This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gottschalk, J. Articles by Heinzer, I. Search for Related Content PubMed PubMed Citation Articles by Gottschalk, J. Articles by Heinzer, I.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, 01 1996, 41-43, Vol 34, No. 1
Copyright © 1996 by the American Society for Microbiology. All rights reserved.

Discrimination of respiratory syncytial virus subgroups A and B by reverse transcription-PCR

J Gottschalk, R Zbinden, L Kaempf and I Heinzer
Institute of Microbiology, Kantonsspital, Aarau, Switzerland.

Reverse transcription (RT)-PCR with shared primers differentiating respiratory syncytial virus (RSV) subgroups A and B was developed for subtyping of RSV isolates. Results of RT-PCR were compared with those of an indirect immunofluorescence test using monoclonal antibodies. Viral RNA isolated from cell cultures infected with RSV served as a template for cDNA synthesis with random primers. For PCR, we used three synthetic oligonucleotides corresponding to the G protein mRNA sequence of subgroup A (bases 248 to 267; 3'ATGCAACAAGCCAGATCAAG), subgroup B (bases 314 to 333; 3'ACTCATCCAAACAACCCACA), or both (bases 511 to 530; 3'GGWACAAARTTGAACACTTC). PCR products of RSV subgroups A and B had molecular sizes of 283 and 217 bp, respectively. Specific cutting sites for RSV A and B in amplified cDNA were demonstrated by restriction fragment analysis with four restriction endonucleases. Our RT-PCR assay divided 68 RSV isolates into 47 strains of subgroup A and 21 strains of subgroup B in full agreement with subtyping by monoclonal antibodies. RT-PCR seems to be a good alternative to subtyping of RSV with monoclonal antibodies.

This article has been cited by other articles:

• Zlateva, K. T., Vijgen, L., Dekeersmaeker, N., Naranjo, C., Van Ranst, M. (2007). Subgroup Prevalence and Genotype Circulation Patterns of Human Respiratory Syncytial Virus in Belgium during Ten Successive Epidemic Seasons. J. Clin. Microbiol. 45: 3022-3030 [Abstract] [Full Text]  
• Rajala, M. S., Sullender, W. M., Prasad, A. K., Dar, L., Broor, S. (2003). Genetic Variability among Group A and B Respiratory Syncytial Virus Isolates from a Large Referral Hospital in New Delhi, India. J. Clin. Microbiol. 41: 2311-2316 [Abstract] [Full Text]  
• Sullender, W. M. (2000). Respiratory Syncytial Virus Genetic and Antigenic Diversity. Clin. Microbiol. Rev. 13: 1-15 [Abstract] [Full Text]