Previous Article | Next Article 
Journal of Clinical Microbiology, January 1998, p. 317-320, Vol. 36, No. 1
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Use of a Gastric Juice-Based PCR Assay To Detect
Helicobacter pylori Infection in Culture-Negative
Patients
Haruhiko
Yoshida,1,*
Katsutaro
Hirota,2
Yasushi
Shiratori,1
Takeshi
Nihei,2
Shin
Amano,2
Akira
Yoshida,3
Osamu
Kawamata,3 and
Masao
Omata1
Second Department of Internal Medicine,
University of Tokyo, Tokyo 113,1
Department of Internal Medicine, Mito Saiseikai Hospital,
Ibaraki 311-41,2 and
Center for
Molecular Biology and Cytogenetics, SRL Inc., Tokyo
192,3 Japan
Received 16 June 1997/Returned for modification 10 September
1997/Accepted 20 October 1997
 |
ABSTRACT |
A gastric juice-based PCR assay was compared with culture,
microscopy, and a rapid urease test with specimens from 114 subjects. The PCR and conventional tests were positive for 76 and 62% of the
subjects, respectively. The prevalence of gastroduodenal disease and
seropositivity for anti-Helicobacter pylori immunoglobulin G were similarly high among conventional-test-positive and
PCR-only-positive subjects compared to all-negative ones. The PCR assay
is recommended to confirm the H. pylori status of
culture-negative peptic-ulcer patients.
| |
TEXT |
Helicobacter pylori,
discovered by Warren and Marshall in 1983 (20, 21), is now
known to be strongly associated with chronic gastritis, peptic ulcers,
and gastric cancer (1, 5, 8, 14). Treatment with
antimicrobial agents was recommended for peptic ulcer patients with
H. pylori infection by a National Institutes of Health
consensus panel in 1994 (14) and has gained general acceptance by gastroenterologists worldwide. However, diagnosing H. pylori infection is sometimes difficult.
Traditionally, culturing the pathogen is considered the "gold
standard" for the diagnosis of infectious diseases. However, diagnosing H. pylori infection by culture alone may have
certain limitations. Most importantly, there are possible false
negatives due to sampling error because the culture, using biopsy
specimens, can assess infection only at the biopsy sites
(14). Microscopic examination and the rapid urease test can
be highly specific if strictly performed, but they are based on biopsy
specimens and thus are theoretically prone to sampling error, as in the
case of culture.
The urea breath test, now recognized as a sensitive diagnostic
procedure, measures urease activity in the entire stomach and is
presumably except from sampling error (7, 13). However, the
urea breath test sometimes becomes apparently positive in culture-negative patients (4, 18). Since the presence of urease activity is not direct proof of the presence of H. pylori, these cases may be determined to be false positives as
long as the culture is used as the gold standard.
Sensitive PCR assays using biopsy specimens have been reported (2,
6, 17, 19), but the sensitivities of previous PCR assays on
gastric juice were at most comparable to culture (12, 17, 19,
22). However, we have established a seminested PCR assay,
designated as URA-PCR, targeting the well-conserved regions in the
ureA gene of H. pylori (11). The
URA-PCR surpassed previous PCR assays in sensitivity (2, 9,
11), and gastric juice samples were applicable for the URA-PCR
assay, thereby avoiding sampling error.
Like the urea breath test, the URA-PCR assay sometimes yields positive
results for culture-negative patients. Unlike the urea breath test,
however, positive PCR amplification of H. pylori-specific DNA may be considered as direct evidence of the presence of the pathogen. In the present study, we compared the PCR assay with conventional biopsy-based tests for 114 consecutive patients, putting
emphasis on the analysis of cases with discrepancies. In addition, we
used disposable capsuled strings (15) to collect gastric
juice. The primary purpose of using this device was to avoid
contamination, but this simple and less invasive procedure may be
clinically valuable for obtaining gastric juice samples without
repeating endoscopy.
Subjects.
One hundred and fourteen consecutive Mito Saiseikai
Hospital patients (71 male, 43 female; mean age, 49 years; range, 23 to 73 years) for which gastroduodenal endoscopy was indicated were enrolled in this study. None had received antimicrobial therapy against
H. pylori before, nor had any of them been subjected to long-term administration of any antibiotic in the previous year. Patients taking nonsteroidal anti-inflammatory drugs were excluded. The
ethical committee of the hospital approved the protocol, and informed
consent was obtained from all subjects.
Gastric juice samples.
Gastric juice samples were obtained by
use of capsuled nylon strings [Entero-Test; HDC Corp., San Jose,
Calif.] after the patients had fasted overnight. For this device, a
highly absorbent nylon string (140 cm) was packed inside a gelatin
capsule (8 by 23 mm). Subjects were instructed to swallow a capsule
with water, with the free end of the string secured outside the mouth.
Once inside the stomach, the capsule dissolves and the string avidly absorbs gastric juice. The string is left in place for 30 min and then
withdrawn through the mouth. About 0.5 ml of gastric juice is absorbed
by 10 cm of the string, an amount which is sufficient for the PCR assay
described below.
PCR amplification of H. pylori DNA.
We designed
novel primers for the URA-PCR assay by targeting the ureA
gene of H. pylori because this gene is unique to this pathogen. Since diversity of the nucleotide sequence of the
ureA gene exists, we analyzed nucleotide conservation among
clinical isolates by full-length sequencing of the gene and by using
selected PCR primers that targeted well-conserved regions.
Three primers, A-2F2 (nucleotides 2783 to 2804;
5'ATATTATGGAAGAAGCGAGAGC3'), A-2F3 (nucleotides 2893 to
2912; 5'CATGAAGTGGGTATTGAAGC3'), and A-2R (nucleotides 3096 to 3076; 5'ATGGAAGTGTGAGCCGATTTG3'), were selected for use
in the URA-PCR; the initial amplification was performed with primers
A-2F2 and A-2R, and the internal amplification was performed with
primers A-2F3 and A-2R. Details of the procedure were described
previously (11). DNA samples extracted from 38 bacterial
species other than H. pylori (including H. cinaedi, H. fennelliae, and H. pametensis)
were not amplified by the PCR assay.
Endoscopic examination.
After the gastric juice sampling
described above was completed, gastroduodenal endoscopies were
performed with endoscopes which had been thoroughly washed in an
automatic endoscope cleaner (16). Endoscopic diagnoses were
made by one of the authors (K.H.), without information on the results
of H. pylori assays (Table 1).
Biopsy-based tests.
Two gastric biopsy specimens each were
obtained from the gastric antrum and corpus on the greater curvature.
One specimen was immediately placed in transfer medium and then
cultured on blood agar medium in a microaerophilic environment (Campy
Pouch; Becton Dickinson, Cockeysville, Md.). Positive cultures were
confirmed by determination of urease, catalase, and oxidase activities. The other specimen was smeared on a glass, gram stained,
microscopically examined for the presence of gram-negative bacilli, and
then used for the rapid urease test (CLO test; Delta West, Bentley,
Western Australia) with a 2-h incubation at 37°C. These biopsy-based
tests were considered positive if at least one specimen, obtained from either the antrum or corpus, had a positive result.
Serum anti-H. pylori IgG.
At the time he or she
entered the study, each subject was tested for serum anti-H.
pylori immunoglobulin G (IgG) by use of the Pilicaplate G
Helicobacter enzyme immunoassay kit (Biomerica, Newport Beach, Calif.).
The assay was determined positive if the increase in the optical
density at 405 nm exceeded that of a 1:16 dilution of the serum
standard contained in the kit.
Antimicrobial therapy.
Five randomly selected subjects who
were negative for H. pylori by any biopsy-based test
(culture, microscopy, or the rapid urease test) but positive by the PCR
assay were treated with amoxicillin (500 mg three times a day orally
[p.o.]) and lansoprazole (30 mg once daily p.o.) for 14 days. Another
four subjects who were positive by both the biopsy-based tests and the
PCR assay were similarly treated. Gastric juice samples were collected
with the capsuled string, as described above, at the cessation of
therapy and 2 and 4 weeks later, and H. pylori DNA was
assessed by the PCR assay.
Statistical analyses.
Student's t test, chi-square
test, and Fisher's exact probability test were used when applicable,
and a difference with a P value of <0.05 was considered
statistically significant.
The gastric juice-based URA-PCR assay (Fig.
1) was positive for 87 (76%) subjects,
whereas the biopsy-based tests, i.e., culture,
microscopy, and the
rapid urease test, were positive for only
65 (57%), 66 (58%), and 70 (61%) subjects, respectively (Table
2).
At least one of the three biopsy-based tests was positive
for 71 (62%)
subjects, and these subjects were designated as biopsy
positives in the
following text.
View larger version (94K):
[in this window]
[in a new window]
|
FIG. 1.
PCR amplification of the H. pylori ureA gene.
Samples 1, 2, 5, and 8 were positive for ureA, and samples
3, 4, 6, and 7 were negative for ureA. P, positive control
showing the first and second PCR products; N, negative control; C,
controls with artificial templates yielding amplicons with different
lengths; M, molecular size markers.
|
|
The detection rate of
H. pylori infection, as determined by
each assay, was higher in subjects with peptic ulcers or chronic
gastritis than in subjects with normal gastric mucosae (Table
2).
However, for subjects with peptic ulcers and chronic gastritis,
the
detection rate by the PCR assay was significantly higher than
that by
biopsy-based tests. These data indicated that a significant
portion of
subjects with positive endoscopic findings were biopsy
negative but PCR
positive. It was crucial to determine whether
they had actual
H. pylori infections because antimicrobial therapy
might be indicated
if they did harbor infection.
Results were further analyzed by dividing subjects into four
categories: PCR positive and biopsy positive (
n = 69;
61%), PCR
positive and biopsy negative (
n = 18; 16%),
PCR negative and biopsy
positive (
n = 2; 2%), and all
negative (
n = 25; 22%) (Table
3).
The biopsy-negative but PCR-positive
group constituted the major
concern in the current study.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Correlation between PCR and biopsy-based test results,
endoscopic findings, and presence of anti-H. pylori
antibodies in serum for 114 subjectsa
|
|
We first analyzed the distribution of endoscopic findings among the
four categories. The majority of PCR-positive subjects
had peptic
ulcers or chronic gastritis irrespective of the results
of biopsy-based
tests: 62 (90%) of 69 biopsy-positive, PCR-positive
subjects and 16 (89%) of 18 biopsy-negative, PCR-positive subjects
had either peptic
ulcers or chronic gastritis. In contrast, only
3 (12%) of 25 all-negative subjects had peptic ulcers or chronic
gastritis. The rate
of positive endoscopic findings was significantly
lower in the
all-negative group than in the biopsy-negative but
PCR-positive group
(
P < 0.0001).
We then analyzed the rates of serum anti-
H. pylori IgG
positivity among the categories (Table
3). The seropositivity was
similarly high in the biopsy-positive, PCR-positive group (69
of 69 [100%]) and in the biopsy-negative, PCR-positive group (17
of 18 [94%]) but was significantly lower in the all-negative group
(7 of
25 [28%]). Thus, the biopsy-negative but PCR-positive subjects
were
similar to biopsy-positive subjects and different from all-negative
subjects serologically as well as endoscopically. It should be
mentioned, however, that 7 (25%) of the 25 subjects who were negative
by both the PCR and biopsy-based tests were seropositive. We do
not
know whether these cases represent past (cured) infection,
ongoing
infection undetected by any other test, or falsely detected
antibodies.
To further prove that the biopsy-negative but PCR-positive subjects
harbored ongoing
H. pylori infections, we randomly selected
five of them and treated them after obtaining informed consent.
The
URA-PCR assay was performed on sequentially sampled gastric
juice. The
PCR assay was negative for all subjects at the completion
of antibiotic
administration, and it remained negative for four
of them but became
positive afterward for one (Table
4).
These
data strongly suggest that the PCR assay reflected the clearance
and the eradication (or its failure) of
H. pylori in the
biopsy-negative
but PCR-positive subjects, as it did in the
biopsy-positive ones
(Table
4). The data also indicated that
H. pylori that had been
rendered nonviable by antibiotics had been
washed away from the
stomach and did not affect the PCR assay by day 14 of the treatment.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Results of sequential PCR assay performed after
antimicrobial therapy on randomly selected subjects positive only
by PCR and in subjects positive also by
biopsy-based testsa
|
|
Instead of selecting one modality as the gold standard, we analyzed
characteristics of subjects in relation to the results
of assays and
demonstrated that the biopsy-negative but PCR-positive
subjects were
similar to the biopsy-positive subjects in terms
of endoscopic findings
and the seropositivity of anti-
H. pylori IgG and were
significantly different from the biopsy- and PCR-negative
ones.
Although the presence of gastroduodenal disease or serum
antibodies is
not direct evidence of ongoing
H. pylori infection,
the most
probable explanation is that the PCR assay detected
H. pylori infections that were not detected by culture or
biopsy-based
tests.
The results of three biopsy-based tests (culture, microscopy, and the
rapid urease test) agreed in most cases: all were negative
in 43 (38%)
cases (the PCR was positive in 18 of them), and all
were positive in 62 (54%) cases. Thus, sampling error caused by
obtaining biopsies only at
uninfected sites seems to be responsible
for false negatives in
biopsy-based tests. Atrophy and intestinal
metaplasia associated with
H. pylori infection progress with age
(
10),
reducing the habitable gastric surface for
H. pylori
(
3).
Thus, older patients may be more liable to have
false-negative
results due to sampling error. In fact, the
biopsy-negative, PCR-positive
subjects in the current study were
significantly older than the
biopsy-positive ones (54 ± 11 years
versus 49 ± 11 years;
P <
0.05). This line of
reasoning would suggest that the sensitivity
of biopsy-based tests
might be improved by obtaining more specimens
from various sites in the
stomach. However, an increase in the
number of biopsy sites would be
accompanied by higher costs and
a longer duration of endoscopic
examination, and the number of
available biopsy specimens is
practically limited.
Perez-Trallero and colleagues obtained gastric juice with the capsuled
string and used it for culture (
15). However, we
have found
that cultures using gastric juice obtained in this
manner are sometimes
affected by contaminating bacteria (unpublished
observation). At
present, the susceptibility of
H. pylori to individual
antibiotics can be assessed only by culturing biopsy specimens.
In
addition, diseases such as gastric cancer are sometimes revealed
unexpectedly by gastroduodenal endoscopy. We thus recommend that
gastroduodenal endoscopy be performed initially in the screening
of
patients. However, we also recommend the additional use of
the URA-PCR
assay for the confirmation of
H. pylori status, especially
for culture-negative patients with peptic ulcers or chronic gastritis.
Gastric juice samples aspirated through the endoscope and stored
frozen
can be used afterward for the PCR assay (data not shown).
Alternatively, gastric juice samples can be obtained with the
capsuled
string without repeating the endoscopy procedure. The
assessment of the
outcome of antimicrobial therapy may be another
clinical application of
the PCR assay. With the use of the string,
endoscopy need not be
repeated. This possibility is now under
investigation, and preliminary
data indicate that the PCR assay
is at least as sensitive as the urea
breath test for monitoring
relapses after therapy. A commercially
available kit for
H. pylori detection based on the URA-PCR
assay is now being prepared (SRL
Inc., Tokyo, Japan).
In conclusion, 18 (16%) of 114 subjects were negative for
H. pylori by culture, microscopy, and the rapid urease
test but
positive by the URA-PCR assay. These subjects were similar to
culture-positive subjects and distinct from all-negative subjects
both
endoscopically and serologically, and they should be regarded
as having
ongoing infections. Nine (16%) of 57 ulcer patients
belonged in this
category and would have benefited from antimicrobial
therapy. The use
of the URA-PCR assay is also recommended to confirm
the
H. pylori status of patients who are negative for
H. pylori by conventional biopsy-based tests.
| |
ACKNOWLEDGMENTS |
This work was supported in part by a Grant-in-Aid for General
Scientific Research from the Ministry of Education, Japan.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Second
Department of Internal Medicine, Faculty of Medicine, University of
Tokyo, Hongo 7-3-1, Bunkyo, Tokyo 113, Japan. Phone: 81-3-3815-5411. Fax: 81-3-3814-0021. E-mail:
yoshida-2im{at}h.u-tokyo.ac.jp.
| |
REFERENCES |
| 1.
|
Blaser, M. J.,
P. H. Chyou, and A. Nomura.
1995.
Age at establishment of Helicobacter pylori infection and gastric carcinoma, gastric ulcer, and duodenal ulcer risk.
Cancer Res.
55:562-565[Abstract/Free Full Text].
|
| 2.
|
Clayton, C. L.,
H. Kleanthous,
P. J. Coates,
D. D. Morgan, and S. Tabaqchali.
1992.
Sensitive detection of Helicobacter pylori by using polymerase chain reaction.
J. Clin. Microbiol.
30:192-200[Abstract/Free Full Text].
|
| 3.
|
Craanen, M. E.,
P. Blok,
W. Dekker, and G. N. J. Tytgat.
1992.
Subtypes of intestinal metaplasia and Helicobacter pylori.
Gut
33:597-600[Abstract/Free Full Text].
|
| 4.
|
Cutler, A. F.,
S. Havstad,
C. K. Ma,
M. J. Blaser,
G. I. Perez-Perez, and T. T. Schubert.
1995.
Accuracy of invasive and noninvasive tests to diagnose Helicobacter pylori infection.
Gastroenterology
109:136-141[Medline].
|
| 5.
|
EUROGAST Study Group.
1993.
An international association between Helicobacter pylori infection and gastric cancer.
Lancet
341:1359-1362[Medline].
|
| 6.
|
Fabre, R.,
I. Sobhani,
P. Laurent-Puig,
N. Hedef,
N. Yazigi,
C. Vissuzaine,
I. Rodde,
F. Potet,
M. Mignon,
J. P. Etienne, and M. Braquet.
1994.
Polymerase chain reaction assay for the detection of Helicobacter pylori in gastric biopsy specimens: comparison with culture, rapid urease test, and histopathological tests.
Gut
35:905-908[Abstract/Free Full Text].
|
| 7.
|
Graham, D. Y.,
P. D. Klein,
D. J. Evans, Jr.,
D. G. Evans,
L. C. Alpert,
A. R. Opekun, and T. W. Boutton.
1987.
Campylobacter pylori detected noninvasively by the 13C-urea breath test.
Lancet
i:1174-1177.
|
| 8.
|
Hansson, L. E.,
L. Engstrand,
O. Nyren,
D. J. Evans, Jr.,
A. Lindgren,
R. Bergstrom,
B. Andersson,
L. Athlin,
O. Bendtsen, and P. Tracz.
1993.
Helicobacter pylori infection: independent risk indicator of gastric adenocarcinoma.
Gastroenterology
105:1098-1103[Medline].
|
| 9.
|
Ho, S.-A.,
J. A. Hoyle,
F. A. Lewis,
A. D. Secker,
D. Cross,
N. P. Mapstone,
M. F. Dixon,
J. I. Wyatt,
D. S. Tompkins,
G. R. Taylor, and P. Quirke.
1991.
Direct polymerase chain reaction test for detection of Helicobacter pylori in humans and animals.
J. Clin. Microbiol.
29:2543-2549[Abstract/Free Full Text].
|
| 10.
|
Katelaris, P. H.,
F. Seow,
B. P. C. Lin,
J. Napoli,
M. C. Ngu, and D. B. Jones.
1993.
Effects of age, Helicobacter pylori infection, and gastritis with atrophy on serum gastrin and gastric acid secretion in healthy men.
Gut
34:1032-1037[Abstract/Free Full Text].
|
| 11.
|
Kawamata, O.,
H. Yoshida,
K. Hirota,
A. Yoshida,
R. Kawaguchi,
Y. Shiratori, and M. Omata.
1996.
Nested-polymerase chain reaction for the detection of Helicobacter pylori infection with novel primers designed by sequence analysis of urease A gene in clinically isolated bacterial strains.
Biochem. Biophys. Res. Commun.
219:266-272[Medline].
|
| 12.
|
Mapstone, N. P.,
D. A. Lynch,
F. A. Lewis,
A. T. Axon,
D. S. Tompkins,
M. F. Dixon, and P. Quirke.
1993.
Identification of Helicobacter pylori DNA in the mouths and stomachs of patients with gastritis using PCR.
J. Clin. Pathol.
46:540-543[Abstract/Free Full Text].
|
| 13.
|
Marshall, B. J., and I. Surveyor.
1988.
Carbon-14-urea breath test for the diagnosis of Campylobacter pylori-associated gastritis.
J. Nucl. Med.
29:11-16[Abstract/Free Full Text].
|
| 14.
|
NIH Consensus Development Panel on Helicobacter pylori in Peptic Ulcer Disease.
1994.
Helicobacter pylori in peptic diseases.
JAMA
272:65-69[Abstract/Free Full Text].
|
| 15.
|
Perez-Trallero, E.,
M. Montes,
M. Alcorta,
P. Zubillaga, and E. Telleria.
1995.
Non-endoscopic method to obtain Helicobacter pylori for culture.
Lancet
345:622-623[Medline].
|
| 16.
|
Roosendaal, R.,
E. J. Kuipers,
A. J. C. van den Brule,
A. S. Peña,
A. M. Uyterlinde,
J. M. M. Walboomers,
S. G. M. Meuwissen, and J. de Graaff.
1994.
Importance of the fiberoptic endoscopic cleaning procedure for detection of Helicobacter pylori in gastric biopsy specimens by PCR.
J. Clin. Microbiol.
32:1123-1126[Abstract/Free Full Text].
|
| 17.
|
Shimada, T.,
K. Ogura,
S. Ota,
A. Terano,
M. Takahashi,
E. Hamada,
M. Omata,
S. Sumino, and R. Sasa.
1994.
Identification of Helicobacter pylori in gastric specimens, gastric juice, saliva, and faeces of Japanese patients.
Lancet
343:1636-1637[Medline].
|
| 18.
|
Thijs, J. C.,
A. A. van Zwet,
W. J. Thijs,
H. B. Oey,
A. Karrenbeld,
F. Stellaard,
D. S. Luijt,
B. C. Meyer, and J. H. Kleibeuker.
1996.
Diagnostic tests for Helicobacter pylori: a prospective evaluation of their accuracy, without selecting a single test as the gold standard.
Am. J. Gastroenterol.
91:2125-2129[Medline].
|
| 19.
|
Valentine, J. L.,
R. R. Arthur,
H. L. T. Mobley, and J. D. Dick.
1991.
Detection of Helicobacter pylori by using the polymerase chain reaction.
J. Clin. Microbiol.
29:689-695[Abstract/Free Full Text].
|
| 20.
|
Warren, J. R., and B. J. Marshall.
1983.
Unidentified curved bacilli on gastric epithelium in active chronic gastritis.
Lancet
i:1273-1275.
|
| 21.
|
Warren, J. R., and B. J. Marshall.
1984.
Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration.
Lancet
i:1311-1315.
|
| 22.
|
Westblom, T. U.,
S. Phadnis,
P. Yang, and S. J. Czinn.
1993.
Diagnosis of Helicobacter pylori infection by means of a polymerase chain reaction assay for gastric juice aspirates.
Clin. Infect. Dis.
16:367-371[Medline].
|
Journal of Clinical Microbiology, January 1998, p. 317-320, Vol. 36, No. 1
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Megraud, F., Lehours, P.
(2007). Helicobacter pylori Detection and Antimicrobial Susceptibility Testing. Clin. Microbiol. Rev.
20: 280-322
[Abstract]
[Full Text]
-
ALLAKER, R.P., YOUNG, K.A., HARDIE, J.M., DOMIZIO, P., MEADOWS, N.J.
(2002). Prevalence of Helicobacter pylori at oral and gastrointestinal sites in children: evidence for possible oral-to-oral transmission. J Med Microbiol
51: 312-317
[Abstract]
[Full Text]
-
Yamaji, Y, Mitsushima, T, Ikuma, H, Okamoto, M, Yoshida, H, Kawabe, T, Shiratori, Y, Saito, K, Yokouchi, K, Omata, M
(2001). Inverse background of Helicobacter pylori antibody and pepsinogen in reflux oesophagitis compared with gastric cancer: analysis of 5732 Japanese subjects. Gut
49: 335-340
[Abstract]
[Full Text]
-
Torres, J., Camorlinga, M., Pérez-Peréz, G., Gonzalez, G., Muñoz, O.
(2001). Validation of the String Test for the Recovery of Helicobacter pylori from Gastric Secretions and Correlation of Its Results with Urea Breath Test Results, Serology, and Gastric pH Levels. J. Clin. Microbiol.
39: 1650-1651
[Abstract]
[Full Text]
-
Samuels, A. L., Windsor, H. M., Ho, G. Y., Goodwin, L. D., Marshall, B. J.
(2000). Culture of Helicobacter pylori from a Gastric String May Be an Alternative to Endoscopic Biopsy. J. Clin. Microbiol.
38: 2438-2439
[Abstract]
[Full Text]
-
RUIZ-BUSTOS, E., SIERRA-BELTRAN, A., ROMERO, M.J., RODRIGUEZ-JARAMILLO, C., ASCENCIO, F.
(2000). Protection of BALB/c mice against experimental Helicobacter pylori infection by oral immunisation with H. pylori heparan sulphate-binding proteins coupled to cholera toxin {beta}-subunit. J Med Microbiol
49: 535-541
[Abstract]
[Full Text]
-
YOUNG, K.A., AKYON, Y., RAMPTON, D.S., BARTON, S.G. R. G., ALLAKER, R.P., HARDIE, J.M., FELDMAN, R.A.
(2000). Quantitative culture of Helicobacter pylori from gastric juice: the potential for transmission. J Med Microbiol
49: 343-347
[Abstract]
[Full Text]
-
Maeda, S., Yoshida, H., Matsunaga, H., Ogura, K., Kawamata, O., Shiratori, Y., Omata, M.
(2000). Detection of Clarithromycin-Resistant Helicobacter pylori Strains by a Preferential Homoduplex Formation Assay. J. Clin. Microbiol.
38: 210-214
[Abstract]
[Full Text]
-
Maeda, S, Yoshida, H, Ogura, K, Kanai, F, Shiratori, Y, Omata, M
(1998). Helicobacter pylori specific nested PCR assay for the detection of 23S rRNA mutation associated with clarithromycin resistance. Gut
43: 317-321
[Abstract]
[Full Text]
Top
Abstract
Text
