Previous Article | Next Article 
Journal of Clinical Microbiology, October 1998, p. 2877-2881, Vol. 36, No. 10
Liverpool School of Tropical Medicine,
Liverpool L3 5QA, United Kingdom,1 and
Health Net International, University Town, Peshawar,
Pakistan2
Received 21 January 1998/Returned for modification 27 April
1998/Accepted 1 July 1998
A nested PCR was developed to amplify the variable region of the
kinetoplast minicircles of all Leishmania species which
infect mammals. Each Leishmania parasite contains
approximately 10,000 kinetoplast DNA minicircles, which are unequally
distributed among approximately 10 minicircle classes. The PCR primers
were designed to bind within the 120-bp conserved region which is
common to all minicircle classes; the remaining approximately 600 bp of each minicircle is highly conserved within each minicircle class but
highly divergent between classes. The nested PCR generated a strong
signal from a minimum of 0.1 fg of Leishmania DNA.
Restriction digests of the amplicons from the highest dilutions
suggested that minicircles from only a limited number of minicircle
classes had acted as template in the reaction. One PCR product was
directly sequenced and found to be derived from only one minicircle
class. Since the primers amplify all minicircle classes, this indicated that as little as 1/10 of one Leishmania parasite was
present in the PCR template. This demonstrated that the nested PCR
achieved very nearly the maximum theoretically possible sensitivity and is therefore a potentially useful method for diagnosis. The nested PCR
was tested for sensitivity on 20 samples from patients from the
Timargara refugee camp, Pakistan. Samples were collected by scraping
out a small amount of tissue with a scalpel from an incision at the
edge of the lesion; the tissue was smeared on one microscope slide and
placed in a tube of 4 M guanidine thiocyanate, in which the sample was
stable for at least 1 month. DNA for PCR was prepared by being bound to
silica in the presence of 6 M guanidine thiocyanate; washed in
guanidine thiocyanate, ethanol, and acetone; and eluted with 10 mM
Tris-HCl. PCR products of the size expected for Leishmania tropica were obtained from 15 of the 20 samples in at least one of three replicate reactions. The negative samples were from lesions that had been treated with glucantime or were over 6 months old, in
which parasites are frequently scanty. This test is now in routine use
for the detection and identification of Leishmania parasites in our clinical laboratory. Fingerprints produced by restriction digests of the PCR products were defined as complex or
simple. There were no reproducible differences between the complex
restriction patterns of the kinetoplast DNA of any of the parasites
from Timargara camp with HaeIII and HpaII. The
simple fingerprints were very variable and were interpreted as being the product of PCR on a limited subset of minicircle classes, and
consequently, it was thought that the variation was determined by the
particular minicircle classes that had been represented in the
template. The homogeneity of the complex fingerprints suggests that the
present epidemic of cutaneous leishmaniasis in Timargara camp may be
due to the spread of a single clone of L. tropica.
PCR-based methods for detecting
Leishmania species in clinical samples have been developed
to amplify rRNA and miniexon genes, kinetoplast DNA (kDNA), and
repetitive nuclear DNA sequences (7, 13, 16, 17, 19). These
methods are of varying specificity: some will detect all
Leishmania species while other methods will identify the
infecting Leishmania parasite to the species complex level.
This information is usually sufficient for diagnostic purposes; however, higher-resolution identification is often required for understanding the epidemiology of leishmaniasis. However, it is necessary to isolate parasites in culture before using any of the
existing high-resolution techniques such as isoenzymes, randomly amplified polymorphic DNA analysis, and schizodemes. Recovery of
parasites in culture is rarely more than about 70% efficient even with
easily cultured parasites. Leishmania braziliensis is frequently difficult to isolate, and in Tunisia, Leishmania
infantum parasites causing cutaneous lesions have never been
successfully cultured in the standard NNN blood agar medium used for
the isolation of Leishmania (5). Furthermore, it
is possible that mixed infections will be missed due to the different
growth rates of different strains in blood agar culture
(10).
The kinetoplast, an organelle unique to the kinetoplastids, contains
approximately 10,000 small circular DNAs known as kDNA minicircles
which are between 600 and 800 bp in size in members of the genus
Leishmania. The abundance of these molecules has made them
the target for a number of diagnostic tests (2, 4, 5).
Kinetoplast minicircles code for guide RNAs that are involved in
editing the mitochondrial genes of trypanosomatids. The 10,000 kinetoplast minicircles are distributed among about 10 different sequence classes. Within each minicircle class, sequences may vary by 1 or 2%. The number of minicircles in each class is very variable
(4). The minicircle is divided into an approximately 120-bp
conserved region and an approximately 600-bp variable region. The
conserved region contains shorter blocks that are conserved throughout
the genus Leishmania and in some other trypanosomatids as
well. These conserved sequence blocks are ideal targets for PCR primers
which can amplify all known minicircle classes from all
Leishmania species. The high copy number of the
Leishmania minicircles makes them an ideal target for
diagnostic tests. The heterogeneity of the variable region has been
exploited to discriminate between strains of the same species.
Digestion of the kinetoplast DNA with restriction enzymes yields
fingerprint patterns that vary considerably within each
Leishmania species. Populations that are defined by shared
fingerprint patterns are known as schizodemes, and the technique is
known as schizodeme analysis. Schizodeme analysis has been widely used
in the New World for the classification of Leishmania and
Trypanosoma cruzi. The fingerprint patterns themselves
provide one of the most specific ways available to identify
Leishmania strains (1, 9). kDNA for schizodeme analysis has usually been prepared by differential centrifugation of
total DNA from cultured parasites, although it has been shown that kDNA
can also be prepared by PCR amplification of purified parasite DNA
(3, 15). A nested-PCR-based schizodeme method that permits
both very sensitive detection and high-resolution identification of
Leishmania parasites directly from clinical samples is
presented here.
Clinical samples.
DNA was prepared from clinical samples
collected during a prevalence survey in the Timargara refugee camp. The
Timargara refugee camp, in Dir in northwest Pakistan, is a settled camp
of 15 years' standing. There are about 10,000 residents, mostly
refugees from the Kabul area of Afghanistan. Small numbers of cases of
cutaneous leishmaniasis have been observed since 1993. In 1997, a major outbreak occurred, with up to 20% of the population of the camp being
affected. Lesions consistent with cutaneous leishmaniasis were cleaned
with soap and water and swabbed with ethanol. Samples were taken by
using a sterile scalpel to make an incision in the border of the
lesion, and a small amount of material was scraped out. The sample was
divided between one thin smear on a microscope slide and an Eppendorf
tube containing 500 µl of 4 M guanidine thiocyanate (GuSCN)-0.25 M
EDTA. Microscope slides were stained with Giemsa stain for direct
detection of parasites; GuSCN lysates were stored at 4°C for 1 month
until shipment to the United Kingdom at ambient temperature for PCR
analysis.
Preparation of DNA samples.
Template DNA was extracted from
aliquots of 50, 250, and 100 µl of the GuSCN lysate. Briefly, the
sample was bound to diatomaceous earth (Sigma) in the presence of 6 M
GuSCN, washed with ethanol and acetone, and eluted with 50 µl of 10 mM Tris-HCl (pH 8.4) (6). One microliter of template was
used in the first-round PCR. DNA was both prepared from all 20 samples
and amplified by PCR at least three times. Each replicate batch was
prepared independently from previous batches with fresh sets of
reagents. One set of replicates was prepared in a separate laboratory
that had not previously been used for Leishmania work. DNA
of reference strains was prepared by standard methods (11).
Nested-PCR conditions.
External primers CSB2XF
(C/GA/GTA/GCAGAAAC/TCCCGTTCA) and CSB1XR
(ATTTTTCG/CGA/TTTT/CGCAGAACG) were designed by identifying suitable regions around conserved sequence blocks 1 and 2 in an alignment of kDNA sequences from Leishmania guyanensis,
Leishmania peruviana, L. braziliensis, L. infantum, and Leishmania tropica. The primers were
designed to be external to primers 13Z (ACTGGGGGTTGGTGTAAAATAG) (19), which is homologous to conserved sequence block
3 (18), and LiR (TCGCAGAACGCCCCT)
(15), which is complementary to conserved sequence
block 1. The conserved sequence block 1 is too small for two
independent primers, and consequently, the 10 3' bases of CSB1XR are
the same as the 10 5' bases of LiR. First-round PCR mixtures contained
2.0 mM MgCl2, 200 µM deoxynucleoside triphosphates, 20 mM
(NH4)2SO4, 75 mM Tris-HCl (pH 9.0),
0.01% Tween, 0.4 U of Red Hot Taq (Advanced
Biotechnologies, Leatherhead, United Kingdom), and 40 ng each of
primers CSB2XF and CSB1XR in a final volume of 20 µl. The cycling
conditions were 94°C for 300 s, followed by 30 cycles of 94°C
for 30 s, 55°C for 60 s, and 72°C for 90 s in a
Techne Progene thermocycler. One microliter of a 9:1 dilution in water
of the first-round product was used as template for the second round in
a total volume of 30 µl under the same conditions as those for the
first round, except with primers LiR and 13Z. Three microliters of the
second-round PCR product was loaded onto a 1% agarose gel to confirm
amplification. Positive samples were digested by the addition of 1 U of
restriction enzyme, 1.5 µl of restriction enzyme buffer, and 1.4 µl
of water to 12.5 µl of PCR product and incubation for 16 h. The
restriction digests were separated on a 1.5% 1:1 Nusieve-normal
agarose gel to visualize the schizodeme patterns. Samples were tested
for the presence of amplifiable human DNA with primers for exon 8 of
the single-copy human p53 tumor suppressor gene (8/9LEB,
TTGGGAGTAGATGGAGCCT, and 8/9RE, AGTGTTAGACTGGAAACTTT)
(12). These primers generate a 445-bp product and were
used under the same conditions as those for the nested PCR.
DNA sequencing.
DNA for sequencing was prepared by the
nested PCR. The first-round product was reamplified with primers LiR
and 13Z in a total volume of 100 µl. Primers and deoxynucleoside
triphosphates were removed on an S400 spin column (Pharmacia), the DNA
was precipitated with ethanol, and the sample was submitted for cycle
sequencing with primers LiR and 13Z on an ABI Prism Model 377 cycle
sequencer.
Nucleotide sequence accession number.
Nucleotide sequence
data reported in this paper have been submitted to the GenBank database
with the accession no. AF032997.
Specificity of PCR.
The nested primer set was tested on DNA
from a panel of Leishmania species and was found to generate
a single major product from representatives of all major species
complexes of Leishmania that are infective of humans (Fig.
1). No product was detected from DNA of
Trypanosoma brucei rhodesiense or from the lizard Leishmania parasite Leishmania tarentolae. kDNA
from Endotrypanum monterogeii, a closely related parasite of
sloths, was amplified. A product of 300 bp was amplified from 10 pg of
purified T. cruzi DNA but not from a clinical sample from a
T. cruzi-infected patient (Fig. 1, lanes 14 and 15).
L. tropica generated the largest Leishmania species PCR product (750 bp) and could be distinguished with care from
L. infantum (680 bp) and more easily from Leishmania
major (560 bp). It was therefore possible to identify the Old
World human-infective Leishmania complexes on the basis of
size alone. The New World L. braziliensis complex could not
be distinguished from Leishmania mexicana on the basis of
size, although the smaller Leishmania amazonensis product
was readily identifiable. The E. monterogeii product (780 bp) was slightly larger than the other New World Leishmania
species products.
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
A Nested-PCR-Based Schizodeme Method for
Identifying Leishmania Kinetoplast Minicircle Classes
Directly from Clinical Samples and Its Application to the Study
of the Epidemiology of Leishmania tropica in
Pakistan
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (28K):
[in a new window]
FIG. 1.
Agarose (1.5%) gel of products of the nested PCR on
various species of trypanosomatid (lanes 1 to 17) and the PCR with
primers for the human p53 gene (lane 18). Lane M, Boehringer
Mannheim molecular weight marker set VI; lane 1, L. amazonensis MHOM/BR/73/LV78; lane 2, L. guyanensis
MHOM/BR/75/M4147; lane 3, Leishmania panamensis
MHOM/NI/87/LS94; lane 4, Leishmania enrietti MCAV/BR/45/L88;
lane 5, L. mexicana MNYC/BZ/62/M379; lane 6, Leishmania chagasi (= L. infantum)
MHOM/HN/87/HN29; lane 7, L. infantum MHOM/TN/80/IPT1; lane
8, L. tropica MHOM/IR/89/ARD22; lane 9, L. tropica MHOM/PK/97/37\13; lane 10, L. major
MHOM/ET/95/FV1 (570 bp); lane 11, L. major MHOM/ET/XX/LV305;
lane 12, E. monterogeii MCHO/CR/62/LV88;A9; lane 13, L. tarentolae RTAR/DZ/39/TarVI;LV414; lane 14, blood sample
collected from patient in Guatemala, positive with T. cruzi-specific primers (8); lane 15, T. cruzi MHOM/BR/78/SilvioX10; lane 16, T. brucei
rhodesiense MHOM/UG/XX/WB25;G; lane 17, negative control; lane 18, primers for p53 human gene on clinical sample 1 from
Pakistan (MHOM/PK/97/12\3]). Numbers at left indicate size in base
pairs.
Sensitivity of PCR.
Decimal dilutions from 500 pg to 1 ag of
L. infantum MHOM/TN/80/IPT1 total DNA µl
1
were amplified by the nested PCR and digested with HaeIII to determine the limit of detection and the effect of concentration on
fingerprint patterns (Fig. 2A). The limit
of detection of the L. infantum DNA was 0.1 fg, equivalent
to approximately 1/500 of a Leishmania genome (5 × 107 bp, 50 fg), which represents about 100 kDNA
minicircles. All products were of similar intensities, suggesting that
template concentration was not limiting in the PCR. The fingerprints of the 100- and 10-fg samples were complex and identical to each other;
however, the fingerprints of the 1- and 0.1-fg samples consisted of one
and two fragments, respectively (Fig. 2A).
|
Sequencing of PCR products. The product of the PCR on 1 fg of MHOM/TN/80/IPT1 DNA (Fig. 2A, lane 3) that had given a single sharp band after digestion was sequenced. A clear sequence signal was obtained with little background, indicating that the sequence had been obtained from a single minicircle class. GenBank was searched for similar sequences with the BLAST program, but no homology was detected with other Leishmania sequences, indicating that this is a novel minicircle class.
Detection of parasites in clinical samples. The sensitivity of the nested PCR was tested on 20 samples collected from patients in the Timargara refugee camp in Pakistan. The clinical signs and results of PCR and microscopy for each case are shown in Table 1. At least three replicate DNA extractions were prepared from 50-, 250-, and 100-µl aliquots of the 500-µl original sample volume. PCR on these replicate DNA preparations produced 11, 14, and 12 positives, respectively, from the 20 samples. These data suggest that the aliquot size did have some effect on the number of positives. However, one sample (MHOM/PK/97/5\2) was negative from 250 µl, but positive from 100 µl, of sample; this may be a false positive or a consequence of clumping in the sample.
|
Schizodeme analysis of clinical samples. The 11 positive samples from the first set of replicates were digested with HaeIII to prepare DNA fingerprints. Seven of the samples had complex fingerprint patterns containing 11 to 12 well-resolved fragments (Fig. 2B; Table 1). Nine of the 12 fragments in the complex fingerprints were present in all samples. A further two or three fragments from a repertoire of four fragments were also present. These variable fragments were not always reproducible in replicate reactions from the same patient sample (Fig. 2B). In contrast, the fingerprints prepared from the L. infantum MHOM/TN/80/IPT1 DNA dilutions were reproducible (Fig. 2A). The four remaining clinical samples each had unique but simpler fingerprints, three of which had only four fragments each (Fig. 2B; Table 1). The simple fingerprints suggest that the nested PCR could detect a fraction of the DNA released from a single parasite.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Sensitivity of the nested PCR. The nested PCR detected extremely small amounts of L. infantum kDNA (0.1 fg), which was shown by sequencing to be derived sometimes from individual minicircle classes. Since the primers are expected to be able to amplify all minicircles present in the template, this implies that only members of one minicircle class were present in the template. This would be the case if there was only one minicircle present in the PCR template; alternatively, some minicircle classes might be preferentially amplified or the classes might be nonrandomly distributed throughout the sample from which the template was taken.
It is unlikely that only single minicircles were present in the template, given the higher-than-expected number of restriction patterns, which were consistent with a single minicircle class, and the absence of negatives that would be expected as a corollary of frequent single minicircles. Preferential amplification of some minicircle classes might occur if the extensive secondary structure found in minicircles reduced the efficiency of amplification of some minicircle classes more than that of others. Nonrandom distribution of minicircles among classes might occur if groups of concatenated minicircles were from the same class.The nested PCR for detection of Leishmania in clinical samples. Fifteen patient samples from the Timargara camp were positive in at least one of three replicate DNA preparations. The five patient samples from the Timargara camp that were negative in all three replicates were also negative by microscopy and were from lesions that had been treated or were over 7 months old, in which parasites are frequently very scanty (Table 1). Therefore, these negatives may reflect either a real absence of parasites from the small quantity of material collected by the smears or a lack of sensitivity in the test. Since there is no "gold standard" for detecting Leishmania parasites, it is not possible to distinguish between these two reasons for negative PCRs. Since 6 of the 23 Leishmania-negative DNA preparations were also negative for the p53 single-copy human gene, some of the negative reactions may have been the consequence of low concentrations of patient material, inefficient DNA extraction, or the presence of inhibitors. However, 2 of the 38 Leishmania-positive DNA preparations were negative with the p53 human gene primers; the Leishmania product in these cases gave simple fingerprint patterns (Fig. 1A, lanes 7 and 8) consistent with very low concentrations of target kDNA. The nested PCR can evidently detect at least some of the 10,000 Leishmania kDNA minicircles, even when a single-round PCR cannot detect a single-copy human gene from the patient sample. This confirms the extreme sensitivity of the nested PCR and suggests that the samples that were positive by the p53 human gene primers and negative by the Leishmania primers really did not contain any Leishmania kDNA. This test is now in routine use for the diagnosis and typing of leishmaniasis in our clinical laboratory in Liverpool, United Kingdom.
Single-round PCR on the 120-bp conserved region of Leishmania minicircles is between 1 and 3 orders of magnitude more sensitive than single-round PCR on the approximately 700-bp variable region which was used in this study (2, 19). Single-round PCR on the conserved region may therefore be more suitable for diagnosis in areas where it is not necessary to identify the infecting species; however, it is less suitable for epidemiological studies, since it is not possible to use the product for high-resolution studies by schizodeme analysis. The clinical appearance of the patients in the Timargara camp from which samples were taken was very variable, as were the number and duration of lesions (Table 1). Given the variability of the pathology and the similarity of the parasites, the outcome of infection with L. tropica in Pakistan may be more dependent on the host response to infection than on the particular strain of parasite involved. The complex fingerprint patterns prepared from the clinical samples were not fully reproducible on replicate DNA preparations from the same clinical sample. In contrast, the fingerprints prepared from the L. infantum MHOM/TN/80/IPT1 DNA dilutions were reproducible (Fig. 2A), as were fingerprints prepared by digestion of products of single-round PCR on phenol-chloroform-extracted DNA from cultured parasites (15). If this fingerprinting method is to be used in epidemiological studies, at least three replicates from each isolate would be necessary to confirm that the fragments included in the analysis were reproducible. The simple fingerprint patterns were an artifact caused by operating at the extreme limits of detection and should be excluded from any analysis of populations. Therefore, provided that caution is exercised in interpreting the fingerprint patterns, the nested PCR followed by schizodeme analysis provides the fastest, most specific, and most sensitive method for identifying Leishmania parasite strains available to date and has considerable potential for epidemiological studies. L. infantum strains from around the Mediterranean are highly variable by schizodeme analysis, and 21 distinct groups have been identified among five zymodemes (1). In contrast, there were no reproducible differences between the L. tropica strains from the Timargara camp in Pakistan with HaeIII and HpaII, and these parasites therefore all belong to the same schizodeme. An L. tropica strain (MHOM/PK/95/05) isolated in another part of Pakistan 2 years previously was distinguished from the samples collected in the Timargara camp by the different mobility of single fragments in both HaeIII and HpaII digests (data not shown). The homogeneous fingerprints of the samples from the Timargara camp are consistent with a recent epidemic spread of a single parasite clone. This is consistent with the significant increase in prevalence of cutaneous leishmaniasis in the Timargara camp. However, further studies of the variability of L. tropica schizodemes will be required before firm conclusions can be reached about the utility of this method for the study of L. tropica epidemiology. There appears to have been a large increase in cutaneous leishmaniasis in Kabul since 1992, and significant outbreaks occurred in parts of eastern Afghanistan and in refugee camps in northwest Pakistan in 1997 for the first time (18a). The PCR-based schizodeme technique has considerable potential for elucidating the association between human migration and the spread of cutaneous leishmaniasis in the region. Since the PCR primers described here have amplified kDNA from all human-infective Leishmania species tested, this method should prove valuable as well in other areas where Leishmania is endemic.| |
ACKNOWLEDGMENTS |
|---|
The apparatus used in this study was purchased out of funds donated by Queen Mary's Roehampton Trust, Wallington, Surrey, United Kingdom, which is gratefully acknowledged.
The p53 gene primers were kindly donated by T. Liloglou, Roy Castle Lung Cancer Research Institute, Liverpool, United Kingdom.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Liverpool School of Tropical Medicine, Pembroke Place, Liverpool L3 5QA, United Kingdom. Phone: 151-708-9393. Fax: 151-708-8733. E-mail: harry{at}liv.ac.uk.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. | Angelici, M. C., M. Gramiccia, and L. Gradoni. 1989. Study on genetic polymorphism of Leishmania infantum through the analysis of restriction enzyme digestion patterns of kinetoplast DNA. Parasitology 99:301-309. |
| 2. | Ashford, D. A., M. Bozza, M. Freire, J. C. Miranda, I. Sherlock, C. Eulalio, U. Lopes, O. Fernandes, W. Degrave, R. H. Barker, Jr., R. Badaro, and J. R. David. 1995. Comparison of the polymerase chain reaction and serology for the detection of canine visceral leishmaniasis. Am. J. Trop. Med. Hyg. 53:251-255. |
| 3. | Avila, H., A. M. Gonçalves, N. Saad Nehme, C. M. Morel, and L. Simpson. 1990. Schizodeme analysis of Trypanosoma cruzi stocks from South and Central America by analysis of PCR-amplified minicircle variable region sequences. Mol. Biochem. Parasitol. 42:175-187[Medline]. |
| 4. | Barker, D. C. 1987. DNA diagnosis of human leishmaniasis. Parasitol. Today 3:177-184. [Medline] |
| 5. | Ben-Ismail, R., D. F. Smith, P. D. Ready, A. Ayadi, M. Gramiccia, A. Ben-Osman, and M. S. Ben-Rachid. 1992. Sporadic cutaneous leishmaniasis in north Tunisia: identification of the causative agent as Leishmania infantum by the use of a diagnostic deoxyribonucleic acid probe. Trans. R. Soc. Trop. Med. Hyg. 86:508-510[Medline]. |
| 6. |
Boom, R.,
C. J. A. Sol,
M. M. M. Salimans,
C. L. Jansen,
P. M. E. Wertheim-van Dillen, and J. van der Noordaa.
1990.
Rapid and simple method for purification of nucleic acids.
J. Clin. Microbiol.
28:495-503 |
| 7. | Delgado, O., P. Guevara, S. Silva, E. Belfort, and J. L. Ramirez. 1996. Follow-up of a human accidental infection by Leishmania (Viannia) braziliensis using conventional immunological techniques and polymerase chain-reaction. Am. J. Trop. Med. Hyg. 55:267-272. |
| 8. | Dorn, P. L., S. Selgean, and M. Guillot. 1997. Simplified method for preservation and polymerase chain reaction amplification of Trypanosoma cruzi DNA in human blood. Mem. Inst. Oswaldo Cruz 92:235-255[Medline]. |
| 9. | Gonçalves, A. M., N. S. Nehme, and C. M. Morel. 1984. Trypanosomatid characterisation by schizodeme analysis, p. 95-109. In C. M. Morel (ed.), Genes and antigens of parasites, 2nd ed. Fundaçao Oswaldo Cruz, Rio de Janeiro, Brazil. |
| 10. | Ibrahim, M. E., A. J. Smyth, M. H. Ali, D. C. Barker, and A. Kharazmi. 1994. The polymerase chain reaction can reveal the occurrence of naturally mixed infections with Leishmania parasites. Acta Trop. 57:327-332[Medline]. |
| 11. | Kelly, J. M. 1993. Isolation of DNA and RNA from Leishmania, p. 123-131. In J. E. Hyde (ed.), Protocols in molecular parasitology, vol. 21. Humana Press, Totowa, N.J. |
| 12. |
Liloglou, T.,
A. G. M. Scholes,
D. A. Spandidios,
E. D. Vaughan,
A. S. Jones, and J. K. Field.
1997.
p53 mutations in squamous cell carcinoma of the head and neck predominate in a subgroup of former and present smokers with a low frequency of genetic instability.
Cancer Res.
57:4070-4074 |
| 13. | Meredith, S. E. O., E. E. Zijlstra, G. J. Schoone, C. C. M. Kroon, G. J. J. M. van Eys, K. U. Schaeffer, A. M. El-Hassan, and P. G. Lawyer. 1993. Development and application of the polymerase chain reaction for the detection and identification of Leishmania parasites in clinical material. Arch. Inst. Pasteur Tunis 70:419-431[Medline]. |
| 14. | Motazedian, H., H. Noyes, and R. Maingon. 1996. Leishmania and Sauroleishmania: the use of random amplified polymorphic DNA for the identification of parasites from vertebrates and invertebrates. Exp. Parasitol. 83:150-154[Medline]. |
| 15. | Noyes, H., M. Chance, C. Ponce, E. Ponce, and R. Maingon. 1997. Leishmania chagasi: genotypically similar parasites from Honduras cause both visceral and cutaneous leishmaniasis in humans. Exp. Parasitol. 85:264-273[Medline]. |
| 16. | Qiao, Z., M. A. Miles, and S. M. Wilson. 1995. Detection of parasites of the Leishmania donovani complex by a polymerase chain reaction-solution hybridization enzyme-linked immunoassay (PCR-SHELA). Parasitology 110:269-275. |
| 17. | Ramos, A., D. A. Maslov, O. Fernandes, D. A. Campbell, and L. Simpson. 1996. Detection and identification of human pathogenic Leishmania and Trypanosoma species by hybridization of PCR-amplified mini-exon repeats. Exp. Parasitol. 82:242-250[Medline]. |
| 18. |
Ray, D. S.
1989.
Conserved sequence blocks in kinetoplast minicircles from diverse species of trypanosomes.
Mol. Cell. Biol.
9:1365-1367 |
| 18a. | Reyburn, H., and M. Rowland. Unpublished observations. |
| 19. | Rodgers, M. R., S. J. Popper, and D. F. Wirth. 1990. Amplification of kinetoplast DNA as a tool in the detection and diagnosis of Leishmania. Exp. Parasitol. 71:267-275[Medline]. |
Journal of Clinical Microbiology, October 1998, p. 2877-2881, Vol. 36, No. 10
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
MARCO, J. D., BHUTTO, A. M., SOOMRO, F. R., BALOCH, J. H., BARROSO, P. A., KATO, H., UEZATO, H., KATAKURA, K., KORENAGA, M., NONAKA, S., HASHIGUCHI, Y.
(2006). MULTILOCUS ENZYME ELECTROPHORESIS AND CYTOCHROME B GENE SEQUENCING-BASED IDENTIFICATION OF LEISHMANIA ISOLATES FROM DIFFERENT FOCI OF CUTANEOUS LEISHMANIASIS IN PAKISTAN.. Am J Trop Med Hyg
75: 261-266
[Abstract] [Full Text] -
ALBORZI, A., RASOULI, M., SHAMSIZADEH, A.
(2006). LEISHMANIA TROPICA-ISOLATED PATIENT WITH VISCERAL LEISHMANIASIS IN SOUTHERN IRAN. Am J Trop Med Hyg
74: 306-307
[Abstract] [Full Text] -
KATO, H., UEZATO, H., KATAKURA, K., CALVOPINA, M., MARCO, J. D., BARROSO, P. A., GOMEZ, E. A., MIMORI, T., KORENAGA, M., IWATA, H., NONAKA, S., HASHIGUCHI, Y.
(2005). DETECTION AND IDENTIFICATION OF LEISHMANIA SPECIES WITHIN NATURALLY INFECTED SAND FLIES IN THE ANDEAN AREAS OF ECUADOR BY A POLYMERASE CHAIN REACTION. Am J Trop Med Hyg
72: 87-93
[Abstract] [Full Text] -
Mary, C., Faraut, F., Lascombe, L., Dumon, H.
(2004). Quantification of Leishmania infantum DNA by a Real-Time PCR Assay with High Sensitivity. J. Clin. Microbiol.
42: 5249-5255
[Abstract] [Full Text] -
Gangneux, J.-P., Menotti, J., Lorenzo, F., Sarfati, C., Blanche, H., Bui, H., Pratlong, F., Garin, Y.-J.-F., Derouin, F.
(2003). Prospective Value of PCR Amplification and Sequencing for Diagnosis and Typing of Old World Leishmania Infections in an Area of Nonendemicity. J. Clin. Microbiol.
41: 1419-1422
[Abstract] [Full Text] -
Nicolas, L., Prina, E., Lang, T., Milon, G.
(2002). Real-Time PCR for Detection and Quantitation of Leishmania in Mouse Tissues. J. Clin. Microbiol.
40: 1666-1669
[Abstract] [Full Text] -
Aransay, A. M., Scoulica, E., Tselentis, Y.
(2000). Detection and Identification of Leishmania DNA within Naturally Infected Sand Flies by Seminested PCR on Minicircle Kinetoplastic DNA. Appl. Environ. Microbiol.
66: 1933-1938
[Abstract] [Full Text] -
Reale, S., Maxia, L., Vitale, F., Glorioso, N. S., Caracappa, S., Vesco, G.
(1999). Detection of Leishmania infantum in Dogs by PCR with Lymph Node Aspirates and Blood. J. Clin. Microbiol.
37: 2931-2935
[Abstract] [Full Text] -
Yurchenko, V. Y., Merzlyak, E. M., Kolesnikov, A. A., Martinkina, L. P., Vengerov;, Y. Y., Noyes, H.
(1999). Structure of Leishmania Minicircle Kinetoplast DNA Classes. J. Clin. Microbiol.
37: 1656-1657
[Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»