Previous Article | Next Article 
Journal of Clinical Microbiology, October 1998, p. 2944-2949, Vol. 36, No. 10
The Rockefeller University, New York, New
York,1 and
Institute of
Microbiology, University of Genoa, Genoa, Italy2
Received 6 April 1998/Returned for modification 1 July
1998/Accepted 17 July 1998
Thirty-nine penicillin-resistant Streptococcus
pneumoniae isolates recovered among the approximately 700 pneumococcal strains collected from 1993 to 1996 in central and
northern Italy were analyzed for several characteristics, including
serotype, antibiotic susceptibility profile, chromosomal relatedness
(by using pulsed-field gel electrophoresis [PFGE]), restriction
fragment length polymorphism (RFLP) of the penicillin-binding protein
(PBP) genes 1A, 2X, and 2B, and the presence of a variety of antibiotic
resistance genes (determined by hybridization with appropriate DNA
probes). The MICs of penicillin for most of the isolates (30 of 39)
were high, in the range of 1 µg/ml or higher, and these 30 isolates
carried additional resistance traits to two or more drugs
(erythromycin, chloramphenicol, co-trimoxazole, and tetracycline) and
expressed serotypes 9, 19, and 23 and three distinct PFGE patterns.
More than half (22 of 30) of the isolates for which MICs were high were
identified as representatives of two widespread international epidemic
clones of S. pneumoniae. The first one of these clones (seven isolates) expressed serotype 23F and possessed all properties characteristic of the widespread Spanish/USA international clone. Seven
additional strains with serotype 19 also had the same PFGE pattern, PBP
gene, and RFLP polymorphisms, and other properties typical of the
serotype 23 Spanish/USA clone, suggesting that these strains were the
products of a capsular transformation event (from serotype 23F to
serotype 19) in which the Spanish/USA clone was the recipient. The
second international clone was represented by eight serotype 9 isolates
which were resistant to penicillin and trimethoprim-sulfamethoxazole
and had the molecular properties of the French/Spanish epidemic clone.
The remaining eight isolates for which penicillin MICs were high
appeared to represent a hitherto-undescribed "Italian" clone; they
had a novel PFGE type, unique RFLPs for the PBP genes, and resistance
to tetracycline, trimethoprim-sulfamethoxazole, and erythromycin, and
the penicillin MICs for these isolates were 2 to 4 µg/ml.
In contrast to other western
Mediterranean countries (2-4, 8, 11, 12, 16, 17, 22, 35)
and for reasons not fully understood, penicillin-resistant
Streptococcus pneumoniae has been isolated relatively rarely
in Italy (18, 19, 28). Nevertheless, the frequency of
penicillin-resistant isolates appears to be on the rise in Italy,
increasing from 5.5% in 1993 to 7.7% in 1996. In an attempt to obtain
some insights into the situation in Italy, 39 penicillin-resistant
Italian isolates identified among the approximately 700 S. pneumoniae strains collected from 1993 to 1996 from nine different
centers in central and northern Italy (Milan, Bergamo, Bologna,
Florence, Genoa, Parma, Perugia, Turin, and Vercelli) were examined by
microbiological and molecular techniques. Our findings, as described in
this communication, indicate that more than half of the
penicillin-resistant isolates in this collection were members of two
internationally widespread pneumococcal clones that were most likely
imported into Italy. In addition, properties of a unique and novel
multidrug-resistant "Italian" clone are also described.
Bacterial strains.
Thirty-nine S. pneumoniae
isolates selected for their penicillin resistance from about 700 strains recovered from 1993 to 1996 from nine different centers in
central and northern Italy (Milan, Bergamo, Bologna, Florence, Genoa,
Parma, Perugia, Turin, and Vercelli) were studied. The isolation dates,
geographic origins, and clinical sources (when available) of the
strains are described in Table 1.
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Molecular Epidemiology of Penicillin-Resistant
Streptococcus pneumoniae Isolates Recovered in Italy from
1993 to 1996
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Characteristics of S. pneumoniae isolates
recovered in Italy
Biochemical characterization, serotyping, and susceptibility testing. Isolates were identified as S. pneumoniae by their susceptibility to optochin, their solubility in bile (23), and by employing the API system (Biomerieux, Marcy l'Etoile, France).
Serotypes were determined on the basis of capsular swelling after suspension in antisera (Dako Co.). The susceptibility of the pneumococcal strains to antimicrobial agents was assessed by a microdilution assay in cation-adjusted Mueller-Hinton broth with 5% lysed horse blood, as detailed in guidelines from the National Committee for Clinical Laboratory Standards (NCCLS) (24). MICs were determined after 24 h of incubation at 37°C in 5% CO2. S. pneumoniae ATCC 49619 was included in each run as a control. The antimicrobial agents tested (penicillin G, erythromycin, chloramphenicol, co-trimoxazole, and tetracycline) were obtained from commercial sources. Strains were defined as antibiotic susceptible, intermediately resistant, or resistant in accordance with NCCLS guidelines (24).PFGE. Preparation of chromosomal DNA and pulsed-field gel electrophoresis (PFGE) were performed by methods described previously (30). A CHEF-DRII apparatus (Bio-Rad, Richmond, Calif.) was used for running the gels. Running conditions were as follows: 23 h at 14°C at a voltage of 200 V ramped with an initial forward time of 1 s and a final forward time of 30 s. Gels were stained with ethidium bromide and photographed.
Hybridization with DNA probes. Gels to be hybridized were transferred to nylon membranes with the Vacuum Gene System (Pharmacia Biotech). The resulting membranes were probed with the ECL system (Amersham, Little Chalfont, United Kingdom) in accordance with the manufacturer's recommendations. The molecular weights of the hybridization signals and the corresponding SmaI fragments were determined by comparison with a molecular weight ladder.
Probes. DNA probes for ermB and mefE genes were obtained through PCR with, as templates, S. pneumoniae 02J 1095 (for ermB) and 02J 1175 (for mefE) and primers GAAAARGTACTAACCAAATA and AGTAAYGGTACTTAAATTGTTTAC (for ermB) and AGTATCATTAATCACTAGTGC and CGTAATAGATGCAATCACAGC (for mefE), generated on the basis of sequences published by Sutcliffe et al. (31).
It has been previously shown that streptococcal isolates carry chloramphenicol acetyltransferase (CAT) genes belonging to both catpC194 and catpC221 classes (7, 33). To design primers, protein sequences of the CAT determinants belonging to both classes (sequences under accession no. V01277, J01754, K01998, X65462, S50737, X60827, S45036, X02529, and X02872) were aligned and primers were designed to the conserved regions. The pair of primers thus obtained, CATd (TTAGGYTATTGGGATAAGTTA)-CATr (CATGRTAACCATCACAWACAG), was used to amplify a 338-bp fragment internal to the cat gene (235 to 572 bp of the coding region of the cat gene of plasmid pC164). To generate the probe, template DNA from strain 8249 was prepared as described previously (25) and utilized in a PCR in which annealing was performed at 47°C for 30 s and extension was done at 72°C for 1 min for 30 cycles. Primers used to generate the tetM probe were TETMd (TGGAATTGATTTATCAACGG) and TETMr (TTCCAACCATACAATCCTTG); they were designed to amplify a 1,080-bp region internal to the tetM (34) gene corresponding to nucleotides 529 to 1608 of the sequence under accession no. X52632. Preparation of the template and strain used were the same as for preparation of the CAT probe. PCR was performed with annealing at 50°C for 30 s followed by extension at 72°C for 1 min for 30 cycles. Purification and labeling of the probes were done as described before (20, 25).Labeling and titration of PBPs. Penicillin-binding protein (PBP) profiles and penicillin affinity were determined as described previously (22).
Preparation of chromosomal DNA and fingerprinting of the PBP 1A, 2B, and 2X genes. Chromosomal DNA was prepared as described by Dowson et al. (9). The PBP 2B and 2X genes were amplified as 1.5- and 2-kb fragments, respectively, by PCR, as described by Dowson et al. (9) and Munoz et al. (21). The PBP 1A gene was amplified as a 2-kb fragment by PCR by using the oligonucleotides PN1A up (dACTAGTTGCAACAACTTCTAG) and PN1A down (dTTGAACTTCTGATGAGG) and the same PCR conditions used for PBP 2B and 2X. The amplification products (20 µl each) were purified by using the Wizard PCR purification system (Promega, Madison, Wis.) as described in the manufacturer's instructions and were digested by restriction endonucleases HinfI (PBP 1A), StyI (PBP 2B), and MseI plus DdeI (PBP 2X) and separated by electrophoresis in 2.5% agarose gels, as described by Hermans et al. (14).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Tables 1 and 2 summarize relevant characteristics of the 39 S. pneumoniae clinical isolates examined, including isolation date, serotype, source (when available), geographic origin, assignment to PFGE pattern, and antibiotic resistance level, as well as results of hybridization with different DNA probes. Figure 1A through C show PFGE profiles of chromosomal DNA as well as hybridization patterns with DNA probes for erythromycin and tetracycline resistance genes from a representative group of strains.
|
|
Of the 39 strains studied, 22 were intermediately resistant to penicillin (MICs, 0.1 to 1 mg/liter) and 17 were highly resistant (MIC range, 2 to 4 mg/liter) according to the NCCLS breakpoints. Moreover, 53.8, 41, 61.5, and 89.7% of the strains were resistant to erythromycin, chloramphenicol, tetracycline, and co-trimoxazole, respectively.
Isolates for which penicillin MICs were 
1 mg/liter (30 of 39) tended
to be more frequently resistant to at least two other antibiotics and
showed less variable backgrounds in terms of PFGE patterns and
serotypes than isolates for which penicillin MICs were <1 mg/liter (9 of 39). In particular, 23 S. pneumoniae isolates belonging
to the first group of 30 strains were resistant to two or more
additional drugs (erythromycin, chloramphenicol, co-trimoxazole, and/or
tetracycline).
Only three different serotypes (serotypes 23, 9, and 19) and three main PFGE profiles (named, arbitrarily, A, B, and C) were found among the 30 strains; 15 of these 30 strains expressed serotype 23F, and about half of these (7 of 15) showed the PFGE profile characteristic of the widespread Spanish/USA international clone or closely related variants. The remaining eight S. pneumoniae isolates, which had the 23F serotype, for which the penicillin MICs were high, and which were resistant to tetracycline, co-trimoxazole, and erythromycin, showed a novel PFGE pattern which may represent the emergence of a unique Italian multidrug-resistant clone. Seven of 30 isolates belonging to serotype 19 had a PFGE profile very similar to that of the Spanish/USA serotype 23 clone, suggesting that these bacteria may be the products of a capsular transformation event from serotype 23F to serotype 19.
All eight isolates expressing serotype 9 had a PFGE profile characteristic of a second widely dispersed (French/Spanish) international clone and its PFGE subtype variants (4, 10). The nine penicillin-resistant strains for which the MICs were <1 mg/liter displayed more variable backgrounds (six different PFGE patterns and four serotypes, i.e., 23, 19, 9, and 21).
The results of hybridization with probes for ermB, mefE, tetM, and cat genes are summarized in Table 2. All strains with high-level erythromycin resistance (MIC range, 32 to >128 mg/liter) hybridized with the ermB probe, while all strains with low-level resistance (MIC, 4 to 16 mg/liter) hybridized with the mefE probe as expected (32). Southern hybridization of chromosomal SmaI digests located the ermB hybridizing signal to a DNA band of 388 kb in 8 of the 17 highly erythromycin-resistant isolates, to a 322-kb band in 1 isolate, and to a 122-kb band in the remaining 8 isolates. The mefE gene probe hybridized with a 388-kb DNA band in three strains and in the 338-kb band in one strain.
A good correlation between hybridization and resistance level was also found for chloramphenicol resistance; although three strains defined as susceptible according to NCCLS breakpoints (MICs, 4 mg/liter) also hybridized with the cat probe (Table 2), the significance of this is not clear at the present time.
All tetracycline-resistant strains and seven tetracycline-susceptible strains (four of which showed borderline resistance) gave a positive hybridization signal with the tetM probe. Multidrug-resistant strains carried the erythromycin, tetracycline, and chloramphenicol resistance genes on the same DNA band in SmaI digests of chromosomal DNA.
Fluorographic assays with radioactive penicillin showed, as expected, that the high-molecular-weight PBPs of all penicillin-resistant isolates had a reduced affinity for penicillin (22). The PBP 1A, 2X, and 2B genes amplified from the penicillin-susceptible laboratory strain R6, two representatives of the international Spanish/USA clone (one with serotype 23F and the other with serotype 19), and a representative of the serotype 23F Italian clone were compared for their RFLP patterns by using a set of restriction enzymes. Each of these PBP genes yielded unique and distinct DNA fingerprints, including the two representatives of the Spanish/USA clone which had an RFLP pattern in common (Fig. 2).
|
) and the 1-kb marker
(
) (Promega). Molecular sizes of standards, in kilobases, are shown
to the right and left of the figure.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
In contrast to other European and western Mediterranean countries, such as France, Spain, and Portugal (2-4, 8, 11, 12, 16, 17, 22, 35), the frequency of penicillin-resistant pneumococci has remained relatively low in Italy, closer to the rates reported from Germany (26, 27, 29), the United Kingdom (15), and The Netherlands (14). In an attempt to obtain some insights into the nature of these relatively rare penicillin-resistant pneumococci in Italy, we examined 39 resistant strains recovered from about 700 pneumococcal isolates collected between 1993 and 1996 in central and northern Italy. This study represents the first detailed analysis of penicillin-resistant S. pneumoniae strains circulating in Italy.
Of the 39 isolates analyzed, 22 had intermediate-level penicillin resistance, based on the current clinical microbiology definition of breakpoints, and 17 had high-level penicillin resistance. Nevertheless, the MICs for most strains (25 of 39) were near to or higher than the resistance breakpoint (1 to 2 mg/liter). The overwhelming majority of the penicillin-resistant Italian isolates expressed three serogroups or serotypes: 23, 9, and 19 (represented by 18, 10, and 9 strains, respectively). These could be grouped into three major PFGE types (labeled A, B, and C), and these strains frequently carried resistance genes to erythromycin (53.8%), chloramphenicol (41%), tetracycline (61.5%), and co-trimoxazole (89.7%).
All highly erythromycin-resistant strains carried the ermB gene, while strains with low-level resistance carried the mefE gene, as expected (32). In multidrug-resistant strains exhibiting resistance to erythromycin, tetracycline, and chloramphenicol, genetic determinants for these resistance factors were invariably located on the same DNA fragment in SmaI hydrolysates. Although tetM and ermB are carried on transposon Tn1545 (6), the cat and mef genes are not usually part of this transposable element. The colocalization of these genes on the same SmaI fragment may be fortuitous. Interestingly, three fully tetracycline-susceptible isolates gave a strong hybridization signal with the tetM DNA probe; the mechanism of suppression of the tetracycline resistance phenotype in these bacteria is currently under investigation.
The causes of the relatively low incidence of penicillin-resistant pneumococci in Italy are not known. It is conceivable that the low prevalence is related to the local drug prescription habits (13): Italy is the only country in Europe where over 80% of antibiotic courses are given parenterally, and the most frequently used drugs include expanded-spectrum cephalosporins, such as cefotaxime and ceftriaxone. This mode of antibiotic usage is dominant both in the hospital and in the community setting. It may be speculated that the relatively low prevalence of resistant pneumococci may be related to the higher rates of eradication of these respiratory pathogens due to the aggressive parenteral therapy. Expanded-spectrum cephalosporins are intrinsically more active against S. pneumoniae than penicillin derivatives and, thus, are less prone to produce subinhibitory concentrations conducive to selection of resistant strains, unlike drugs administered through oral therapy.
Analysis of the DNA fingerprints revealed that a large proportion (22 of 30, or 73%) of the penicillin-resistant bacteria for which MICs
were 1.0 µg/ml were representatives of two internationally widespread multidrug-resistant clones: the 23F Spanish/USA clone, already identified in several countries on five continents, and the
serotype 9 or 14 French/Spanish clone, spread to western European and
South American countries. The surprisingly high-level representation of
these two widespread penicillin-resistant clones among the Italian
isolates further documents their remarkable epidemicity, the
microbiological or mechanistic basis of which is currently not
understood. Closer analysis by DNA fingerprinting techniques suggests
that the group of the penicillin-resistant Italian isolates expressing
serotype 19 was, most likely, the product of a capsular transformation
event in which the recipient was a 23F Spanish/USA clonal isolate.
Similar observations have already been described in recent reports
(1, 5, 25).
The microbiological, serological, and molecular analyses also identified among the Italian isolates a hitherto undescribed multidrug-resistant clone of S. pneumoniae that appears to be unique to Italy. This Italian clone expresses serotype 23F, has a high level of penicillin resistance, is resistant to erythromycin, tetracycline, and co-trimoxazole, and exhibits a unique PFGE type and unique RFLP patterns for the PBP genes 1A, 2X, and 2B. This Italian clone was first detected in the 1993 sample, i.e., during the year when the Italian surveillance was initiated. This Italian clone was identified only in the strain collections originating in three of the nine collaborating centers (Bologna, Vercelli, and Parma), while the representatives of the two international clones appeared to be uniformly distributed among all nine collection centers.
| |
ACKNOWLEDGMENTS |
|---|
Partial support for these investigations was provided by a grant from the U.S. Public Health Service (NIH RO1 AI37275). M. Ramirez was supported by a fellowship from the Gulbenkian Foundation and Fundação Luso Americano para o Desenvolvimento. A. Marchese was supported by a fellowship from the University of Genoa, Genoa, Italy.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Laboratory of Microbiology, The Rockefeller University, 1230 York Ave., New York, NY 10021. Phone: (212) 327-8277. Fax: (212) 327-8688. E-mail: tomasz{at}rockvax.rockefeller.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. | Barnes, D. M., S. Whittier, P. H. Gilligan, S. Soares, A. Tomasz, and F. W. Henderson. 1995. Transmission of multidrug-resistant serotype 23F Streptococcus pneumoniae in group day care: evidence suggesting capsular transformation of the resistant strain in vivo. J. Infect. Dis. 171:890-896[Medline]. |
| 2. | Bedos, J. P., S. Chevret, C. Chastang, P. Geslin, R. Reginer, and The French Cooperative Pneumococcus Study Group. 1996. Epidemiological features of and risk factors for infection by Streptococcus pneumoniae strains with diminished susceptibility to penicillin: findings of a French survey. Clin. Infect. Dis. 22:63-72[Medline]. |
| 3. | Carvalho, C., P. Geslin, and M. V. Vaz Pato. 1996. Pulsed-field gel electrophoresis in Streptococcus pneumoniae isolated in France and Portugal. Pathol. Biol. 44:430-434[Medline]. |
| 4. |
Coffey, T. J.,
S. Berrón,
M. Daniels,
M. E. Garcia-Leoni,
E. Cercenado,
E. Bouza,
A. Fenoll, and B. G. Spratt.
1996.
Multiply antibiotic-resistant Streptococcus pneumoniae recovered from Spanish hospitals (1988-1994): novel major clones of serotypes 14, 19F and 15F.
Microbiology
142:2747-2757 |
| 5. | Coffey, T. J., C. G. Dowson, M. Daniels, J. Zhou, C. Martin, B. G. Spratt, and J. M. Musser. 1991. Horizontal transfer of multiple penicillin-binding protein genes, and capsular biosynthetic genes, in natural populations of Streptococcus pneumoniae. Mol. Microbiol. 5:2255-2260[Medline]. |
| 6. | Courvalin, P., and C. Carlier. 1986. Transposable multiple antibiotic resistance in Streptococcus pneumoniae. Mol. Gen. Genet. 205:291-297[Medline]. |
| 7. | David, F., G. de Cespedes, F. Delbos, and T. Horaud. 1993. Diversity of chromosomal genetic elements and gene identification in antibiotic-resistant strains of Streptococcus pneumoniae and Streptococcus bovis. Plasmid 29:147-153[Medline]. |
| 8. | Doit, C., E. Denamur, B. Picard, P. Geslin, J. Elion, and E. Bingen. 1996. Mechanisms of spread of penicillin resistance in Streptococcus pneumoniae strains causing meningitis in children in France. J. Infect. Dis. 174:520-528[Medline]. |
| 9. | Dowson, C. G., A. Hutchison, and B. G. Spratt. 1989. Extensive remodelling of the transpeptidase domain of penicillin-binding protein 2B of a penicillin-resistant South African isolate of Streptococcus pneumoniae. Mol. Microbiol. 3:95-102[Medline]. |
| 10. |
Gasc, A. M.,
P. Geslin, and A. M. Sicard.
1995.
Relatedness of penicillin-resistant Streptococcus pneumoniae serogroup 9 strains from France and Spain.
Microbiology
141:623-627 |
| 11. | Goldstein, F. W., J. F. Acar, and The Alexander Project Collaborative Group. 1996. Antimicrobial resistance among lower respiratory tract isolates of Streptococcus pneumoniae: results of the 1992-93 Western Europe and USA collaborative surveillance study. J. Antimicrob. Chemother. 38(Suppl. A):71-84. |
| 12. | Gomez, J., J. Ruiz-Gomez, J. L. Hernandez-Cardona, M. L. Nunez, M. Canteras, and M. Valdes. 1994. Antibiotic resistance patterns of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis: a prospective study in Murcia, Spain, 1983-1992. Chemotherapy 40:299-303[Medline]. |
| 13. |
Halls, G. A.
1993.
The management of infections and antibiotic therapy: an European survey.
J. Antimicrob. Chemother.
31:985-1000 |
| 14. | Hermans, P. W. M., M. Sluijter, K. Elzenaar, A. van Veen, J. J. M. Schonkeren, F. M. Nooren, W. J. van Leeuwen, A. J. de Neeling, B. van Klingeren, H. A. Verbrugh, and R. de Groot. 1997. Penicillin-resistant Streptococcus pneumoniae in The Netherlands: results of a 1-year molecular epidemiologic survey. J. Infect. Dis. 175:1413-1422[Medline]. |
| 15. |
Johnson, A. P.,
D. C. E. Speller,
R. C. George,
M. Warner,
G. Dominigue, and A. Efstration.
1996.
Prevalence of antibiotic resistance and serotypes in pneumococci in England and Wales: results of observational surveys in 1990 and 1995.
Br. Med. J.
312:1454-1456 |
| 16. | Lefevre, J. C., M. A. Bertrand, and G. Fauçon. 1995. Molecular analysis by pulsed-field gel electrophoresis of penicillin-resistant Streptococcus pneumoniae from Toulouse, France. Eur. J. Clin. Microbiol. Infect. Dis. 14:491-497[Medline]. |
| 17. | Lefevre, J. C., A. M. Gasc, J. Lemozy, A. M. Sicard, and G. Fauçon. 1994. Pulsed field gel electrophoresis for molecular epidemiology of penicillin resistant Streptococcus pneumoniae strains. Pathol. Biol. 42:547-552[Medline]. |
| 18. |
Marchese, A.,
E. A. Debbia,
A. Arvigo,
A. Pesce, and G. C. Schito.
1995.
Susceptibility of Streptococcus pneumoniae strains isolated in Italy to penicillin and ten other antibiotics.
J. Antimicrob. Chemother.
36:833-837 |
| 19. | Marchese, A., E. A. Debbia, A. Pesce, and G. C. Schito. Comparative activity of amoxicillin and ten other oral drugs against penicillin susceptible and resistant Streptococcus pneumoniae strains recently isolated in Italy. Submitted for publication. |
| 20. |
McDougal, L. K.,
R. Facklam,
M. Reeves,
S. Hunter,
J. M. Swenson,
B. C. Hill, and F. C. Tenover.
1992.
Analysis of multiply antimicrobial-resistant isolates of Streptococcus pneumoniae from the United States.
Antimicrob. Agents Chemother.
36:2176-2184 |
| 21. | Munoz, R., T. J. Coffey, M. Daniels, C. G. Dowson, G. Laible, J. Casal, R. Hakenbeck, M. Jacobs, J. M. Musser, B. G. Spratt, and A. Tomasz. 1991. Intercontinental spread of a multiresistant clone of serotype 23F Streptococcus pneumoniae. J. Infect. Dis. 164:302-306[Medline]. |
| 22. | Munoz, R., J. M. Musser, M. Crain, D. E. Briles, A. Marton, A. J. Parkinson, U. Sorensen, and A. Tomasz. 1992. Geographic distribution of penicillin resistant clones of Streptococcus pneumoniae: characterization by penicillin binding protein profile, surface protein A typing and multilocus enzyme analysis. Clin. Infect. Dis. 15:112-118[Medline]. |
| 23. | Murray, P. R., E. J. Baron, M. A. Pfaller, F. C. Tenover, and R. H. Yolken (ed.). 1995. Manual of clinical microbiology, 6th ed. American Society for Microbiology, Washington, D.C. |
| 24. | National Committee for Clinical Laboratory Standards. 1993. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A3. National Committee for Clinical Laboratory Standards, Villanova, Pa. |
| 25. | Nesin, M., M. Ramirez, and A. Tomasz. 1998. Capsular transformation of a multidrug-resistant Streptococcus pneumoniae in vivo. J. Infect. Dis. 177:707-713[Medline]. |
| 26. |
Reichmann, P.,
E. Varon,
E. Gunther,
R. R. Reinert,
R. Luttikens,
A. Marton,
P. Geslin,
J. Wagner, and R. Hakenbeck.
1995.
Penicillin-resistant Streptococcus pneumoniae in Germany: genetic relationship to clones from other European countries.
J. Med. Microbiol.
43:377-385 |
| 27. | Reinert, R. R., A. Queck, A. Kaufhold, M. Kresken, and R. Luttikens. 1995. Antimicrobial resistance and type distribution of Streptococcus pneumoniae isolates causing systemic infections in Germany, 1992-1994. Clin. Infect. Dis. 21:1398-1401[Medline]. |
| 28. | Schito, G. C., S. Mannelli, A. Pesce, and The
Alexander Project Group. 1997. Trends in the activity of the
macrolide and  -lactam antibiotics and resistance development.
J. Chemother. 9(Suppl. 3):18-28.
|
| 29. |
Sibold, C.,
J. Wang,
J. Henrichsen, and R. Hakenbeck.
1992.
Genetic relationships of penicillin-susceptible and -resistant Streptococcus pneumoniae strains isolated on different continents.
Infect. Immun.
60:4119-4126 |
| 30. | Soares, S., K. G. Kristinsson, J. M. Musser, and A. Tomasz. 1993. Evidence for the introduction of a multiresistant clone of serotype 6B Streptococcus pneumoniae from Spain to Iceland in the late 1980s. J. Infect. Dis. 168:158-163[Medline]. |
| 31. | Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrak. 1996. Detection of erythromycin-resistant determinants by PCR. Antimicrob. Agents Chemother. 40:2562-2566[Abstract]. |
| 32. | Sutcliffe, J., A. Tait-Kamradt, and L. Wondrack. 1996. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 40:1817-1824[Abstract]. |
| 33. |
Trieu-Cuot, P.,
G. de Cespedes,
F. Bentorcha,
F. Delbos,
E. Gaspar, and T. Horaud.
1993.
Study of heterogeneity of chloramphenicol acetyltransferase (CAT) genes in streptococci and enterococci by polymerase chain reaction: characterization of a new CAT determinant.
Antimicrob. Agents Chemother.
37:2593-2598 |
| 34. |
Trieu-Cuot, P.,
C. Poyart-Salmeron,
C. Carlier, and P. Courvalin.
1990.
Nucleotide sequence of the erythromycin resistance gene of the conjugative transposon Tn1545.
Nucleic Acids Res.
18:3660 |
| 35. | Vaz Pato, M. V., C. B. de Carvalho, A. Tomasz, and The Multicenter Study Group. 1995. Antibiotic susceptibility of Streptococcus pneumoniae isolates in Portugal. A multicenter study between 1989 and 1993. Microb. Drug Resist. 1:59-69. [Medline] |
Journal of Clinical Microbiology, October 1998, p. 2944-2949, Vol. 36, No. 10
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Frias, M. J., Melo-Cristino, J., Ramirez, M.
(2009). The Autolysin LytA Contributes to Efficient Bacteriophage Progeny Release in Streptococcus pneumoniae. J. Bacteriol.
191: 5428-5440
[Abstract] [Full Text] -
Sogstad, M. K. R., Hoiby, E. A., Caugant, D. A.
(2006). Molecular Characterization of Non-Penicillin-Susceptible Streptococcus pneumoniae in Norway.. J. Clin. Microbiol.
44: 3225-3230
[Abstract] [Full Text] -
Klaassen, C. H. W., Mouton, J. W.
(2005). Molecular Detection of the Macrolide Efflux Gene: To Discriminate or Not To Discriminate between mef(A) and mef(E). Antimicrob. Agents Chemother.
49: 1271-1278
[Full Text] -
Nunes, S., Sa-Leao, R., Carrico, J., Alves, C. R., Mato, R., Avo, A. B., Saldanha, J., Almeida, J. S., Sanches, I. S., de Lencastre, H.
(2005). Trends in Drug Resistance, Serotypes, and Molecular Types of Streptococcus pneumoniae Colonizing Preschool-Age Children Attending Day Care Centers in Lisbon, Portugal: a Summary of 4 Years of Annual Surveillance. J. Clin. Microbiol.
43: 1285-1293
[Abstract] [Full Text] -
Spigaglia, P., Mastrantonio, P.
(2004). Comparative analysis of Clostridium difficile clinical isolates belonging to different genetic lineages and time periods. J Med Microbiol
53: 1129-1136
[Abstract] [Full Text] -
Perez-Trallero, E., Marimon, J. M., Gonzalez, A., Vicente, D., Garcia-Arenzana, J. M., on behalf of The Spanish Pneumococcal Infection St,
(2004). Spectrum of antibiotic resistance of the Spain14-5 Streptococcus pneumoniae clone over a 22 year period. J Antimicrob Chemother
53: 620-625
[Abstract] [Full Text] -
Bennett, D., Lennon, B., Humphreys, H., Cafferkey, M.
(2003). Penicillin Susceptibility and Epidemiological Typing of Invasive Pneumococcal Isolates in the Republic of Ireland. J. Clin. Microbiol.
41: 3641-3648
[Abstract] [Full Text] -
Gherardi, G., Del Grosso, M., Scotto d'Abusco, A., D'Ambrosio, F., Dicuonzo, G., Pantosti, A.
(2003). Phenotypic and Genotypic Characterization of Two Penicillin-Susceptible Serotype 6B Streptococcus pneumoniae Clones Circulating in Italy. J. Clin. Microbiol.
41: 2855-2861
[Abstract] [Full Text] -
Gamboa, L., Camou, T., Hortal, M., Castaneda, E.
(2002). Dissemination of Streptococcus pneumoniae Clone Colombia5-19 in Latin America. J. Clin. Microbiol.
40: 3942-3950
[Abstract] [Full Text] -
Dicuonzo, G., Gherardi, G., Gertz, R. E., D'Ambrosio, F., Goglio, A., Lorino, G., Recchia, S., Pantosti, A., Beall, B.
(2002). Genotypes of Invasive Pneumococcal Isolates Recently Recovered from Italian Patients. J. Clin. Microbiol.
40: 3660-3665
[Abstract] [Full Text] -
Tang, Y.-W., Li, H., Griffin, J. P., Haas, D. W., D'Agata, E. M. C.
(2002). Rapidly Increasing Prevalence of Penicillin-Resistant Streptococcuspneumoniae in Middle Tennessee: a 10-Year Clinical and Molecular Analysis. J. Clin. Microbiol.
40: 395-399
[Abstract] [Full Text] -
Fluit, A. C., Visser, M. R., Schmitz, F.-J.
(2001). Molecular Detection of Antimicrobial Resistance. Clin. Microbiol. Rev.
14: 836-871
[Abstract] [Full Text] -
McGee, L., McDougal, L., Zhou, J., Spratt, B. G., Tenover, F. C., George, R., Hakenbeck, R., Hryniewicz, W., Lefevre, J. C., Tomasz, A., Klugman, K. P.
(2001). Nomenclature of Major Antimicrobial-Resistant Clones of Streptococcus pneumoniae Defined by the Pneumococcal Molecular Epidemiology Network. J. Clin. Microbiol.
39: 2565-2571
[Abstract] [Full Text] -
Bogaert, D., Syrogiannopoulos, G. A., Grivea, I. N., de Groot, R., Beratis, N. G., Hermans, P. W. M.
(2000). Molecular Epidemiology of Penicillin-Nonsusceptible Streptococcus pneumoniae among Children in Greece. J. Clin. Microbiol.
38: 4361-4366
[Abstract] [Full Text] -
Doherty, N., Trzcinski, K., Pickerill, P., Zawadzki, P., Dowson, C. G.
(2000). Genetic Diversity of the tet(M) Gene in Tetracycline-Resistant Clonal Lineages of Streptococcus pneumoniae. Antimicrob. Agents Chemother.
44: 2979-2984
[Abstract] [Full Text] -
Santagati, M., Iannelli, F., Oggioni, M. R., Stefani, S., Pozzi, G.
(2000). Characterization of a Genetic Element Carrying the Macrolide Efflux Gene mef(A) in Streptococcus pneumoniae. Antimicrob. Agents Chemother.
44: 2585-2587
[Abstract] [Full Text] -
Vilhelmsson, S. E., Tomasz, A., Kristinsson, K. G.
(2000). Molecular Evolution in a Multidrug-Resistant Lineage of Streptococcus pneumoniae: Emergence of Strains Belonging to the Serotype 6B Icelandic Clone That Lost Antibiotic Resistance Traits. J. Clin. Microbiol.
38: 1375-1381
[Abstract] [Full Text] -
Marchese, A., Tonoli, E., Debbia, E. A., Schito, G. C.
(1999). Macrolide resistance mechanisms and expression of phenotypes among Streptococcus pneumoniae circulating in Italy. J Antimicrob Chemother
44: 461-464
[Abstract] [Full Text] -
Muñoz, R., Mollerach, M., López, R., García, E.
(1999). Characterization of the Type 8 Capsular Gene Cluster of Streptococcus pneumoniae. J. Bacteriol.
181: 6214-6219
[Abstract] [Full Text] -
Llull, D., Munoz, R., Lopez, R., Garcia, E.
(1999). A Single Gene (tts) Located outside the cap Locus Directs the Formation of Streptococcus pneumoniae Type 37 Capsular Polysaccharide: Type 37 Pneumococci Are Natural, Genetically Binary Strains. JEM
190: 241-252
[Abstract] [Full Text] -
Tamayo, M., Sá-Leão, R., Sanches, I. S., Castañeda, E., de Lencastre, H.
(1999). Dissemination of a Chloramphenicol- and Tetracycline-Resistant but Penicillin-Susceptible Invasive Clone of Serotype 5 Streptococcus pneumoniae in Colombia. J. Clin. Microbiol.
37: 2337-2342
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»