Previous Article | Next Article 
Journal of Clinical Microbiology, March 1998, p. 648-651, Vol. 36, No. 3
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Antigenic Diversity of Hepatitis B Virus Strains of
Genotype F in Amerindians and Other Population Groups from
Venezuela
Linda
Blitz,1
Flor H.
Pujol,2,*
Paul D.
Swenson,3
Leticia
Porto,1
Ricardo
Atencio,1
Mary
Araujo,1
Luciana
Costa,1
Diana Callejas
Monsalve,1
Jaime R.
Torres,4
Howard A.
Fields,5
Steve
Lambert,5
Caroline
Van
Geyt,6
Helene
Norder,7
Lars O.
Magnius,7
José M.
Echevarría,8 and
Lieven
Stuyver6
Laboratorio Regional de Referencia
Virológica, Instituto de Investigaciones Clínicas, LUZ,
Maracaibo,1
Laboratorio de
Biología de Virus, CMBC, IVIC,2 and
Instituto de Medicina Tropical, UCV,4
Caracas, Venezuela;
Seattle-King County Department of Public
Health, Seattle, Washington3;
Hepatitis
Branch, Centers for Disease Control and Prevention, Atlanta,
Georgia5;
Innogenetics, Ghent,
Belgium6;
Department of Virology,
Swedish Institute for Infectious Disease Control, Stockholm,
Sweden7; and
Instituto de Salud Carlos
III, CNMVIS, Majadahonda, Spain8
Received 11 July 1997/Returned for modification 9 September
1997/Accepted 20 November 1997
 |
ABSTRACT |
The adw4 subtype of hepatitis B virus (HBV) belongs to a unique
genomic group (genotype F) representing the original HBV strains from
the New World. Data regarding the prevalence of this subtype among HBV
carriers in South America are, however, scarce, and those concerning
HBV genotype F are based on only a few samples from Latin America. In
this study, serum samples were obtained from 141 hepatitis B surface
antigen (HBsAg) carriers from Amerindians and urban populations from
Venezuela. The HBsAg subtype was identified with monoclonal antibodies
in 105 samples, and the HBV genotype was identified by reverse-phase
hybridization with DNA fragments in 58 samples. The adw4 subtype was
highly prevalent in the population studied (75%); among the
Amerindians, the prevalence was 97%. The adw2 subtype was also present
(10%), while other subtypes (ayw3 and ayw4) were only occasionally
found. The HBV subtype was associated with the expected genotype in
most cases (80%), and thus genotype F was highly prevalent. Sequencing
of viral strains that gave genotypes unpredicted by the HBsAg subtyping confirmed seven of them as belonging to not previously described genotype-subtype associations: namely, adw2 and ayw4 within genotype F.
| |
INTRODUCTION |
Hepatitis B virus (HBV) strains
isolated worldwide have been classified into six genomic groups deduced
from genome comparisons and indicated as HBV genotypes A to F (10,
17). Nine serological groups, called hepatitis B surface antigen
(HBsAg) subtypes, have also been defined based on discriminating sera
and have been designated adw2, adw4, adr, adrq
, ayw1, ayw2, ayw3,
ayw4, and ayr (5). It has been shown that each of the known
HBsAg subtypes may belong to either one or several genotypes, but in
such cases, the genotype involved, rather than the subtype, is more
likely to correlate with the geographical origin of the strain
(14).
Data regarding the prevalence of HBsAg subtypes among carriers from
South America are scarce (5, 8), and those concerning the
HBV genotypes in this area have been based on results from only a few
samples from Latin America (1, 4, 11, 12, 14, 16, 25).
However these results do suggest that (i) the adw4 subtype defines a
unique genomic group (genotype F), (ii) this HBV genotype is the
prevalent infectious agent in the original human populations of
America, and (iii) it may represent the first split from the human
hepadnaviral ancestor (11, 15, 16).
To provide further data regarding the genomic characteristics and
antigenic variability of the HBV strains from South America, a study
was carried out involving the identification of HBV subtypes and
genotypes in a large number of HBV strains obtained from Amerindians and other populations from Venezuela.
| |
MATERIALS AND METHODS |
The study comprised 141 serum samples from HBsAg carriers from
the following populations: (i) Amerindians from Western Venezuela (Barí and Yukpa [n = 23], with prevalences
for HBV infection of 11.1 and 7.1%, respectively
[3]); (ii) Amerindians from South Venezuela (Yanomamis
from the Orinoco Basin [n = 12], a group from a
region in which HBV infection is highly endemic; 7.4% prevalence of
HBsAg [26, 27]); (iii) hemodialysis patients from
units with a high prevalence of HBV and hepatitis C virus (HCV)
infection in Caracas (n = 24) (19) and in
Maracaibo (n = 40); (iv) patients with chronic
hepatitis from Maracaibo (where HBsAg positivity was determined over a
period of at least 6 months and histological evidence of chronic
hepatitis was observed upon biopsy [n = 19]); (v)
hemophiliacs from Maracaibo (n = 12); (vi) blood donors
from Caracas (n = 9), where HBsAg prevalence has been
determined as 0.71% (18); and (vii) pregnant women from Puerto La Cruz (0.4% prevalence of HBsAg) (7).
The HBsAg subtype was determined on the basis of the reactivity pattern
by enzyme immunoassay (EIA) with a panel of five monoclonal antibodies
(3C3, 2D11, 3D9, 3A5, and 3E2) as described elsewhere (24).
HBV genotypes were determined with DNA fragments amplified by PCR with
a reverse-phase hybridization assay with genotype-specific probes (line
probe assay [LiPA]) (InnoLiPA HBV; Innogenetics SA, Ghent, Belgium).
HBV genotypes were determined in the pre-S1 and HBsAg regions. The HBV
LiPA genotyping technology (22) is comparable to the test
described for HCV genotyping (23). Primers used for the
amplification were HBPr 134 (outer sense, 5' TGCTGCTATGCCTCATCTTC 3'), HBPr 135 [outer antisense, 5' CA(G/A)AGACAAAAGAAAATTGG
3'], HBPr 75 (nested sense, 5' Bio-CAAGGTATGTTGCCCGTTTGTCC 3'),
and HBPr 94 [nested antisense, 5' Bio-GGTA(A/T)AAAGGGACTCA(A/C)GATG 3'].
In 18 samples, a region of the HBsAg gene corresponding to amino acids
81 to 180 was amplified by PCR and sequenced. The HBV DNA in proteinase
K-treated serum was amplified with primers hep3 and hep33. The
amplified product was purified and used as a template in a sequencing
reaction with hep3 as sequencing primer (13). In three other
samples, the region of the gene corresponding to the major external
region of HBsAg was amplified between codons 109 and 206 with primers
HBPr 75 and HNPr 94. This PCR fragment was purified to remove
unincorporated nucleotides and primers and was further analyzed with an
ABI 373 sequencer by dideoxy chain terminator chemistry with the same
primers for sequencing. In all of these samples, the genotype for each
strain was assessed on the basis of sharing at least 12 of 13 amino
acid substitutions in this region known to be conserved within
genotypes (see Table 3). The HBsAg subtype was deduced from the amino
acid substitutions at positions 122, 127, and 160 (13).
Statistical differences were evaluated by the chi-square test with
Yate's correction and by Fisher's exact test when a value was less
than 5, according to a computerized Epi Info program, version 5.01b
(Centers for Disease Control and Prevention, Atlanta, Ga.).
| |
RESULTS |
In order to assess the HBV genetic variability present in
Venezuela, the HBsAg subtype was analyzed for 141 HBV-infected patients and the HBV genotyping was performed for 58 samples. From the 141 serum
samples, 105 could be subtyped by monoclonal EIA (Table 1). The adw4 subtype was highly prevalent
in all of the population groups studied, except for the hemodialysis
patients from Caracas and chronic patients from Maracaibo, in whom a
wide range of subtypes were circulating, including both ayw3 and ayw4.
Among Amerindians, adw4 accounted for 97% of the infections. The adw2
subtype was detected among patients with chronic hepatitis and patients
undergoing hemodialysis. Subtype ayw4 was significantly associated with
a single hemodialysis unit compared to its prevalence in other
population groups (P < 0.001).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
HBsAg subtypes according to monoclonal typing among
carriers from different population groups from Venezuela
|
|
Out of the 58 genotyped samples, a total of 47 were infected with HBV
genotype F strains, either alone or in a mixture with other genotypes
(6 samples). These mixed infections were only found among hemodialysis
patients. Genotypes A and D were detected in 10 samples, and genotype B
was detected in one patient (Table 2). In
46 cases, both the HBsAg subtype and the HBV genotype were available
for comparison. In all samples but eight (83%), the subtype determined
by EIA was associated with the expected genotype determined by LiPA
(Table 2).
A total of 19 samples were also studied by sequence analysis, and the
genotype and subtype were assigned as shown in Table 3. Genotype-subtype combination
F/adw4 was confirmed in six serum samples, and A/adw2 was confirmed in
five others. One unexpected genotype-subtype association (subject
755 [A/adw4], a West Amerindian) was found upon sequencing of A/adw2.
One unexpected subtype in this population group (subject 22506 [B/adr], a chronic patient) was revealed upon sequencing to belong to
subtype adw2. A methionine at position 143 for the isolate from subject
22506 and a valine at position 159 for the isolate from subject 755 might be responsible for the mistyping by monoclonal antibodies (Table
3). Moreover, one adw2 sample and all five ayw4 samples showed the
unexpected HBV genotype F (Table 2). Sequence analysis confirmed the
HBsAg subtype and the genotype predicted in all of these specimens. An
additional specimen (hemodialysis patient D5 [genotype F]), which
could not be subtyped by EIA because of insufficient HBsAg, was
revealed upon sequencing to belong to the same genotype-subtype group
of F/ayw4.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Genotype- and subtype-specific amino acid substitutions
between residues 81 and 180 of the primary structure of HBsAg
|
|
| |
DISCUSSION |
In agreement with previous reports regarding the HBsAg subtypes in
South America (5-7), this study showed that the adw4
subtype was highly prevalent among HBV carriers from Venezuela, being almost unique among the Amerindians. As expected, most of the adw4
strains were grouped into genotype F, and this genotype was the most
prevalent among the samples studied. These findings support prior
conclusions regarding the American origin of this genotype (1) and its correlation with the adw4 subtype (11-13,
15). Most adw2 strains were grouped in genotype A, and this is
likely to reflect its North American or European origin (14,
25). Infections with multiple genotypes were detected in seven
cases of infection, and these mixed infections always involved genotype F. All of these cases were found among hemodialysis patients, who are
considered high-risk patients for multiple infections by parenterally
transmitted viruses. Such mixed infections in high-risk patients have
previously been documented for HCV genotypes (9),
particularly in this group of patients (20). Slightly different results between serotyping and genotyping were observed concerning these mixed infections, but this discrepancy can be explained by the higher sensitivity of the genotypic amplification procedures (PCR amplification of few viral copies) compared to that of the serotyping technology (requiring larger amounts of HBsAg
protein).
Besides the high correlation found between HBsAg subtypes and HBV
genotypes, eight samples from this study were classified into HBV
genomic groups which were not predicted by the subtyping (Table 2).
Such discrepancies involved samples from four of the subtypes found in
the study, but especially concerned samples from the ayw4 subtype that
were all recognized as genotype F. The confirmation of both subtype
ayw4 and genotype F after sequencing of six strains and adw2 subtype
and genotype F in one strain suggests that two previously unrecognized
geno-antigenic groups of HBV strain (subtypes ayw4 and adw2, genotype
F) exist in South America. These new associations were only found among
hemodialysis patients from the same unit from Caracas, where nosocomial
transmission of HBV could be playing a role in viral dissemination as
it seems to for HCV (19). Indeed, the distribution of HBV
variants in hemodialysis patients from Caracas was significantly
different from that observed in other patient groups, suggesting that
nosocomial transmission might explain this cluster of F/ayw4 in this
setting. However, the presence of genotype F/ayw4 cannot exclusively be attributed to an outbreak in a hemodialysis unit from Caracas, because
this new association has recently been found in other Latin American
countries (2). In contrast, more European-like HBV strains
were found circulating among chronic patients from Maracaibo. This
situation is probably due to the European immigration that has always
been significant in Venezuela. Interestingly, strains of HBV from the
old-world lineages were also observed in the Amerindians tested (Tables
1 and 2), suggesting that these strains had been introduced even in the
more isolated communities from Venezuela.
Genotype F of HBV has been defined on the basis of sequences obtained
from strains from France, Alaska, Colombia, and Brazil (11-14,
16). Its full characterization is likely to require the study of
additional samples from other populations. On the other hand, the HBV
strains from the ayw4 subtype have been previously classified into two
different genotypes, genotype E in Africa and a single genotype D
strain from the United States, MS-2 (14). The new
genotype-subtype associations found in this study corroborate the
genetic diversity of the ayw4 subtype and suggest an antigenic diversity inside genotype F, which would now include adw2 and ayw4 in
addition to adw4. Table 4 summarizes the
present knowledge about the genotype-subtype associations of HBV,
including the novel data reported here.
Genotyping of HBV strains might also give an explanation for some
pathogenic aspects of HBV infection which are likely to show
peculiarities in some geographical areas (14). The ability to be transmitted vertically, oncogenic potential, and susceptibility to vaccine-induced immunity could be different in some HBV genotypes, and these differences might explain the predominance of mother-to-child transmission in the spread of HBV in the Far East (21), the geographical variations in the incidence of the HBV-associated liver
cancer, or the failure of vaccine-induced immunity to prevent HBV
infection reported in Africa (6). More severe cases of HBV
coinfection with hepatitis delta virus have also been described in
South America, and a phenomenon of coevolution of HBV genotype F with
hepatitis delta virus genotype III has been suggested and might be
responsible for this severe form of disease (4). Therefore, the high predominance of genotype F strains found in this study warrants future investigations of these aspects of HBV infection in
South America.
| |
ACKNOWLEDGMENTS |
This work was supported by grant 1722-95 from Proyecto
LUZ-CONDES, Venezuela; Swedish Cancer Society grant 3312-B95-04XAA; and
Swedish Medical Research Council grant K97-06X-10365-05.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratorio de
Biología de Virus, CMBC, IVIC, Apdo 21827, Caracas 1020-A,
Venezuela. Phone: 58.2.5041623. Fax: 58.2.5041623. E-mail:
fpujol{at}pasteur.ivic.ve.
| |
REFERENCES |
| 1.
|
Arauz-Ruiz, P.,
H. Norder,
K. A. Visoná, and L. O. Magnius.
1996.
Genotype F prevails in HBV infected patients of Hispanic origin in Central America and may carry the precore stop mutant.
J. Med. Virol.
51:305-312.
|
| 2.
|
Arauz-Ruiz, P.,
H. Norder,
K. A. Visoná, and L. O. Magnius.
1997.
Molecular epidemiology of hepatitis B virus in Central America reflected in the genetic variability of the small S gene.
J. Infect. Dis.
176:851-858[Medline].
|
| 3.
|
Blitz-Dorfman, L.,
F. Monsalve,
R. Atencio,
M. Monzon,
M. O. Favorov,
H. A. Fields,
F. H. Pujol, and J. M. Echeverría.
1996.
Serological survey of viral hepatitis agents among Yukpa Amerindian populations from Western Venezuela. Absence of hepatitis C infection.
Ann. Trop. Med. Parasitol.
90:655-657[Medline].
|
| 4.
|
Casey, J. L.,
G. A. Niro,
R. E. Engle,
A. Vega,
H. Gomez,
M. McCarthy,
D. M. Watts,
K. C. Hyams, and J. L. Gerin.
1996.
Hepatitis B virus (HBV)/hepatitis D virus (HDV) coinfection in outbreaks of acute hepatitis in the Peruvian Amazon Basin: the roles of HDV genotype III and HBV genotype F.
J. Infect. Dis.
174:920-926[Medline].
|
| 5.
|
Couroucé-Pauty, A.-M.,
A. Plançon, and J. P. Soulier.
1983.
Distribution of HBsAg subtypes in the world.
Vox Sang.
44:197-211[Medline].
|
| 6.
|
Coursaget, P.,
C. Bourdil,
P. Adamowicz,
J. Chotard,
J. Diop Mar,
B. Ivonnet,
M. Mevelec,
J. L. Barrés,
R. N'Doye, and J. P. Chiron.
1987.
HBsAg reactivity in man not due to hepatitis B virus.
Lancet
ii:1354-1358.
|
| 7.
|
del Nunzio, J.,
J. Brito,
S. Brazón,
C. Carpio,
E. Ledezma, and F. H. Pujol.
1997.
Prevalencia de marcadores serológicos para hepatitis B y C en mujeres gestantes del Estado Anzoátegui.
GEN
51:226-229.
|
| 8.
|
Gaspar, A. M. C., and C. F. T. Yoshida.
1987.
Geographic distribution of the HBsAg subtypes in Brazil.
Mem. Inst. Oswaldo Cruz
82:253-258[Medline].
|
| 9.
|
Jarvis, L. M.,
H. G. Watson,
F. McOmish,
J. F. Peutherer,
C. A. Ludlam, and P. Simmonds.
1994.
Frequent reinfection and reactivation of hepatitis C virus genotypes in multitransfused hemophiliacs.
J. Infect. Dis.
170:1018-1022[Medline].
|
| 10.
|
Magnius, L. O., and H. Norder.
1995.
Subtypes, genotypes and molecular epidemiology of the hepatitis B virus as reflected by sequence variability of the S-gene.
Intervirology
38:24-34[Medline].
|
| 11.
|
Naumann, H.,
S. Schaefer,
C. F. T. Yoshida,
A. M. C. Gaspar,
R. Repp, and W. H. Gerlich.
1993.
Identification of a new hepatitis B virus (HBV) genotype from Brazil that expresses HBV surface antigen subtype adw4.
J. Gen. Virol.
74:1627-1632[Abstract/Free Full Text].
|
| 12.
|
Niel, C.,
M. T. B. Moraes,
A. M. C. Gaspar,
C. F. T. Yoshida, and S. A. Gomes.
1994.
Genetic diversity of hepatitis B virus strains isolated in Río de Janeiro, Brazil.
J. Med. Virol.
44:180-186[Medline].
|
| 13.
|
Norder, H.,
B. Hammas,
S. Löfdahl,
A.-M. Couroucé, and L. O. Magnius.
1992.
Comparison of the amino acid sequences of nine different serotypes of hepatitis B surface antigen and genomic classification of the corresponding hepatitis B virus strains.
J. Gen. Virol.
73:1201-1208[Abstract/Free Full Text].
|
| 14.
|
Norder, H.,
B. Hammas,
S.-D. Lee,
K. Bile,
A.-M. Couroucé,
I. K. Mushawar, and L. O. Magnius.
1993.
Genetic relatedness of hepatitis B viral strains of diverse geographical origin and natural variation in the primary structure of the surface antigen.
J. Gen. Virol.
74:1341-1348[Abstract/Free Full Text].
|
| 15.
|
Norder, H.,
A.-M. Couroucé, and L. O. Magnius.
1993.
Complete nucleotide sequences of six hepatitis B viral genomes encoding the surface antigens ayw4, adw4q, and adrq and their phylogenetic classification.
Arch. Virol.
8:S189-S199.
|
| 16.
|
Norder, H.,
A.-M. Couroucé, and L. O. Magnius.
1994.
Complete genomes, phylogenetic relatedness and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes.
Virology
198:489-503[Medline].
|
| 17.
|
Okamoto, H.,
F. Tsuda,
H. Sakugawa,
R. I. Sastrosoewignjo,
M. Imai,
Y. Miyakawa, and M. Mayumi.
1988.
Typing hepatitis B virus by homology in nucleotide sequence of surface antigen subtypes.
J. Gen. Virol.
69:2575-2583[Abstract/Free Full Text].
|
| 18.
|
Ponce, J. G.,
L. F. Cadenas,
F. García,
G. León,
L. Blitz-Dorfman,
F. Monsalve, and F. H. Pujol.
1994.
High prevalence of serological markers for hepatitis B and C in indigent patients from Caracas, Venezuela.
Invest. Clin.
35:123-129[Medline].
|
| 19.
|
Pujol, F. H.,
J. G. Ponce,
M. G. Lema,
F. Capriles,
M. Devesa,
F. Sirit,
M. Salazar,
G. Vásquez,
F. Monsalve, and L. Blitz-Dorfman.
1996.
High incidence of hepatitis C virus infection in hemodialysis patients in units with high prevalence.
J. Clin. Microbiol.
34:1633-1636[Abstract].
|
| 20.
|
Pujol, F. H.,
C. L. Loureiro,
M. Devesa,
L. Blitz,
K. Parra,
S. Beker, and F. Liprandi.
1997.
Determination of genotypes of hepatitis C virus in Venezuela by restriction fragment length polymorphism.
J. Clin. Microbiol.
35:1870-1872[Abstract].
|
| 21.
|
Stevens, C. E.,
R. A. Neurath,
R. P. Beasly, and W. Szmuness.
1979.
HBeAg and anti-Hbe detection by radioimmunoassay. Correlation with vertical transmission of hepatitis B virus in Taiwan.
J. Med. Virol.
3:237-241[Medline].
|
| 22.
| Stuyver, L., R. Rossau, and G. Maertens. 1995. Line
probe assays for the detection of hepatitis B and C virus genotypes.
Antivir. Ther. 1(Suppl. 3):53-57.
|
| 23.
|
Stuyver, L.,
A. Wyseur,
W. van Arnhem,
F. Hernandez, and G. Maertens.
1996.
Second-generation line probe assay for hepatitis C virus genotyping.
J. Clin. Microbiol.
34:2259-2266[Abstract].
|
| 24.
|
Swenson, P. D.,
J. T. Riess, and L. E. Krueger.
1991.
Determination of HBsAg subtypes in different high risk populations using monoclonal antibodies.
J. Virol. Methods
33:27-38[Medline].
|
| 25.
|
Telenta, P. F.,
G. P. Poggio,
J. L. Lopez,
J. Gonzalez,
A. Lemberg, and R. H. Campos.
1997.
Increased prevalence of genotype F hepatitis B virus isolates in Buenos Aires, Argentina.
J. Clin. Microbiol.
35:1873-1875[Abstract].
|
| 26.
|
Torres, J., and A. Mondolfi.
1991.
Protracted outbreak of severe delta hepatitis: experience in an isolated Amerindian population of the upper Orinoco basin.
Rev. Infect. Dis.
13:52-55[Medline].
|
| 27.
|
Torres, J.
1996.
Hepatitis B and hepatitis delta virus infections in South America.
Gut
38:S48-S55.
|
Journal of Clinical Microbiology, March 1998, p. 648-651, Vol. 36, No. 3
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Lusida, M. I., Nugrahaputra, V. E., Soetjipto, , Handajani, R., Nagano-Fujii, M., Sasayama, M., Utsumi, T., Hotta, H.
(2008). Novel Subgenotypes of Hepatitis B Virus Genotypes C and D in Papua, Indonesia. J. Clin. Microbiol.
46: 2160-2166
[Abstract]
[Full Text]
-
Laperche, S., Thibault, V., Bouchardeau, F., Alain, S., Castelain, S., Gassin, M., Gueudin, M., Halfon, P., Larrat, S., Lunel, F., Martinot-Peignoux, M., Mercier, B., Pawlotsky, J.-M., Pozzetto, B., Roque-Afonso, A.-M., Roudot-Thoraval, F., Saune, K., Lefrere, J.-J.
(2006). Expertise of laboratories in viral load quantification, genotyping, and precore mutant determination for hepatitis B virus in a multicenter study.. J. Clin. Microbiol.
44: 3600-3607
[Abstract]
[Full Text]
-
Cuestas, M. L., Mathet, V. L., Ruiz, V., Minassian, M. L., Rivero, C., Sala, A., Corach, D., Alessio, A., Pozzati, M., Frider, B., Oubina, J. R.
(2006). Unusual Naturally Occurring Humoral and Cellular Mutated Epitopes of Hepatitis B Virus in a Chronically Infected Argentine Patient with Anti-HBs Antibodies.. J. Clin. Microbiol.
44: 2191-2198
[Abstract]
[Full Text]
-
VIANA, S., PARANA, R., MOREIRA, R. C., COMPRI, A. P., MACEDO, V.
(2005). HIGH PREVALENCE OF HEPATITIS B VIRUS AND HEPATITIS D VIRUS IN THE WESTERN BRAZILIAN AMAZON. Am J Trop Med Hyg
73: 808-814
[Abstract]
[Full Text]
-
Franca, P. H. C., Gonzalez, J. E., Munne, M. S., Brandao, L. H., Gouvea, V. S., Sablon, E., Vanderborght, B. O. M.
(2004). Strong Association between Genotype F and Hepatitis B Virus (HBV) e Antigen-Negative Variants among HBV-Infected Argentinean Blood Donors. J. Clin. Microbiol.
42: 5015-5021
[Abstract]
[Full Text]
-
Imamura, T, Yokosuka, O, Kurihara, T, Kanda, T, Fukai, K, Imazeki, F, Saisho, H
(2003). Distribution of hepatitis B viral genotypes and mutations in the core promoter and precore regions in acute forms of liver disease in patients from Chiba, Japan. Gut
52: 1630-1637
[Abstract]
[Full Text]
-
Norder, H., Arauz-Ruiz, P., Blitz, L., Pujol, F. H., Echevarria, J. M., Magnius, L. O.
(2003). The T1858 variant predisposing to the precore stop mutation correlates with one of two major genotype F hepatitis B virus clades. J. Gen. Virol.
84: 2083-2087
[Abstract]
[Full Text]
-
Arauz-Ruiz, P., Norder, H., Robertson, B. H., Magnius, L. O.
(2002). Genotype H: a new Amerindian genotype of hepatitis B virus revealed in Central America. J. Gen. Virol.
83: 2059-2073
[Abstract]
[Full Text]
-
Kidd-Ljunggren, K., Miyakawa, Y., Kidd, A. H.
(2002). Genetic variability in hepatitis B viruses. J. Gen. Virol.
83: 1267-1280
[Abstract]
[Full Text]
-
Smith, A. L., Hesketh, P., Archer, A., Shirley, M. W.
(2002). Antigenic Diversity in Eimeria maxima and the Influence of Host Genetics and Immunization Schedule on Cross-Protective Immunity. Infect. Immun.
70: 2472-2479
[Abstract]
[Full Text]
-
Ivaniushina, V., Radjef, N., Alexeeva, M., Gault, E., Semenov, S., Salhi, M., Kiselev, O., Deny, P.
(2001). Hepatitis delta virus genotypes I and II cocirculate in an endemic area of Yakutia, Russia. J. Gen. Virol.
82: 2709-2718
[Abstract]
[Full Text]
-
Stuyver, L., De Gendt, S., Van Geyt, C., Zoulim, F., Fried, M., Schinazi, R. F., Rossau, R.
(2000). A new genotype of hepatitis B virus: complete genome and phylogenetic relatedness. J. Gen. Virol.
81: 67-74
[Abstract]
[Full Text]
-
Warren, K. S., Heeney, J. L., Swan, R. A., Heriyanto, , Verschoor, E. J.
(1999). A New Group of Hepadnaviruses Naturally Infecting Orangutans (Pongo pygmaeus). J. Virol.
73: 7860-7865
[Abstract]
[Full Text]
Top
Abstract
Introduction
