Previous Article | Next Article ![]()
Journal of Clinical Microbiology, November 1998, p. 3239-3242, Vol. 36, No. 11
Department of Pediatric
Dentistry1 and
Department of Oral
Biology,
Received 2 February 1998/Returned for modification 9 June
1998/Accepted 3 August 1998
Periodontitis is a common, progressive disease that eventually
affects the majority of the population. The local destruction of
periodontitis is believed to result from a bacterial infection of the
gingival sulcus, and several clinical studies have provided evidence to
implicate Porphyromonas gingivalis. If P. gingivalis is a periodontal pathogen, it would be
expected to be present in most subjects with disease and rarely
detected in subjects with good periodontal health. However, in most
previous studies, P. gingivalis has not been detected in
the majority of subjects with disease, and age-matched, periodontally
healthy controls were not included for comparison. The purpose of the
study reported here was to compare the prevalence of P. gingivalis in a group with periodontitis to that of a group that
is periodontally healthy. A comprehensive sampling strategy and a
sensitive PCR assay were used to maximize the likelihood of detection.
The target sequence for P. gingivalis-specific
amplification was the transcribed spacer region within the ribosomal
operon. P. gingivalis was detected in only 25% (46 of 181)
of the healthy subjects but was detected in 79% (103 of 130) of the
periodontitis group (P < 0.0001). The odds ratio for
being infected with P. gingivalis was 11.2 times greater in
the periodontitis group than in the healthy group (95% confidence
interval, 6.5 to 19.2). These data implicate P. gingivalis in the pathogenesis of periodontitis and suggest that P. gingivalis may not be a normal inhabitant of a periodontally
healthy dentition.
Periodontitis is a common,
progressive disease that affects the supporting structures of the
teeth, causing loss of attachment to the bone and often resulting in
tooth loss (4). Moderate disease eventually affects the
majority of persons, and advanced disease is seen in nearly half of
individuals over 65 (3). A limited number of bacterial
species have been associated with periodontitis, and the strongest
evidence has accumulated to implicate Porphyromonas
gingivalis. Studies have shown that P. gingivalis occurs with greater frequency and at higher levels at sites which appear to be disease active (15, 17, 18, 21) and that certain periodontal health indicators in individuals are inversely correlated with the presence or levels of P. gingivalis
(1, 2, 10, 11, 16, 19). If P. gingivalis is a
pathogen, then it would be expected to be detected in most subjects
with disease and rarely detected in subjects who are periodontally healthy. However, in most previous studies, P. gingivalis
has not been detected in the majority of subjects with disease. Low sensitivities of culturing techniques and sampling of a limited number
of oral sites may have caused an underestimate of the organism's true
prevalence in these studies. Information about the presence of P. gingivalis in a healthy population is mostly limited to young
subjects who may not yet have evidenced the cumulative
destruction used for diagnosis, or from "healthy" sites
in mouths with areas of destruction. Little information is
available about its prevalence in those individuals who reach middle
age without experiencing disease. No good animal model has been
identified that would allow the direct testing of Koch's postulates,
but with the advent of molecular techniques for detecting and
identifying bacteria, revisions to Koch's original postulates for
establishing microbial pathogenesis that do not require an animal model
have been proposed (8). It has been suggested that to
establish causality, the nucleic acid sequence belonging to a putative
pathogen be detected in most cases of disease and that fewer or no
copies should be detected in the absence of disease. Additional
supporting evidence would include the disappearance of the
pathogen-associated sequence with disease resolution, biological
plausibility, and tissue localization (8). Conducting human
epidemiologic studies on periodontitis that meet these criteria is
challenging, since no direct test for periodontitis exists, and the
presence of disease can only be determined by measuring slowly
accumulating evidence of past destruction with insensitive and
unreliable methods. The purpose of this study was to determine if
P. gingivalis meets two major requirements of the revised
postulates for sequence-based identification of microbial pathogens. In
order to accomplish this, a group of subjects with clear indicators of
periodontitis and an age-matched group of subjects who had not
exhibited signs of substantial periodontal destruction were identified.
A comprehensive sampling strategy and a sensitive and specific DNA
sequence-based assay were used to maximize the likelihood of detection
of P. gingivalis (14). Detection rates were found
to be high in the periodontitis group and low in the healthy group,
implicating P. gingivalis in the pathogenesis of
periodontitis.
Study population.
Subjects for this institutionally approved
study were recruited from the clinics of the Ohio State University
College of Dentistry. Potential subjects were screened, examined, and
selected for participation if they met criteria for periodontal health
or disease. These criteria were established to include approximately
the most and least healthy one-fourth of the population based on
epidemiologic data (13). Probing pocket depths and
attachment levels were screened at six sites per tooth by a calibrated
examiner with a ball-ended WHO probe with a colored band from 3.5 to
5.5 mm (Hu-Friedy PCP-11.5B). Subjects identified by screening with the WHO probe as meeting inclusion criteria were reexamined with a North
Carolina probe (Hu-Friedy PCPUNC15), again measuring six sites per
tooth. Subjects were included in the periodontitis group if loss of
attachment was greater than or equal to 7 mm at a minimum of three
sites and pocket depth was greater than or equal to 6 mm at a minimum
of two sites, in order to rule out treated disease. Subjects were
included in the healthy group if pocket depths and attachment levels
were less than 5.5 mm for all sites. Subjects were excluded from the
healthy group if less than 24 teeth remained, to avoid including those
with treated disease. The healthy group was age matched to the diseased
group.
Bacterial sampling.
Excess saliva was removed with a cotton
roll or gauze pad to minimize collection of transient contaminating
bacteria from an exogenous source. A sterile, medium endodontic paper
point (Caulk-Dentsply) was placed in the mesial sulcus of each tooth for 10 s. All teeth present were sampled to maximize the
possibility of detection of P. gingivalis if present at
any site. Samples from each individual were pooled in a sterile 2-ml
microcentrifuge tube and frozen for later analysis.
Detection of P. gingivalis.
DNA was isolated and
samples were analyzed for the presence of P. gingivalis, as previously described (14), with a PCR
assay that did not require that the samples be cultured. The target sequence was the ribosomal DNA spacer region between the 16S and 23S
ribosomal genes. Briefly, DNA was isolated from the paper points, and a
P. gingivalis-specific fragment was generated by nested
PCR with first a pair of universal prokaryotic primers followed by
amplification with a species-specific primer located in the 16S gene
(CGATATACCGTCAAGCTTCCACAG) paired with a universal primer
located in the 23S gene. DNA fragments were separated by agarose gel
electrophoresis. Samples were scored as positive or negative for
P. gingivalis based on a clear band of the expected size (Fig. 1). All second amplifications
were repeated and scored a second time. If the results were not in
agreement, the amplification was repeated again. The presence of DNA
was confirmed in all negative samples by using universal prokaryotic
primers.
Statistical analysis.
The prevalence of P. gingivalis among healthy and diseased subjects and the sex and
race distribution were compared by chi-square analysis. The odds ratio
and 95% confidence interval were calculated for detection of
P. gingivalis in the periodontitis group versus the
healthy group. Age comparisons were made by using t tests.
Approximately 7,000 patient charts were screened, and from among
these, approximately 600 individuals were selected for examination. Of
these, 311 met inclusion criteria for the study: 130 in the periodontitis group and 181 in the healthy group. Highly statistically significant differences were observed between the prevalence of P. gingivalis in the healthy and periodontitis
groups (P < 0.0001). P. gingivalis was
detected in only 25% (46 of 181) of the healthy subjects but was found
in 79% (103 of 130) of the periodontitis group (Table
1). The odds ratio for being infected
with P. gingivalis was 11.2 times greater in the
periodontitis group than in the healthy group (95% confidence
interval, 6.5 to 19.2).
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Prevalence of Porphyromonas gingivalis
and Periodontal Health Status
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (100K):
[in a new window]
FIG. 1.
P. gingivalis-specific DNA fragments.
The markers in the far left lane are EcoRI and
HindIII digestion products of bacteriophage lambda DNA.
The far right lane contains a control without template DNA, and next to
it is a DNA fragment amplified from P. gingivalis ATCC
33277 which appears at 1.7 kb. Lanes numbered 1 through 5 contain DNA
amplified from plaque samples. Of these, lanes 2 and 5 were scored as
positive for the presence of P. gingivalis. The image
was captured with a model 4910 CCD camera (Cohu, Inc., San Diego,
Calif.) and an LG-3 Frame Grabber Board (Scion Corp., Frederick, Md.).
Analysis was performed on a Power Macintosh 7100 with the public domain
NIH Image program.
![]()
RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Prevalence of P. gingivalis in healthy
and diseased groups
The mean age of the periodontitis group was 51.4 years, and the mean age of the healthy group was 49.2 years (Table 2). This difference was not significant by t test (P = 0.18). No relationship was observed for detection of P. gingivalis and age for either group by t test (P = 0.31 for periodontitis group, P = 0.85 for the healthy group). A difference in sex distribution between the two groups was significant by chi-square analysis (P = 0.0002), with more females in the healthy group and fewer in the diseased group (Table 2). However, chi-square analysis showed no significant differences in colonization with P. gingivalis between males and females within groups (P = 0.48 for the periodontitis group and P = 0.85 for the healthy group) (Table 1). A larger number of African-Americans and a smaller number of white subjects were seen in the diseased group than in the healthy group (Table 2). This difference was significant by chi-square analysis (P = 0.02). However, no significant differences in colonization with P. gingivalis were seen within groups for race (P = 0.07 for the healthy group and P = 0.13 for the periodontitis group) (Table 1).
|
| |
DISCUSSION |
|---|
|
|
|---|
To investigate the relationship between infection with P. gingivalis and periodontal health, a group of subjects with clear indicators of periodontitis and a healthy, age-matched control group were identified. A comprehensive sampling strategy was employed, and colonization with P. gingivalis was determined with a sensitive and specific PCR-based assay. Samples were taken from 130 adults with periodontitis and 181 controls. By this approach, the presence of P. gingivalis was found to be highly associated with disease, with the odds of detecting it more than 11-fold greater in the periodontitis group than in the healthy group, suggesting that P. gingivalis is a pathogen.
The PCR assay has been shown to be sensitive to as few as 10 bacteria (12), although some efficiency is no doubt lost in sampling and retrieving the bacteria from the paper points. The primer has been shown to be highly specific for P. gingivalis (7, 12), and a search of GenBank failed to find any matches. The spacer region is sufficiently variable that size differences in the fragment generated by PCR are observed among even closely related species, providing a further check for any cross-reactive species. We have analyzed several hundred PCR products by sequencing or heteroduplex analysis and have not found any false positives among the samples that were originally identified as P. gingivalis by PCR and agarose gel electrophoresis (9).
Measurable criteria for defining a group with periodontitis and a periodontally healthy group were adopted on the basis of previously reported data about population norms for pocket depth and attachment levels (13). Attachment levels and pocket depths in populations exhibit a continuous frequency distribution rather than a bimodal distribution into "health" and "disease" (13). Since no unequivocal thresholds exist to define periodontal health or disease, criteria were selected to allow the inclusion of no more than the healthiest and most diseased quartiles of the population for study.
Many more than half of the individuals screened for the study were found to fall between the two groups of interest, confirming that the criteria were selective. In particular, it was difficult to identify subjects of a sufficient age who met criteria for periodontal health to match the age of the periodontitis group. Since the subjects were drawn from the patient pool of dental school clinics, it is possible that fewer healthy subjects may have been available in the pool than in the general population. Efforts were made to recruit a larger sample size of healthy subjects, because infection rates were expected to be lower in this group, and similar numbers of infected subjects from each group were needed for future strain analysis.
The healthy group was well matched to the periodontitis group for age, with no significant difference seen. The healthy and periodontitis groups were not matched for sex or race, and there were more males and more African-American subjects in the diseased group than in the healthy group. The racial bias is consistent with previous reports of higher rates of periodontal disease among African-Americans. However, no significant differences in the prevalence of P. gingivalis were seen between sexes or among races in either the healthy or periodontitis groups. Thus, differences in prevalence of P. gingivalis between the healthy and periodontitis groups could not be attributed to age, sex, or race.
Studies have often relied upon dental professionals such as hygienists and dental students as healthy controls. However, we have shown that the prevalence and levels of P. gingivalis are atypically low in this group, probably due to unusually thorough oral hygiene (5). Therefore, the healthy subjects selected for this study were drawn from patient pools to provide a more representative control group.
If P. gingivalis is a pathogen, how can we account for the 25% detection rate among healthy subjects? Several plausible explanations deserve further study. Perhaps the criteria for health were not sufficiently stringent, since pocket depths and attachment loss of up to 5 mm were included. However, stratifying the data by deepest pocket and attachment loss did not show any relationship to prevalence in the healthy group (data not shown). It is also possible that the strains found in the healthy group are not the same as those found in periodontitis. Preliminary analysis to identify and compare strains in the two groups does in fact suggest that different strain groups are found under conditions of health and disease, and further analysis is indicated to address this interesting possibility (9). On the other hand, P. gingivalis was not detected in 21% of the periodontitis group. This could be accounted for by subjects who, although demonstrating evidence of past disease, no longer harbored detectable levels of the pathogen, although it appears to be difficult to eradicate (6, 20). It is also possible that P. gingivalis is not the only organism capable of causing periodontal destruction and that P. gingivalis was not the causative species in these individuals.
In summary, the odds of detecting P. gingivalis were 11.2-fold greater in individuals with periodontitis than in age-matched healthy subjects. This suggests that P. gingivalis is a periodontal pathogen. Investigation to determine if only a subset of strains are associated with disease and longitudinal studies to establish causality are needed.
| |
ACKNOWLEDGMENTS |
|---|
We gratefully acknowledge Gerard McDonnell for recruiting and sampling subjects and Lourdes Christopher for the examination of subjects.
This work was supported by NIH grant DE10467.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Pediatric Dentistry, College of Dentistry, The Ohio State University, 305 W. 12th Ave., Columbus, OH 43210. Phone: (614) 292-1150. Fax: (614) 688-3077. E-mail: griffen.1{at}osu.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Alpagot, T., L. F. Wolff, Q. T. Smith, and S. D. Tran. 1996. Risk indicators for periodontal disease in a racially diverse urban population. J. Clin. Periodontol. 23:982-988[Medline]. |
| 2. | Beck, J. D. 1994. Methods of assessing risk for periodontitis and developing multifactorial models. J. Periodontol. 65(Suppl. 5):468-478. |
| 3. | Brown, L. J., J. A. Brunelle, and A. Kingman. 1996. Peridodontal status in the United States, 1988-1991: prevalence, extent, and demographic variation. J. Dent. Res. 75(Special issue):672-683. |
| 4. | Brown, L. J., R. C. Oliver, and H. Loe. 1989. Periodontal diseases in the U.S. in 1981: prevalence, severity, extent, and role in tooth mortality. J. Periodontol. 60:363-370[Medline]. |
| 5. | Christopher, L. A., A. L. Griffen, and E. J. Leys. 1996. Low incidence of colonization with Porphyromonas gingivalis among dental students. J. Dent. Res. 75(IADR abstracts):354. |
| 6. | Danser, M. M., M. F. Timmerman, A. J. van Winkelhoff, and U. van der Velden. 1996. The effect of periodontal treatment on periodontal bacteria on the oral mucous membranes. J. Periodontol. 67:478-485[Medline]. |
| 7. |
Dix, K.,
S. M. Watanabe,
S. McArdle,
D. I. Lee,
C. Randolph,
B. Moncla, and D. E. Schwartz.
1990.
Species-specific oligodeoxynucleotide probes for the identification of periodontal bacteria.
J. Clin. Microbiol.
28:319-323 |
| 8. | Fredericks, D. N., and D. A. Relman. 1996. Sequence-based identification of microbial pathogens: a reconsideration of Koch's postulates. Clin. Microbiol. Rev. 9:18-33[Abstract]. |
| 9. | Griffen, A. L., M. L. Moeschberger, S. R. Lyons, and E. J. Leys. 1997. Identification of virulent strains of Porphyromonas gingivalis. J. Dent. Res. 76(IADR abstracts):174. |
| 10. | Grossi, S. G., J. J. Zambon, A. W. Ho, G. Koch, R. G. Dunford, E. E. Machtei, O. M. Norderyd, and R. J. Genco. 1994. Assessment of risk for periodontal disease. I. Risk indicators for attachment loss. J. Periodontol. 65:260-267[Medline]. |
| 11. | Haffajee, A. D., S. S. Socransky, C. Smith, and S. Dibart. 1991. Relation of baseline microbial parameters to future periodontal attachment loss. J. Clin. Periodontol. 18:744-750[Medline]. |
| 12. |
Leys, E. J.,
A. L. Griffen,
S. J. Strong, and P. A. Fuerst.
1994.
Detection and strain identification of Actinobacillus actinomycetemcomitans by nested PCR.
J. Clin. Microbiol.
32:1288-1294 |
| 13. | Machtei, E. E., L. A. Christersson, S. G. Grossi, R. Dunford, J. J. Zambon, and R. J. Genco. 1992. Clinical criteria for the definition of "established periodontitis." J. Periodontol. 63:206-214[Medline]. |
| 14. | McClellan, D. L., A. L. Griffen, and E. J. Leys. 1995. Age and prevalence of Porphyromonas gingivalis in children. J. Clin. Microbiol. 34:2017-2019[Abstract]. |
| 15. | Melvin, W. L., D. A. Assad, G. A. Miller, M. E. Gher, L. Simonson, and A. K. York. 1994. Comparison of DNA probe and ELISA microbial analysis methods and their association with adult periodontitis. J. Periodontol. 65:576-582[Medline]. |
| 16. | Moore, W. E., L. H. Moore, R. R. Ranney, R. M. Smibert, J. A. Burmeister, and H. A. Schenkein. 1991. The microflora of periodontal sites showing active destructive progression. J. Clin. Periodontol. 18:729-739[Medline]. |
| 17. | Preus, H. R., A. Anerud, H. Boysen, R. G. Dunford, J. J. Zambon, and H. Loe. 1995. The natural history of periodontal disease. The correlation of selected microbiological parameters with disease severity in Sri Lankan tea workers. J. Clin. Periodontol. 22:674-678[Medline]. |
| 18. | Socransky, S. S., A. D. Haffajee, C. Smith, and S. Dibart. 1991. Relation of counts of microbial species to clinical status at the sampled site. J. Clin. Periodontol. 18:766-775[Medline]. |
| 19. | Teanpaisan, R., C. W. Douglas, and T. F. Walsh. 1995. Characterisation of black-pigmented anaerobes isolated from diseased and healthy periodontal sites. J. Periodontal Res. 30:245-251[Medline]. |
| 20. | von Troil-Linden, B., M. Saarela, J. Matto, S. Alaluusua, H. Jousimies-Somer, and S. Asikainen. 1996. Source of suspected periodontal pathogens re-emerging after periodontal treatment. J. Clin. Periodontol. 23:601-607[Medline]. |
| 21. | Wolff, L. F., D. M. Aeppli, B. Pihlstrom, L. Anderson, J. Stoltenberg, J. Osborn, N. Hardie, C. Shelburne, and G. Fischer. 1993. Natural distribution of 5 bacteria associated with periodontal disease. J. Clin. Periodontol. 20:699-706[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»