Previous Article | Next Article 
Journal of Clinical Microbiology, November 1998, p. 3423-3425, Vol. 36, No. 11
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Pretreatment with Restriction Enzyme or Bovine
Serum Albumin for Effective PCR Amplification of Epstein-Barr
Virus DNA in DNA Extracted from Paraffin-Embedded Gastric
Carcinoma Tissue
Yukio
Satoh,1
Noriko
Takasaka,1
Yoshiko
Hoshikawa,1
Mitsuhiko
Osaki,2
Satoshi
Ohfuji,2
Hisao
Ito,2
Nobuaki
Kaibara,3
Takeshi
Kurata,4 and
Takeshi
Sairenji1,4,*
Departments of
Biosignaling,1
Pathology,2 and
Surgery,3 Faculty of Medicine, Tottori
University, Yonago 683, and
Department of Pathology,
National Institute of Infectious Diseases, Tokyo
162,4 Japan
Received 31 December 1997/Returned for modification 10 April
1998/Accepted 3 August 1998
 |
ABSTRACT |
An association between Epstein-Barr virus (EBV) and gastric
carcinoma has been studied through the EBV genome present in the carcinoma cells. Recently, we found that EBV DNA in paraffin-embedded gastric carcinoma tissue was detected effectively by PCR after pretreatment of the extracted DNA with a restriction enzyme,
BamHI or EcoRI. Here, we show that the PCR
amplification was also enhanced by pretreatment of the DNA with other
restriction enzymes or with bovine serum albumin and several other
proteins. Treatment with these proteins may remove a PCR inhibitor(s)
in the DNA samples extracted from the paraffin blocks.
 |
TEXT |
Epstein-Barr virus (EBV) infection
was observed in 7% of gastric carcinoma patients in Japan (6, 8,
15, 24) and was detected with high frequency in gastric carcinoma
with lymphoid stroma (15, 16, 21), suggesting that EBV may
be associated with pathogenesis. Recent studies of EBV-associated early
gastric carcinoma have suggested that EBV infection may occur in the
atrophic gastric epithelial cells associated with intestinal metaplasia and in the nonneoplastic gastric epithelium (3, 10). To
address the question of when EBV infection occurs in the development of EBV-associated gastric carcinoma, retrospective detection of EBV genomes becomes more important. Paraffin-embedded tissue is excellent material for identifying the presence of viral genes or mutated oncogenes in carcinomas, since the tissue has been kept for many years
and can easily be retested. It has been reported that DNA extracted
from paraffin blocks was usable for the amplification of
-globin
gene alleles (9), papillomavirus DNA (22), and EBV DNA (17) by PCR. On the other hand, DNA from paraffin
blocks has been reported to be unsuitable material for PCR, because it was not intact (7), had compromised efficiency of
amplification (4), and contained PCR inhibitors (2,
13). Several methods to remove (2, 5, 12) or dilute
(1, 14) the inhibitors and rapid methods to prepare DNA for
PCR (11, 20) have been reported. We observed that EBV DNA
was not well amplified from DNA extracted from paraffin-embedded
gastric carcinoma tissue, for unknown reasons; however, amplification
was achieved by pretreating the DNA with BamHI or
EcoRI restriction enzyme (23). Here, we have
extended the effective detection of EBV DNA on PCR by pretreatment of
the extracted DNA with other restriction enzymes, bovine serum albumin
(BSA), and several other proteins.
Specimens of paraffin-embedded gastric carcinoma tissue from different
patients were used for this study. Some of them were derived from
gastric carcinoma with lymphoid stroma (16). Twenty 10-µm
slices were deparaffinized, and DNA was prepared by proteinase K
digestion, phenol-chloroform extraction, and ethanol precipitation and
dissolved in 1 ml of TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA). Primers
(5'CCAGACAGCAGCCAATTGTC and 5'GGTAGAAGACCCCCTCTTAC)
were used to amplify a 129-bp fragment of the BamHI-W
region of EBV DNA (25). The PCR products were detected by
Southern blot analysis according to the described method
(23) with a sequence-specific oligonucleotide probe
(5'CCCTGGTATAAAGTGGTCCTGCAGCTATTTCTGGTCGCATC) 5' end labeled
with [
-32P]ATP (26).
We tested whether the EBV DNA was amplified by pretreatment of the
extracted DNA with the restriction enzymes BstXI,
ClaI, HindIII, KpnI,
NotI, SalI, and XbaI (Fig.
1). Five microliters (1.8 µg) of DNA
from a patient with EBV-encoded small RNA (EBER)-positive gastric
carcinoma (16) was incubated at 37°C for 1 h with
each enzyme (10 U; Takara Shuzo Co., Ltd., Kyoto, Japan) in 10 µl of a mixture containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2,
1 mM dithiothreitol and 100, 50, or 0 mM NaCl. The control was
incubated without the enzyme. The mixture was incubated at 60°C for
15 min to inactivate the enzyme, and the DNA was ethanol precipitated, dissolved in 5 µl of TE, and subjected to PCR in a 50-µl mixture.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Enhancement of PCR amplification of the EBV genome by
pretreatment of the extracted DNA with a restriction enzyme or BSA. The
extracted DNA from paraffin-embedded gastric carcinoma tissue was (+)
or was not ( ) pretreated with a restriction enzyme (lanes 1 to 14) or
BSA (lanes 18 to 27), as described in the text. The DNA was subjected
to PCR-Southern analysis of the BamHI-W region. EBV
genome-positive Raji cell DNA (RJ) (lane 15), EBV genome-negative Ramos
cell DNA (RM) (lane 16), and nonpretreated DNA (C) (lane 17) were
subjected to PCR as controls. The 129-bp PCR product is indicated by an
arrow.
|
|
Pretreatment of the extracted DNA with BstXI (Fig. 1, lane
1), ClaI (lane 3), HindIII (lane 5),
KpnI (lane 7), or SalI (lane 11) resulted in
positive PCR, while the control without enzyme showed either no signal
of amplification (Fig. 1, lanes 2, 4, and 8) or a faint one (lanes 6 and 12). PCR of DNA pretreated with NotI (Fig. 1, lane 9)
and XbaI (lane 13) showed amplification; however, in both
cases, to our surprise the signal was also observed in the controls
(lanes 10 and 14). As for reasons for the amplification, we noticed
that BSA was contained in the original buffers for NotI and
XbaI alone, according to the manufacturer's recommendation. When the BSA was excluded from the buffers, either no signal or a faint
one was observed in the samples (data not shown). These results
indicated that the amplification was induced by not only BamHI or EcoRI but also by the other restriction
enzymes or BSA.
The effect of BSA pretreatment on PCR was analyzed in more detail.
Amplification was improved with BSA (0.01%; Takara Shuzo Co., Ltd.)
(Fig. 1, lanes 18, 19, and 23) compared to amplification of the
controls without BSA (lanes 20 to 22). The effect of BSA was confirmed
by using another BSA (Fig. 1, lane 24) from a different company (Wako
Pure Chemical Ind., Ltd., Osaka, Japan). The effect was also observed
with DNase- and RNase-free BSA (Pharmacia Biotech, Uppsala, Sweden)
(Fig. 1, lane 25) and in a TE buffer which lacked MgCl2, an
essential element for DNase activity (lane 27), while no signal was
observed in the control without BSA (lane 26). These results indicated
that the effect of BSA was not due to the contamination of nuclease in
BSA. The effect (Fig. 1, lane 18) was observed even if the BSA was
removed after the pretreatment (lane 19). On the other hand, the
addition of BSA to the PCR mixture of the DNA sample which was not
pretreated with BSA did not show the amplification signal (Fig. 1, lane
21). These results indicated that BSA exerted its action in
pretreatment but not in the PCR itself.
We hypothesized that an inhibitor(s) of PCR may exist in the extracted
DNA and may be removed by BSA treatment. When the DNA extracted from
the paraffin-embedded gastric carcinoma tissue was purified by
adsorption to silica (27), the amplification of EBV DNA was
greatly improved (Fig. 2A, lane 3) over
that of the nonpurified DNA (lane 1). However, further enhancement of amplification was not observed with BSA pretreatment of the purified DNA (Fig. 2A, lane 4), while it was observed in the unpurified DNA
(lane 2). This result is consistent with the conclusion that the DNA
extracted from paraffin blocks contains a PCR inhibitor(s) whose action
is overcome by preincubation with BSA.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Effect of purification of extracted DNA, BSA, and
various proteins on the PCR in DNA from a gastric carcinoma. The
extracted DNA in Fig. 1 was used for these experiments. (A) DNA was
purified by binding to and elution from silica membrane (SpinBind DNA
recovery system; FMC Bioproducts, Rockland, Maine). The nonpurified DNA
(lanes 1 and 2) and the purified DNA (lanes 3 and 4) were not
pretreated (lanes 1 and 3) or were pretreated with BSA (lanes 2 and 4)
and were subjected to PCR of the BamHI-W region of EBV. The
PCR product is detected at 129 bp. (B) DNA was not pretreated (lane 1)
or was pretreated with BSA (lane 2), 2 macroglobulin
(lane 3), phosphorylase b (lane 4), lactate dehydrogenase
(lane 5), soybean trypsin inhibitor (lane 6), lysozyme (lane 7),
proteinase K (lane 8), S. caespitosus protease (lane 9),
C. histolyticum collagenase (lane 10), or lima bean trypsin
inhibitor (lane 11) and was subjected to PCR analysis. The PCR product
is shown at 129 bp. (C) DNA was subjected to PCR of the -globin gene
(the arrow indicates the 110-bp PCR product of the -globin gene)
(18), without pretreatment (lane 1) or with pretreatment
with BSA (lane 2). (D) DNA was subjected to PCR for the EGF receptor
gene (the arrow indicates the 206-bp PCR product of the EGF receptor
gene) (19), without pretreatment (lane 1) or with
pretreatment with BSA (lane 2).
|
|
We also tested the effect of the pretreatment of DNA with several other
proteins at 0.01%, which were selected from the categories of protease
inhibitors, carrier proteins like BSA, and enzymes other than nuclease.
We found that the four proteins equine plasma
2
macroglobulin (Boehringer Mannheim, Mannheim, Germany) (Fig. 2B, lane
3), rabbit muscle phosphorylase b (Boehringer Mannheim) (Fig. 2B, lane 4), rabbit muscle lactate dehydrogenase (Boehringer Mannheim) (Fig. 2B, lane 5), and chicken egg white lysozyme (Wako Pure
Chemical Ind., Ltd.) (Fig. 2B, lane 7) had effects similar to those of
BSA (Fig. 2B, lane 2). The chicken egg white trypsin inhibitor (Sigma,
St. Louis, Mo.) (not shown) had a much smaller effect than BSA. On the
other hand, the five proteins soybean trypsin inhibitor (Boehringer
Mannheim) (Fig. 2B, lane 6), lima bean trypsin inhibitor (Worthington
Biochemical Corp., Freehold, N.J.) (Fig. 2B, lane 11),
Tritirachium album proteinase K (Merck KGaA, Darmstadt,
Germany) (Fig. 2B, lane 8), Streptomyces caespitosus protease (Sigma) (Fig. 2B, lane 9), and Clostridium
histolyticum collagenase (Sigma) (Fig. 2B, lane 10) had no effect.
Thus, the five animal proteins
albumin, lysozyme, lactate
dehydrogenase, phosphorylase b, and
2
macroglobulin
may have an affinity for the removal of the putative
inhibitor(s), while plant or microbial proteins may not have the
affinity. BSA also enhanced the amplification of cellular genes for
-globin (Fig. 2C, lane 2) and epidermal growth factor (EGF) receptor
(Fig. 2D, lane 2).
Using BSA pretreatment, we detected EBV DNA in 9 of 16 specimens of
gastric carcinoma, while the
-globin gene was well amplified for all
of the specimens (Fig. 3). The specimens
were tested for the expression of EBER by in situ hybridization
(16). The PCR-negative specimens were negative for EBER. The
PCR-positive specimens shown in Fig. 3, lanes 1, 3, 11, and 12, were
positive for EBER, and those in lanes 5, 6, 9, 10, and 16 were negative
for EBER. Therefore, we concluded that the four EBER-positive specimens
(Fig. 3, lanes 1, 3, 11, and 12) were from EBV-infected gastric
carcinomas.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 3.
Detection of EBV DNA in samples extracted from paraffin
blocks containing gastric carcinoma tissue from different patients.
DNAs extracted from 16 specimens (lanes 1 to 16) were treated with BSA
and subjected to PCR for EBV DNA (top) and the -globin gene
(bottom). The specimen in lane 1 was also used in the experiments shown
in Fig. 1 and 2. No PCR amplification was observed in any of the
specimens which did not have BSA treatment (data not shown).
|
|
In conclusion, BSA pretreatment is a useful method for the detection of
EBV DNA by PCR of the DNA extracted from paraffin blocks and could be
applicable in the detection of other viral and cellular DNAs.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biosignaling, Faculty of Medicine, Tottori University, 86 Nishimachi, Yonago 683, Japan. Phone: 81 (859) 34-8041. Fax: 81 (859) 34-8042. E-mail: sairen{at}grape.med.tottori-u.ac.jp.
 |
REFERENCES |
| 1.
|
Abe, K.
1996.
Kangan parafin houmai byouri kentai yorino Bgata, Cgata kan-en uirusu no kenshyutu.
Byouri To Rinshyou
14:276-280. (In Japanese.)
|
| 2.
|
An, S. F., and K. A. Fleming.
1991.
Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.
J. Clin. Pathol.
44:924-927[Abstract/Free Full Text].
|
| 3.
|
Arikawa, J.,
M. Tokunaga,
E. Satoh,
S. Tanaka, and C. E. Land.
1997.
Morphological characteristics of Epstein-Barr virus-associated early gastric carcinoma: a case-control study.
Pathol. Int.
47:360-367[Medline].
|
| 4.
|
Coates, P. J.,
A. J. d'Ardenne,
G. Khan,
H. O. Kangro, and G. Slavin.
1991.
Simplified procedures for applying the polymerase chain reaction to routinely fixed paraffin wax sections.
J. Clin. Pathol.
44:115-118[Abstract/Free Full Text].
|
| 5.
|
de Franchis, R.,
N. C. Cross,
N. S. Foulkes, and T. M. Cox.
1988.
A potent inhibitor of Taq polymerase copurifies with human genomic DNA.
Nucleic Acids Res.
16:10355[Free Full Text].
|
| 6.
|
Fukayama, M.,
Y. Hayashi,
J. Chong,
T. Ooba,
T. Takizawa,
M. Koike,
S. Mizutani,
M. Miyaki, and K. Hirai.
1994.
Epstein-Barr virus-associated gastric carcinoma and Epstein-Barr virus infection of the stomach.
Lab. Investig.
71:73-81[Medline].
|
| 7.
|
Goelz, S. E.,
S. R. Hamilton, and B. Vogelstein.
1985.
Purification of DNA from formaldehyde fixed and paraffin embedded human tissue.
Biochem. Biophys. Res. Commun.
130:118-126[Medline].
|
| 8.
|
Imai, S.,
S. Koizumi,
M. Sugiura,
M. Tokunaga,
Y. Uemura,
N. Yamamoto,
S. Tanaka,
E. Sato, and T. Osato.
1994.
Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein-Barr virus latent infection protein.
Proc. Natl. Acad. Sci. USA
91:9131-9135[Abstract/Free Full Text].
|
| 9.
|
Impraim, C. C.,
R. K. Saiki,
H. A. Erlich, and R. L. Teplitz.
1987.
Analysis of DNA extracted from formalin-fixed, paraffin-embedded tissues by enzymatic amplification and hybridization with sequence-specific oligonucleotides.
Biochem. Biophys. Res. Commun.
142:710-716[Medline].
|
| 10.
|
Jing, X.,
Y. Nakamura,
M. Nakamura,
T. Yokoi,
L. Shan,
E. Taniguchi, and K. Kakudo.
1997.
Detection of Epstein-Barr virus DNA in gastric carcinoma with lymphoid stroma.
Viral Immunol.
10:49-58[Medline].
|
| 11.
|
Kiene, P.,
K. Milde-Langosch,
M. Runkel,
K. Schulz, and T. Löning.
1992.
A simple and rapid technique to process formalin-fixed, paraffin-embedded tissues for the detection of viruses by the polymerase chain reaction.
Virchows Arch. A Pathol. Anat. Histopathol.
420:269-273[Medline].
|
| 12.
|
Lampertico, P.,
J. S. Malter,
M. Colombo, and M. A. Gerber.
1990.
Detection of hepatitis B virus DNA in formalin-fixed, paraffin-embedded liver tissue by the polymerase chain reaction.
Am. J. Pathol.
137:253-258[Abstract].
|
| 13.
|
Lo, Y.-M. D.,
W. Z. Mehal, and K. A. Fleming.
1989.
In vitro amplification of hepatitis B virus sequences from liver tumor DNA and from paraffin wax embedded tissues using the polymerase chain reaction.
J. Clin. Pathol.
42:840-846[Abstract/Free Full Text].
|
| 14.
|
Lo, Y.-M. D.,
E. S.-F. Lo,
W. Z. Mehal,
M. Sampietro,
G. Fiorelli,
G. Ronchi, and C. H. Tse.
1993.
Geographical variation in prevalence of hepatitis B virus DNA in DNA in HBsAg negative patients.
J. Clin. Pathol.
46:304-308[Abstract/Free Full Text].
|
| 15.
|
Min, K. W.,
S. Holmquist,
S. C. Peiper, and T. J. O'Leary.
1991.
Poorly differentiated adenocarcinoma with lymphoid stroma (lymphoepithelioma-like carcinomas) of the stomach. Report of three cases with Epstein-Barr virus genome demonstrated by polymerase chain reaction.
Am. J. Clin. Pathol.
96:219-227[Medline].
|
| 16.
|
Ohfuji, S.,
M. Osaki,
S. Tsujitani,
M. Ikeguchi,
T. Sairenji, and H. Ito.
1996.
Low frequency of apoptosis in Epstein-Barr virus associated gastric carcinoma with lymphoid stroma.
Int. J. Cancer
68:710-715[Medline].
|
| 17.
|
Rogers, B. B.,
L. C. Alpert,
E. A. S. Hine, and G. J. Buffone.
1990.
Analysis of DNA in fresh and fixed tissue by the polymerase chain reaction.
Am. J. Pathol.
136:541-548[Abstract].
|
| 18.
|
Saiki, R. K.,
T. L. Bugawan,
G. T. Horn,
K. B. Mullis, and H. A. Erlich.
1986.
Analysis of enzymatically amplified -globin and HLA-DQ DNA with allele-specific oligonucleotide probes.
Nature
324:163-166[Medline].
|
| 19.
|
Satoh, Y.,
M. Oomae,
Y. Hoshikawa,
M. Izawa,
T. Sairenji, and S. Ichii.
1997.
The truncated epidermal growth factor receptor mRNA is more stable than full-length receptor mRNAs in rat hepatoma cells.
Endocr. J.
44:403-408[Medline].
|
| 20.
|
Sepp, R.,
I. Szabo,
H. Uda, and H. Sakamoto.
1994.
Rapid techniques for DNA extraction from routinely processed archival tissue for use in PCR.
J. Clin. Pathol.
47:318-323[Abstract/Free Full Text].
|
| 21.
|
Shibata, D.,
M. Tokunaga,
Y. Uemura,
E. Sato,
S. Tanaka, and L. M. Weiss.
1991.
Association of Epstein-Barr virus with undifferentiated gastric carcinomas with intense lymphoid infiltration. Lymphoepithelioma-like carcinoma.
Am. J. Pathol.
139:469-474[Abstract].
|
| 22.
|
Shibata, D. K.,
N. Arnheim, and W. J. Martin.
1988.
Detection of human papilloma virus in paraffin-embedded tissues using the polymerase chain reaction.
J. Exp. Med.
167:225-230[Abstract/Free Full Text].
|
| 23.
|
Takasaka, N.,
Y. Satoh,
Y. Hoshikawa,
M. Osaki,
H. Ito,
J.-Y. Chen, and T. Sairenji.
1996.
Improvements in the detection of Epstein-Barr virus DNA on paraffin-embedded gastric carcinoma tissues: treatment of extracted cellular DNA with a restriction enzyme prior to polymerase chain reaction.
Yonago Acta Med.
39:171-176.
|
| 24.
|
Tokunaga, M.,
C. E. Land,
Y. Uemura,
T. Tokudome,
S. Tanaka, and E. Sato.
1993.
Epstein-Barr virus in gastric carcinoma.
Am. J. Pathol.
143:1250-1254[Abstract].
|
| 25.
|
Tomita, Y.,
M. Ohsawa,
Y. Mishiro,
T. Kubo,
N. Maeshiro,
S. Kojya,
Y. Noda, and K. Aozasa.
1995.
The presence and subtype of Epstein-Barr virus in B and T cell lymphomas of the sino-nasal region from the Osaka and Okinawa districts of Japan.
Lab. Investig.
73:190-196[Medline].
|
| 26.
|
Uhara, H.,
Y. Sato,
K. Mukai,
I. Akao,
Y. Matsuno,
S. Furuya,
T. Hoshikawa,
Y. Shimosato, and T. Saida.
1990.
Detection of Epstein-Barr virus DNA in Reed-Sternberg cells of Hodgkin's disease using polymerase chain reaction and in situ hybridization.
Jpn. J. Cancer Res.
81:272-278[Medline].
|
| 27.
|
Vogelstein, B., and D. Gillespie.
1979.
Preparative and analytical purification of DNA from agarose.
Proc. Natl. Acad. Sci. USA
76:615-619[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, November 1998, p. 3423-3425, Vol. 36, No. 11
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kase, S., Adachi, H., Osaki, M., Murakami, M., Sairenji, T., Hashimoto, K., Teramoto, H., Yamamoto, S., Makino, H., Shimizu, E., Watanabe, T., Ohsawa, T., Hagari, Y., Mihara, M., Ito, H.
(2004). Epstein-Barr Virus-Infected Malignant T/NK-Cell Lymphoma in a Patient with Hypersensitivity to Mosquito Bites. INT J SURG PATHOL
12: 265-272
[Abstract]
-
Abu Al-Soud, W., Radstrom, P.
(2000). Effects of Amplification Facilitators on Diagnostic PCR in the Presence of Blood, Feces, and Meat. J. Clin. Microbiol.
38: 4463-4470
[Abstract]
[Full Text]
-
Pietila, J., He, Q., Oksi, J., Viljanen, M. K.
(2000). Rapid Differentiation of Borrelia garinii from Borrelia afzelii and Borrelia burgdorferi Sensu Stricto by LightCycler Fluorescence Melting Curve Analysis of a PCR Product of the recA Gene. J. Clin. Microbiol.
38: 2756-2759
[Abstract]
[Full Text]