JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adu-Bobie, J.
Right arrow Articles by Dougan, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adu-Bobie, J.
Right arrow Articles by Dougan, G.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, March 1998, p. 662-668, Vol. 36, No. 3
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Detection of Intimins alpha , beta , gamma , and delta , Four Intimin Derivatives Expressed by Attaching and Effacing Microbial Pathogens

Jeannette Adu-Bobie,1 Gad Frankel,1,* Christopher Bain,2 Azizedite Guedes Goncalves,3 Luiz R. Trabulsi,3 Gill Douce,1 Stuart Knutton,2 and Gordon Dougan1

Department of Biochemistry, Imperial College of Science, Technology and Medicine, London SW7 2AZ,1 and Institute of Child Health, The University of Birmingham B16 8ET,2 United Kingdom, and Departmento de Microbiologia, Instituto de Ciências Biomédicas, Universidade de São Paulo, São Paulo, Brazil3

Received 10 July 1997/Returned for modification 15 October 1997/Accepted 19 November 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Intimins are outer membrane proteins expressed by enteric bacterial pathogens capable of inducing intestinal attachment-and-effacement lesions. A eukaryotic cell-binding domain is located within a 280-amino-acid (Int280) carboxy terminus of intimin polypeptides. Polyclonal antiserum was raised against Int280 from enteropathogenic Escherichia coli (EPEC) serotypes O127:H6 and O114:H2 (anti-Int280-H6 and anti-Int280-H2, respectively), and Western blot analysis was used to explore the immunological relationship between the intimin polypeptides expressed by different clinical EPEC and enterohemorrhagic E. coli (EHEC) isolates, a rabbit diarrheagenic E. coli strain (RDEC-1), and Citrobacter rodentium. Anti-Int280-H6 serum reacted strongly with some EPEC serotypes, whereas anti-Int280-H2 serum reacted strongly with strains belonging to different EPEC and EHEC serotypes, RDEC-1, and C. rodentium. These observations were confirmed by using purified Int280 in an enzyme-linked immunosorbent assay and by immunogold and immunofluorescence labelling of whole bacterial cells. Some bacterial strains were recognized poorly by either antiserum (e.g., EPEC O86:H34 and EHEC O157:H7). By using PCR primers designed on the basis of the intimin-encoding eae gene sequences of serotype O127:H6, O114:H2, and O86:H34 EPEC and serotype O157:H7 EHEC, we could distinguish between different eae gene derivatives. Accordingly, the different intimin types were designated alpha , beta , delta , and gamma , respectively.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Enteropathogenic Escherichia coli (EPEC) is a major cause of acute and persistent infantile diarrhea in developing parts of the world (33). Traditionally, EPEC strains are considered to belong to 12 different O serogroups: O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158 (48). Population genetic surveys, using multilocus enzyme electrophoresis, have shown that the classical EPEC strains have diverged into two major groups of related clones, designated EPEC clones 1 and 2 (39, 47). Within each group, a variety of O antigens are present while the somatic flagellar (H) antigens are conserved. Strains belonging to EPEC clone 1 typically express H6 and H34, whereas EPEC clone 2 strains express H2 (39, 46).

Small-bowel biopsies of children infected with EPEC reveal discrete colonies of bacteria attached to the mucosa (45). Binding of EPEC to the brush border triggers a cascade of transmembrane and intracellular signals leading to cytoskeletal reorganization and formation of a specific lesion, termed the attachment-and-effacement (A/E) lesion (36). This lesion is characterized by destruction of brush border microvilli and intimate adherence of bacteria to cup-like pedestals formed by the bare enterocyte cell membrane (28). High concentrations of polymerized actin are present in the enterocyte beneath the site of bacterial attachment (29). Infection of cultured epithelial cells by EPEC not only induces A/E lesions morphologically similar to those seen in biopsies but also produces a characteristic pattern of adherence, termed localized adherence (LA) (41). A/E lesions are also induced by other enterobacteria, including enterohemorrhagic E. coli (EHEC), the causative agent of bloody and nonbloody diarrhea, as well as of hemolytic-uremic syndrome, in humans (40, 43); Hafnia alvei, which has been isolated from children with diarrhea (3); Citrobacter rodentium, the causative agent of transmissible colonic hyperplasia in laboratory mice (4, 42); and rabbit-specific EPEC strains; including rabbit diarrheagenic E. coli RDEC-1, which cause diarrhea in rabbits (8).

Experiments with cultured epithelial cells have implicated several genes in LA and A/E lesion formation by EPEC. These genes map predominantly to two sites. The first is a 35-kbp pathogenicity island termed the locus of enterocyte effacement or the LEE region (26, 35). This locus, found in all A/E lesion-forming bacteria (35), encodes a type III secretion system (22), a series of secreted proteins (EPEC-secreted proteins or Esps) (12, 27, 32), and intimin, the product of the eae gene (23, 24) that mediates intimate bacterial adhesion to epithelial cells and is required for full virulence in volunteers (13, 14). The second is the ca. 90-kbp EPEC-adherence factor (EAF) plasmid common to all typical EPEC strains (25, 38). The EAF plasmid encodes the bundle-forming pilus (Bfp) protein, which plays a role in LA, facilitates the formation of the A/E lesion (11, 18), and contains a regulatory locus (the per locus) (19) that appears to control and coordinate the expression of several EPEC virulence factors, including intimin (19, 30).

The eae genes of several EPEC and EHEC strains, RDEC-1, and C. rodentium and the 3' end of eae of H. alvei have been cloned and sequenced (1, 5, 15, 23, 42, 49). Comparison of the amino acid sequences of the different intimins has revealed that the N-terminal regions are highly conserved, while the C termini show much less similarity. Nevertheless, two Cys residues at the C termini are conserved among all of the intimin family members. Recently, we expressed the 280-amino-acid C-terminal domain of intimin (Int280) and derivatives of this domain containing N- and C-terminal deletions as maltose-binding protein (MBP) fusions and tested their cell-binding properties (15, 16). Cell-binding activity was observed only with the MBP-Int280 and MBP-Int150 fusions, localizing a cell-binding function of intimin to the C-terminal 150 amino acids (16). Cell-binding activity was abolished when Cys937 was replaced with Ser (16).

Preliminary evidence from volunteer and epidemiological studies suggests that anti-intimin antibodies might play a key role in protection against EPEC infection (7). In this report, we describe the production and characterization of polyclonal antisera raised against Int280, expressed as a His-tagged polypeptide, from EPEC clone 1 and 2 strains of serotypes O127:H6 (ant-Int280-H6) and O114:H2 (ant-Int280-H2), respectively. We found that antigenic variation exists within the cell-binding domain of intimins expressed by different clinical EPEC and EHEC isolates. By using PCR primers designed on the basis of the eae sequences of EPEC strains of serotypes O127:H6, O114:H2, and O86:H34 and EHEC of serotype O157:H7, we classified the intimin family into at least five distinct subtypes.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Bacterial strains. The bacterial strains used in this study included clinical EPEC strains of serotypes O127:H6 (E2348/69 [34] and ICC64 [15]), O114:H2 (ICC61) (21), O111:H- (B171) (18), and O86:H34 (ICC95) (this study); an eae serotype O127:H6 mutant (CVD206) (10); and strains of the serotypes listed in Tables 1 and 2. Bacterial strains were grown in L broth or L agar. The medium used was supplemented with 100-µg/ml ampicillin or 30-µg/ml kanamycin when appropriate. For immunodetection of intimin in whole-cell extracts, stationary-phase L-broth cultures were diluted 1:100 in Dulbecco's modified Eagle's medium containing 2 mM L-glutamine (DMEM) and incubated at 28 or 37°C.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Summary of Western blotting analysis and immunogold and immunofluorescent labelling of intimin

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Summary of PCR analysis of intimin derivatives

Preparation of MBP-Int fusion proteins. MBP-Int280 fusion protein from EPEC ICC64 (Int280-H6) was purified as previously described (15). MBP-Int280 fusions from EPEC strains ICC61 (Int280-H2) and B171 were constructed and purified as described for the other MBP-Int280 fusion protein (15).

Preparation of His-Int280-H6 and His-Int280-H2. To express Int280 from ICC64 and ICC61 separately from MBP, the DNA fragments encoding this domain within pMAL-c2 were gel purified with the Prep-A-Gene DNA purification system (Bio-Rad) after EcoRI/HindIII endounuclease digestion. The fragments were then subcloned into a similarly digested pET-28a vector (Novagen Biotechnology), and the recombinant plasmids were transformed into E. coli BL21. The His-Int280 polypeptides were purified as suggested by the manufacturer. Briefly, 1 ml of an overnight culture of BL21 containing the recombinant pET28a plasmid was inoculated into 100 ml of L broth supplemented with 0.2% glucose and 30-µg/ml kanamycin. The culture was incubated for 2 h at 37°C with shaking, and expression of His-Int280 was induced by addition of 24 mg of isopropyl-beta -D-thiogalactopyranoside (IPTG). After an additional 4 h of incubation at 30°C, the cells were harvested by centrifugation, the supernatant was discarded, and the pellet was resuspended in 8 ml of binding buffer (5 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9) and frozen overnight. The culture was then sonicated at maximum intensity in 10-s bursts for a total of 3 min with 1-min intervals. The lysate was centrifuged at 3,200 × g for 30 min, and the supernatant was loaded onto a prewashed nickel column with a 2.5-ml bed volume. After loading of the cell extract the column was washed with 25 ml of binding buffer and 7.5 ml each of wash buffers 1 (30 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9), and 2 (60 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9). The bound protein was eluted with 15 ml of elute buffer (500 mM imidazole). The fractions were analyzed by electrophoresis on a 10% polyacrylamide gel (see below).

Preparation of polyclonal sera. Female Sandy half-lop rabbits were immunized subcutaneously with 50 to 100 µg of His-Int280-H6 (made from ICC64) or His-Int280-H2 (made from ICC61) in complete Freund's adjuvant. The animals were boosted twice with the same antigen in incomplete Freund's adjuvant at 3-week intervals before exsanguination.

PAGE. Polyacrylamide gel electrophoresis (PAGE) in the presence of sodium dodecyl sulfate (SDS) was performed as described by Laemmli (31). Protein samples and bacterial extracts to be separated were diluted in an equal volume of 2× sample buffer (2% [wt/vol] SDS, 2% [vol/vol] 2-mercaptoethanol, 20% [wt/vol] glycerol, and 0.01% [wt/vol] bromophenol blue in 0.0065 M Tris, pH 6.8) and boiled for 5 min prior to loading onto 7.5 to 10% gels. Molecular sizes were estimated by using Rainbow molecular size markers (Amersham). Following electrophoresis, the separated proteins were visualized by staining the gel with Coomassie stain or transferred to nitrocellulose membrane.

Western blotting (immunoblotting). Proteins separated by SDS-PAGE were transferred electrophoretically onto nitrocellulose membranes (Schleicher & Schuell) and immunoblotted as described by Towbin et al. (44) and Burnette (6), at 80 V for 90 min. The membranes were blocked overnight in 3% bovine serum albumin (BSA), washed three times with phosphate-buffered saline (PBS) containing 0.05% Tween 20 (PBST), and then reacted with the antiserum of interest for 2 h. Anti-Int280-H6 and anti-Int280-H2 sera were diluted 1:750 and 1:5,000, respectively, in PBST containing 0.1% BSA. After three washes with PBST, the bound antibodies were reacted with horseradish peroxidase-conjugated swine anti-rabbit serum (1:1,000 dilution; DAKO) and the membranes were developed with hydrogen peroxide and 3'3'-diaminobenzidine (Sigma).

Enzyme-linked immunosorbent assay (ELISA). Briefly, 96-well enzyme immunoassay-radioimmunoassay plates (Costar) were coated overnight at 4°C with 2.5-µg/ml Int280 in PBS at 50 µl/well. The wells were washed three times in PBST and blocked for 1 h at 37°C with PBST-1% BSA. The plates were washed again and then incubated with fivefold serial dilutions of the primary antibody to determine the antiserum titer. Two-hour incubations with primary and secondary antibodies, diluted in PBST-0.1% BSA, were carried out at 37°C with PBST washes after each step. Fifty microliters of substrate (10-mg o-phenylenediamine tablet [Sigma] in 12.125 ml of 0.1 M citric acid-12.875 ml of 0.25 M NaHPO4-10 µl of 30% H2O2) was added to each well. The enzymatic reaction was terminated by addition of 12.5% H2SO4. The colorimetric reactions were recorded by using a Ceres 900 HDi (Bio-Tek Instruments, Inc.) microtiter plate reader. The optical density values were plotted for each sample, and the titers were determined as the reciprocal dilution giving an A490 of 0.3 above the background. All titrations and experiments were performed in duplicate. A positive reference serum was used on each plate, and the results were adjusted accordingly.

Immunogold labelling of bacterial cells. For immunogold labelling of bacteria, stationary-phase L-broth cultures of representative strains were diluted 1:100 in DMEM and grown at 37°C for 4 h. Samples (10 µl) of washed bacterial suspensions were applied to carbon-coated grids, and after 5 min, excess liquid was removed and the grids were immediately placed face down on drops of anti-Int280-H6 or anti-Int280-H2 serum (diluted 1:40 in PBS containing 0.2% BSA [PBS/BSA]) for 30 min. After thorough washing in PBS/BSA, grids were placed on drops of 10-nm gold-labelled goat anti-rabbit serum (diluted 1:20; British BioCell International) and incubated for 30 min. After further washing with PBS/BSA and distilled water, grids were air dried and viewed under a JEOL 1200EX electron microscope operated at 80 kV.

Immunofluorescent labelling of bacterial cells. Immunofluorescent staining was performed on bacteria adhering to HEp-2 cells following a 3-h incubation of HEp-2 cell monolayers with overnight cultures (30). Formalin-fixed and washed infected-cell monolayers were incubated with anti-Int280-H6 or anti-Int280-H2 serum (diluted 1:40) for 45 min. After three 5-min washes with PBS/BSA, monolayers were stained with fluorescein isothiocyanate-conjugated goat anti-rabbit immunoglobulin G (IgG; Sigma; diluted 1:20) for 45 min. HEp-2 cell preparations were also labelled for cellular actin by simultaneously staining coverslips with a 5-µg/ml solution of tetramethyl rhodamine isocyanate-phalloidin (Sigma) (30). Preparations were washed three times with PBS, mounted in glycerol-PBS, and examined by incident-light fluorescence by using a Leitz Dialux microscope. Fluorescence and phase-contrast images of the same field were recorded.

DNA sequencing of Int280 from ICC61 and ICC95. The DNA sequence of Int280 from ICC61 was determined from the recombinant pET28a construct and from three independent Taq polymerase (Appligene) PCR products cloned into vector pGEM-T (Promega). The DNA sequence of Int280 from ICC95 was determined from a vent polymerase (New England Biolabs) PCR product cloned into pGEM-T. The primers used were pET28 T7 promoter (5' TTAATACGACTCACTATAGG), pET28 T7 terminator (5' CTAGTTATTGCTCAGCGGT), pGEM-T V1 (5' TGTAAAACGAAGGCCAGT), and pGEM-T V2 (5' ATGTTGTGTGAATTGTG). Plasmids were purified from a 4.5-ml overnight culture. After centrifugation, the bacterial pellets were resuspended in 200 µl of 50 mM Tris-HCl (pH 7.5) and a 10 mM EDTA solution containing 100-µg/ml RNase A. A lysis solution (200 µl of 0.2 M NaOH-1% SDS) was added before the mixtures were neutralized with 200 µl of 1.32 M potassium acetate (pH 4.8). Following 5 min of centrifugation, the supernatants were extracted twice with 400 µl of chloroform and the plasmid DNA was precipitated in an equal volume of isopropanol. After washing with 70% ethanol, the DNA pellets were dried under vacuum, dissolved in 32 µl of deionized water, and then reprecipitated by addition of 8 µl of 4 M NaCl and 40 µl of 13% polyethylene glycol 8000. Following 20 min of incubation on ice, the mixtures were centrifuged at 4°C for 15 min and the pellets were rinsed with 70% ethanol, dried under vacuum, and resuspended in 25 µl of deionized water. DNA sequencing was performed by using 0.5 to 1 µg of template DNA and a vector-derived primer with a Perkin Elmer ABI/Prism 377 automated DNA sequencer in accordance with the manufacturer's instructions. On the basis of the emerging DNA sequence, additional (walking) primers were synthesized in the forward and reverse orientations (for sequencing of both DNA strands). Sequence analysis and contig assembly were carried out by using Genejockey II in an Apple Macintosh computer.

PCR. PCR (37) was used to amplify a segment of the eae gene. Thirty amplification cycles of 95°C for 20 s, 45°C for 1 min, and 74°C for 1 min (except for the Int-gamma primer, for which the annealing temperature was 55°C) were employed. A 25-pmol sample of each primer (Table 3) and 1.5 U of Taq DNA polymerase (Appligene, Durham, United Kingdom) were used. For each reaction, about one-third of a colony was transferred to a 0.5-ml tube containing the PCR mixture and primers and the tubes were incubated at 95°C for 5 min prior to the PCR cycling. Ten microliters of each reaction mixture was analyzed by agarose gel electrophoresis.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Primer sequences used in PCR to classify intimin subtypes

Nucleotide sequence accession numbers. The nucleotide sequences encoding Int280 from ICC61 and ICC95 have been submitted to the EMBL database under accession no. Y13111 and Y13112, respectively.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Immunoreactivity of anti-Int280-H6 serum. The cell-binding domain of intimin from EPEC strain ICC64 (O127:H6), expressed as a His-tagged polypeptide, was used to raise polyclonal anti-Int280-H6 serum. To find conditions that will enable efficient and reproducible immunodetection of intimin in whole bacterial cell extracts, we conducted a systematic investigation of the levels of intimin expression in cultured ICC64 bacteria. We found, in agreement with previous reports (19, 30), that intimin expression is induced when EPEC is grown to the mid-log growth phase in DMEM at 37°C. In contrast, intimin was undetectable when the DMEM cultures were incubated at 28°C (data not shown). When the rabbit polyclonal antiserum was reacted with Western blots of whole bacterial cell extracts after overnight bacterial cultures had been diluted in DMEM and grown at 37°C for approximately 3 h, until the mid-log growth phase was reached, only some of the selected EPEC strains reacted strongly with the antiserum while other strains (including CVD206, an intimin-deficient derivative of E2348/69 [O127:H6]) showed no or weak reactivity (Table 1). This lack of reactivity could reflect either interbacterial differences in expression levels or antigenic variation within the intimin cell-binding domain expressed by the different EPEC strains.

Preparation of anti-Int280-H2 sera: reactivity of anti-Int280-H6 and anti-Int280-H2 sera with intimin. To investigate the possible existence of antigenic variation within the intimin family of polypeptides, His-Int280-H2 was constructed from a representative of EPEC clone 2 (ICC61) and used to raise anti-Int280-H2 serum in rabbits. Forty-one typical EPEC strains belonging to eight serogroups, together with 2 serotype O55:H7 and 7 EHEC strains from widely separated geographical sources (North and South America, Europe, and Asia), were analyzed by using the anti-Int280-H6 and anti-Int280-H2 sera. Only some of the EPEC strains (belonging to serotypes O55:H6, O127:H6, O142:H6, and O142:H34), as well as H. alvei, reacted strongly with anti-Int280-H6 serum, while the other strains (belonging to EPEC serotypes O55:H-, O55:H7 O86:H34, O111:H2, O111:H-, O114:H2, O119:H2, O119:H6, O127:H40, and O128:H2 and EHEC serotypes O26:H-, O26:H11, and O157:H7, as well as C. rodentium and E. coli RDEC-1) showed weak or no reactivity (Fig. 1A and Table 1). In contrast, the anti-Int280-H2 serum reacted strongly with the strains belonging to EPEC serotypes O111:H2, O111:H-, O114:H2, O119:H2, O119:H6, and O128:H2, EHEC serotypes O26:H11 and O26:H-, C. rodentium, and E. coli RDEC-1. A weak reaction or no reaction was observed with strains belonging to EPEC serotypes O55:H-, O55:H6, O55:H7, O86:H34, O127:H6, O127:H40, O142:H6, and O142:H34 and to EHEC serotype O157:H7 (Fig. 1B and Table 1). Figure 1 shows immunoblotting of 14 representatives of these strains (summary in Table 1). No reactivity was observed when the strains were probed with normal rabbit serum (data not shown). These findings show antigenic variation within the cell-binding domain and indicate that by using these sera, intimin can be divided antigenically into at least three serogroups (Table 1). These were designated intimin alpha , recognized strongly by anti-Int280-H6 serum; intimin beta , recognized strongly by anti-Int280-H2 serum; and nontypeable (NT), recognized poorly by either antiserum (Table 1).


View larger version (45K):
[in this window]
[in a new window]
 
FIG. 1.   Immunoblotting analysis of polyclonal antisera against various EPEC strains. Each sample (optical density, 0.05) was loaded onto an SDS-7.5% PAGE gel, and the bacterial cell extracts were reacted with anti-Int280-H6 (A) or anti-Int280-H2 (B) serum. Molecular size markers (in kilodaltons) are shown in lane 1. Strain E2348/69 of serotype O127:H6 (lane 2) and strains of serotypes O142:H34 (lane 7), O55:H6 (lane 9), and O142:H6 (lane 13) reacted strongly with the anti-Int280-H6 serum, while strains of serotypes O111:H- (lane 4), O114:H2 (lane 5), O119:H6 (lane 6), O111:H2 (lane 8), O119:H2 (lane 11), and O128:H2 (lane 15) reacted strongly with the anti-In280-H2 serum. Weak or no reactivity was observed with both antisera with strains CVD206 (lane 3) and strains of serotypes O55:H- (lane 10), O86:H34 (lane 12), and O127:H40 (lane 14).

By using an ELISA with purified MBP-Int280 fusion proteins from different EPEC strains as coating antigens, the degree of cross-reactivity of the antisera was quantified. Anti-intimin alpha  serum was 100-fold more reactive with MBP-Int280 O127:H6 (ICC64) than with MBP-Int280 O114:H2 and O111:H- (ICC61 and B171, respectively). The anti-intimin beta  serum was 10-fold more reactive with MBP-Int280 (ICC61 and B171) than with MBP-Int280 (ICC64). No reactivity with MBP was observed. Comparison of the ELISA titers of the antisera obtained by using His-tagged and MBP fusions showed that the presence of MBP had no effect (data not shown). Reaction of the different MBP-Int280 fusion proteins with the polyclonal antisera on Western blots confirmed the results obtained with whole-cell lysates (data not shown). These results further suggest that there are major antigenic differences between intimins alpha  and beta .

Immunogold and immunofluorescent labelling of whole bacterial EPEC and EHEC cells. The existence of antigenic variation in different intimins expressed on the bacterial cell surface was confirmed directly by immunogold and immunofluorescence. Both immunogold labelling (Fig. 2a to c) and immunofluorescence labelling of EPEC using anti-intimin alpha  and anti-intimin beta  sera confirmed surface intimin expression in logarithmic-phase DMEM-grown cultures of strains belonging to EPEC clones 1 (Fig. 2a) and 2 (Fig. 2b) and revealed a uniform distribution of intimin over the bacterial surface; other EPEC strains did not react with either antiserum (Fig. 2c). Strains belonging to serogroups O55:H6, O127:H6, O142:H6, and O142:H34 stained strongly with anti-intimin alpha  serum, while strains belonging to serogroups O55:H-, O86:H34, O111:H-, O111:H2, O114:H2, O119:H2, O119:H6, and O127:H40 showed weak or no staining (Fig. 2a and e and Table 1). In contrast, EPEC strains belonging to serotypes O111:H-, O111:H2, O114:H2, O119:H2, and O119:H6 stained strongly with anti-intimin beta  serum, and weak or no staining was seen with strains of serotypes O55:H6, O127:H6, O142:H6, and O142:H34 (Fig. 2b and f and Table 1). Weak or no staining with either anti-intimin alpha  or beta  serum was observed with strains of serotypes O55:H-, O86:H34, and O127:H40 (Fig. 2c and g and Table 1), although complementary fluorescence actin staining and phase-contrast microscopy confirmed that the cells were covered with A/E bacteria (data not shown).


View larger version (158K):
[in this window]
[in a new window]
 
FIG. 2.   Immunogold labelling of logarithmic-phase, DMEM-grown cultures of EPEC (a to c) and EHEC (d) and immunofluorescence labelling of HEp-2 cell-adherent EPEC (e to g) and EHEC (h to l) strains showing a serotype O127:H6 EPEC strain expressing intimin alpha  (a and e), a serotype O114:H2 EPEC strain expressing intimin beta  (b and f), a serotype O86:H34 EPEC strain that expresses neither intimin alpha  nor beta  (c and g), a serotype O157:H7 EHEC strain expressing neither intimin alpha  nor beta  (d and h), a serotype O26:H- EPEC strain expressing intimin beta  (i), and a serotype O26:H11 EHEC strain expressing intimin beta  (j) but not intimin alpha  (k). Although not stained with anti-intimin alpha  serum, the phase-contrast micrograph of field k shows cell-adherent bacteria (l). Original magnifications: a to d, ×30,000; e to l, ×5,500.

Cross-reactivity with intimin from EHEC was also examined. Neither anti-intimin alpha  nor anti-intimin beta  serum stained DMEM-grown (Fig. 2d) or cell-adherent O157:H7 EHEC (Fig. 2h) strains, whereas anti-intimin beta , but not anti-intimin alpha , serum stained DMEM-grown and cell-adherent O26:H11 EHEC (Fig. 2j to l) and related O26:H- (Fig. 2i and Table 1) strains.

Identification of intimin derivatives by PCR. The amino acid sequence of the C-terminal domain of intimin from EPEC ICC61 (O114:H2) and ICC95 (O86:H34) was deduced from the DNA sequence of the cloned domains. Alignment of Int280 from ICC61 (excluding the primer-derived sequence) with the published intimin sequences revealed 50% identity with that of E2348/69 (23); 79.8% identity with Int280 from C. rodentium (42); 46.7% identity with that of O157:H7 (49); 100% identity with those of RDEC-1 (1), O26:H11 (GenBank accession no. U62656), and O26:B6 (Genbank accession no. U62657); 99.6% identity with O111:H- (Genbank accession no. U62655); and 47% identity with that of H. alvei (15). Comparison of Int280 from ICC95 with those of E2348/69 and O157:H7 revealed 49.6 and 46.7% identity, respectively, and 47 and 77.6% identity, respectively, with those of H. alvei and C. rodentium, while 75% identity with those of E. coli RDEC-1 and serotypes O114:H2, O111:H-, O26:H11, and O26:B6 was revealed.

Alignment of the amino acid sequences of intimins alpha  and beta  revealed several regions of low similarity. On the basis of one such region, we synthesized forward DNA primers corresponding to intimins alpha  (Int-alpha ) and beta  (Int-beta ) (Table 3) and tested their ability to distinguish between the two intimin types by PCR. Initially, the Int-R reverse primer, made according to DNA sequences adjacent to the 3' end of the eae gene, was used (Table 3). One hundred four classical EPEC and 27 EHEC-like (7 O26:H11, 4 O26:H-, 6 O157:H7, and 10 O55:H7) isolates were tested. The results of the DNA analysis, summarized in Table 2, show that all of the strains belonging to the serotypes recognized by anti-intimin alpha  serum produced a specific PCR product with the Int-alpha forward primer while all but one of the strains belonging to the serotypes reacted with anti-intimin beta  serum produced a specific PCR product with the Int-beta primer. Representative strains analyzed with the Int-alpha and Int-beta primers are shown in Fig. 3. Serotypes that were poorly recognized by both antisera produced no PCR product with either the Int-alpha or the Int-beta primer. On the basis of the DNA sequence encoding the cell-binding domains of intimin from EHEC O157:H7 (49) and O86:H34 (this study), primers were designed and designated Int-gamma and Int-delta , respectively (Table 3). Since primer Int-R would not allow DNA amplification of some NT strain eae genes, a new reverse primer (Int-Ru) was synthesized according to the absolutely conserved and universal intimin amino acid sequence WAAGANKY (Table 3). Testing of representatives strains with the Int-alpha and Int-beta forward primers together with the Int-Ru reverse primer generated results consistent with those obtained with the Int-R primer. Testing of strains classified as NT in immunodetection assays by PCR with the Int-gamma and Int-delta forward primers together with the Int-Ru reverse primer revealed that all but one of the tested O55:H-, O55:H7, and O157:H7 strains produced a specific PCR product with the Int-gamma primer, while the O86:H34 strains produced a specific PCR product with the Int-delta primer. EPEC and EHEC strains expressing intimin alpha  or beta  did not produce a PCR product with either the Int-gamma or the Int-delta primer. EPEC isolates belonging to the O127:H40 serotype produced no PCR product with any of the four forward primers and hence were designated NT. Thus, by using a combination of antisera and PCR, it was possible to distinguish among five different intimin subtypes.


View larger version (83K):
[in this window]
[in a new window]
 
FIG. 3.   Detection of intimins alpha  and beta  by PCR. Representative strains are shown. PCR products obtained with primer Int-alpha were obtained from E2348/69 (A, lane 2) and from all of the serotype O55:H6 strains tested (A, lanes 4-9) but with none of the serotype O111:H2 strains (B, lanes 2 to 9) or strain CVD206 (A, lane 3). All of the serotype O119:H2 (C, lanes 2 and 4 to 7) and O119:H6 (D, lanes 2 to 7) strains tested, but not E2348/69 (C, lane 3), produced a positive PCR product with the Int-beta primer. Molecular size markers (1-kb ladder; Bethesda Research Laboratories) were loaded in lanes 1. The complete DNA analysis is presented in Table 2.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

In the present study, we used the cell-binding domain of intimin from two EPEC strains, representatives of EPEC clones 1 and 2, to raise polyclonal anti-intimin sera. Reaction of the anti-intimin sera with whole EPEC cell extracts (41 different strains belonging to eight serogroups) revealed antigenic variation within this domain, which seems to be in accordance with the reported diversity in the linear amino acid sequences. Nevertheless, on the basis of the Western blots, the tested EPEC strains could be divided into three groups. The first group consisted of strains which reacted strongly with anti-intimin alpha  serum. Importantly, all of these strains which belong to EPEC clone 1 (serotypes O55:H6, O127:H6, O142:H6, and O142:H34) were also positive in a PCR using the Int-alpha primer. The second group included strains that reacted strongly with anti-intimin beta  serum. These strains (serotypes O111:H2, O111:H-, O114:H2, O119:H2, O119:H6, and O128:H2), with the exception of that belonging to serotype O119:H6 (20) all belong to EPEC clone 2 (39, 46) and produced a positive PCR product when the Int-beta primer was used. Seventeen serotype O119:H6 strains were analyzed by PCR, and all gave consistent results. The third group of strains (serotypes O55:H-, O86:H34, and O127:H40) was recognized poorly by both antisera and produced a PCR product with neither primer Int-alpha nor Int-beta . However, this group of strains, designated NT by immunological criteria, could be further classified genetically by using primers designed on the basis of the eae sequences from strains of serotypes O157:H7 (Int-gamma ) and O86:H34 (Int-delta ). It is necessary to raise antiserum to Int280 from a representative of the NT group of strains to complete the immunological classification. By using immunological and genetic bioassays, we obtained consistent results with all (but two) of the strains belonging to a specific serotype. In addition, the classification of intimin according to diversity within the cell-binding domain, with the exception of O119:H6 and O86:H34 (which, although they belong to EPEC clone 1, comprise a different clonal phylogeny [46]), seems to follow the clonal lineages. Significantly, cross-reactivity with anti-intimin beta serum was observed with C. rodentium and E. coli RDEC-1, which also produced PCR products with the Int-beta primer, while H. alvei cross-reacted with anti-intimin alpha  serum.

EHEC strains capable of forming A/E lesions and lacking the EAF plasmid are also divided into two divergent clonal groups (46, 47). EHEC clone 1 includes the serotype O157:H7 clone, while EHEC clone 2 is composed of Shiga-like toxin-producing serotype O26:H11 and O111:H8 strains. Recently, it was shown that serotype O55:H7, an atypical EPEC clone, is closely related to EHEC clone 1 (46, 47). Reacting the anti-intimin sera with representatives of the two EHEC clones revealed that while strains related to EHEC clone 1 were recognized by neither antiserum, strong cross-reactivity was observed with anti-intimin beta  serum and strains of EHEC clone 2. Similar results were obtained by PCR: while the serotype O26:H11 strains produced PCR products with the Int-beta primer, strains belonging to serotypes O55:H7 and O157:H7 produced specific PCR products with the Int-gamma primer. Significantly, like O55:H7, the typical EPEC serotype O55:H- was classified by using PCR together with EHEC O157:H7. By using immunogold and immunofluorescent labelling, we have directly demonstrated the existence of antigenic variation in the epitopes of different intimins expressed on the bacterial cell surface of EPEC and EHEC.

Previously published data from Agin and Wolf (2) and Jerse and Kaper (24) have been brought together to provide proof of the existence of at least three immunologically distinct groups of intimins, i.e., those similar to intimins from RDEC-1, EPEC E2348/69 (O127:H6), and EHEC (O157:H7). This cross-reactivity did not appear to be serogroup specific. In contrast, our study provides comprehensive evidence, obtained with immune sera, PCR, and a large number of clinical isolates of EPEC and EHEC, of the existence of at least five intimin subtypes which segregated in a serogroup-serotype fashion. An important feature of the antiserum used by Jerse and Kaper is the fact that it was raised by using an alkaline phosphatase-intimin fusion, containing the whole conserved N-terminal region of intimin, as the immunogen. This difference may explain, in part, the differences between the findings of Agin and Wolf and those presented here. In addition, by using immunological and genetic bioassays, we showed that both E. coli RDEC-1 and C. rodentium express intimin beta . The reason for the lack of cross-reactivity between these two intimins reported by Agin and Wolf is not clear.

An investigation of pathogen-specific factor that protect children from Brazil against diarrheal disease revealed that breastfeeding is protective against EPEC infection. Analysis of colostrum IgA showed that the antibodies reacted strongly with a 94-kDa protein and could prevent the adherence of EPEC to cells in culture (9). Recently, we assayed murine mucosal IgA responses to intimin in the C. rodentium model and found that in all of the immunologically naive mice that survived the initial infection, mucosal IgA antibodies to intimin were detected 28 days postchallenge, while no such responses were seen in any of the mice infected with the eae mutant of C. rodentium (17). Since intimin is highly immunogenic, it is possible that the diversity within the polypeptide cell-binding domain is driven by natural selection. However, it is important to note that despite the high diversity in this region, two stretches of six and seven amino acids (WLQYGQ and WAAGANKY) are identical in all intimins but are not found in any other sequences in the databases. It is possible, although not yet proven, that these amino acids form part of the binding site. According to the level of the immunological cross-reaction between intimins alpha  and beta , these conserved amino acid sequences do not seem to be highly immunogenic. However, only our current investigation, aimed at mapping the immunodominant epitopes within Int280, will confirm this experimentally. The high immunogenicity of intimin in infected hosts provides a rational basis to support the concept of engineering an intimin molecule as a basis for an EPEC vaccine.

In conclusion, in the present study, we used immunological and genetic approaches to study antigenic variation and classify the cell-binding domain of intimin expressed by A/E lesion-forming pathogens. Our results revealed the presence of at least five intimin subtypes: alpha , beta , gamma , delta , and an untypeable intimin expressed by EPEC of serotype O127:H40.

    ACKNOWLEDGMENTS

We are grateful to Jim Kaper (Center for Vaccine Development, University of Maryland, UMBA) for providing the E2348/69 and CVD206 strains used in this study, Alan Phillips (University Department of Paediatric Gastroenterology, Royal Free Hospital, London, United Kingdom) and Felipe Schelotto (Cátedra de Inmunologia, Facultas de Quimica, Uruguay) for bacterial strains, and to Mark Pallen for sequence analysis advice and assistance.

Trips by G. Frankel to Brazil were supported by FAPESP. J. Adu-Bobie is a Ph.D. student supported by the BBSRC, the WHO, and Murex Diagnostics. This study was supported by FAPESP (grant 92/4890-2), a PADCT grant (620236/92-2 PADCT/CNPq), and the Wellcome Trust.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Biochemistry, Imperial College of Science, Technology and Medicine, Exhibition Rd., London SW7 2AZ, United Kingdom. Phone: 44-71-594-5253. Fax: 44-71-594-5255. E-mail: g.frankel{at}ic.ac.uk.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Agin, T. S., J. R. Cantey, E. C. Boedeker, and M. K. Wolf. 1996. Characterisation of the eae gene from rabbit enteropathogenic Escherichia coli strain RDEC-1 and comparison to other eae genes from bacteria that cause attaching and effacing lesions. FEMS Microbiol. Lett. 144:249-258[Medline].
2. Agin, T. S., and M. K. Wolf. 1997. Identification of a family of intimins common to Escherichia coli causing attaching-effacing lesions in rabbits, humans, and swine. Infect. Immun. 65:320-326[Abstract].
3. Albert, M. J., S. M. Faruque, M. Ansaruzzaman, M. M. Islam, K. Haider, K. Alam, I. Kabir, and R. Robins-Browne. 1992. Sharing of virulence-associated properties at the phenotypic and genetic levels between enteropathogenic Escherichia coli and Hafnia alvei. J. Med. Microbiol. 37:310-314[Abstract].
4. Barthold, S. W., G. L. Coleman, P. N. Bhatt, G. W. Osbaldiston, and A. M. Jones. 1976. The etiology of transmissible murine colonic hyperplasia. Lab. Anim. Sci. 26:889-894[Medline].
5. Beebakhee, G., M. Louie, J. De Azavedo, and J. Brunton. 1992. Cloning and nucleotide sequence of the eae gene homologue from enterohemorrhagic Escherichia coli serotype O157:H7. FEMS Microbiol. Lett. 70:63-68[Medline].
6. Burnette, W. N. 1981. Western blotting: electrophoretic transfer of proteins from sodium dodecyl sulphate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 112:195-203[Medline].
7. Camara, L. M., S. B. Carbonare, M. L. Silva, and M. Carneiro-Sampaio. 1994. Inhibition of enteropathogenic Escherichia coli (EPEC) adhesion to HeLa cells by human colostrum: detection of specific sIgA related to EPEC outer membrane proteins. Int. Arch. Allerg. Immunol. (Paris) 103:307-310.
8. Cantey, J. R., and R. K. Blake. 1977. Diarrhea due to Escherichia coli in the rabbit, a novel mechanism. J. Infect. Dis. 135:454-462[Medline].
9. Carneiro-Sampaio, M. M. S., M. L. M. da Silva, S. B. Carbonare, P. Palmeira, M. T. Delneri, A. C. Honorio, and L. R. Trabulsi. 1996. Breast-feeding protection against enteropathogenic Escherichia coli. Rev. Microbiol. Sao Paulo 27(Suppl. 1):120-125.
10. Donnenberg, M. S., and J. B. Kaper. 1991. Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect. Immun. 59:4310-4317[Abstract/Free Full Text].
11. Donnenberg, M. S., J. A. Giron, J. P. Nataro, and J. B. Kaper. 1992. A plasmid-encoded type IV fimbrial gene of enteropathogenic Escherichia coli associated with localized adherence. Mol. Microbiol. 6:3427-3437[Medline].
12. Donnenberg, M. S., J. Yu, and J. B. Kaper. 1993. A second chromosomal gene necessary for intimate attachment of enteropathogenic Escherichia coli to epithelial cells. J. Bacteriol. 175:4670-4680[Abstract/Free Full Text].
13. Donnenberg, M. S., C. O. Tacket, S. P. James, G. Losonsky, J. P. Nataro, S. S. Wasserman, J. B. Kaper, and M. M. Levine. 1993. Role of the eae gene in experimental enteropathogenic Escherichia coli infection. J. Clin. Invest. 92:1412-1417.
14. Donnenberg, M. S., S. Tzipori, M. L. McKee, A. D. O'Brien, J. Alroy, and J. B. Kaper. 1993. The role of the eae gene of enterohemorrhagic Escherichia coli in intimate attachment in vitro and in a porcine model. J. Clin. Invest. 92:1418-1424.
15. Frankel, G., D. C. A. Candy, P. Everest, and G. Dougan. 1994. Characterization of the C-terminal domains of intimin-like proteins of enteropathogenic and enterohemorrhagic Escherichia coli, Citrobacter freundii, and Hafnia alvei. Infect. Immun. 62:1835-1842[Abstract/Free Full Text].
16. Frankel, G., D. C. A. Candy, E. Fabiani, J. Adu-Bobie, S. Gil, M. Novakova, A. D. Phillips, and G. Dougan. 1995. Molecular characterization of a carboxy-terminal eukaryotic-cell-binding domain of intimin from enteropathogenic Escherichia coli. Infect. Immun. 63:4323-4328[Abstract].
17. Frankel, G., A. D. Phillips, M. Novakova, D. C. A. Candy, D. B. Schauer, D. B., G. Douce, and G. Dougan. 1996. Intimin from enteropathogenic Escherichia coli restores murine virulence to a Citrobacter rodentium eae mutant: induction of an immunoglobulin A response to intimin and EspB. Infect. Immun. 64:5315-5325[Abstract].
18. Giron, J. A., A. S. Ho, and G. K. Schoolnik. 1991. An inducible bundle-forming pilus of enteropathogenic Escherichia coli. Science 254:710-713[Abstract/Free Full Text].
19. Gómez-Duarte, O. G., and J. B. Kaper. 1995. A plasmid-encoded regulatory region activates chromosomal eaeA expression in enteropathogenic Escherichia coli. Infect. Immun. 63:1767-1776[Abstract].
20. Goncalves, A. G., L. C. Campos, T. A. T. Gomes, J. Rodrigues, V. Sperandio, T. S. Whittam, and L. R. Trabulsi. 1997. Virulence properties and clonal structure of strains of Escherichia coli O119 serotypes. Infect. Immun. 65:2034-2040[Abstract].
21. Hills, S. M., A. D. Phillips, and J. A. Walker-Smith. 1991. Enteropathogenic Escherichia coli and life threatening chronic diarrhoea. Gut 32:154-158[Abstract/Free Full Text].
22. Jarvis, K. G., J. A. Giron, A. E. Jerse, T. K. McDaniel, M. S. Donnenberg, and J. B. Kaper. 1995. Enteropathogenic Escherichia coli contains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation. Proc. Natl. Acad. Sci. USA 92:7996-8000[Abstract/Free Full Text].
23. Jerse, A. E., J. Yu, B. D. Tall, and J. B. Kaper. 1990. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc. Natl. Acad. Sci. USA 87:7839-7843[Abstract/Free Full Text].
24. Jerse, A. E., and J. B. Kaper. 1991. The eae gene of enteropathogenic Escherichia coli encodes a 94-kilodalton membrane protein, the expression of which is influenced by the EAF plasmid. Infect. Immun. 59:4302-4309[Abstract/Free Full Text].
25. Kaper, J. B. 1996. Defining EPEC. Rev. Microbiol. Sao Paulo 27(Supp. 1):130-133.
26. Kaper, J. B., T. K. McDaniel, and K. G. Jarvis. 1996. Molecular genetics of enteropathogenic Escherichia coli. Rev. Microbiol. Sao Paulo 27(Supp. 1):82-88.
27. Kenny, B., L. C. Lai, B. B. Finlay, and M. S. Donnenberg. 1996. EspA, a protein secreted by enteropathogenic Escherichia coli (EPEC), is required to induce signals in epithelial cells. Mol. Microbiol. 20:313-323[Medline].
28. Knutton, S., D. R. Lloyd, and A. S. McNeish. 1987. Adhesion of enteropathogenic Escherichia coli to human intestinal enterocytes and cultured human intestinal mucosa. Infect. Immun. 55:69-77[Abstract/Free Full Text].
29. Knutton, S., T. Baldwin, P. H. Williams, and A. S. McNeish. 1989. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect. Immun. 57:1290-1298[Abstract/Free Full Text].
30. Knutton, S., J. Adu-Bobie, C. Bain, A. D. Phillips, G. Dougan, and G. Frankel. 1997. Down regulation of intimin expression during attaching and effacing enteropathogenic Escherichia coli adhesion. Infect. Immun. 65:1644-1652[Abstract].
31. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685[Medline].
32. Lai, L. C., L. A. Wainwright, K. D. Stone, and M. S. Donnenberg. 1997. A third secreted protein that is encoded by the enteropathogenic Escherichia coli pathogenicity island is required for transduction of signals and for attaching and effacing activities in host cells. Infect. Immun. 65:2211-2217[Abstract].
33. Levine, M. M. 1987. Escherichia coli that cause diarrhea: enterotoxigenic, enteropathogenic, enteroinvasive, enterohemorrhagic, and enteroadherent. J. Infect. Dis. 155:377-389[Medline].
34. Levine, M. M., E. J. Berquist, D. R. Nalin, D. H. Waterman, R. B. Hornick, C. R. Young, S. Stoman, and B. Rowe. 1978. Escherichia coli that cause diarrhoea but do not produce heat-labile or heat-stable enterotoxins and are non-invasive. Lancet i:119-122.
35. McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper. 1995. A genetic locus of enterocyte effacement conserved among diverse enterobacterial pathogens. Proc. Natl. Acad. Sci. USA 92:1664-1668[Abstract/Free Full Text].
36. Moon, H. W., S. C. Whipp, R. A. Argenzio, M. M. Levine, and R. A. Giannella. 1983. Attaching and effacing activities of rabbit and human enteropathogenic Escherichia coli in pig and rabbit intestines. Infect. Immun. 41:1340-1351[Abstract/Free Full Text].
37. Mullis, K. B., and R. A. Faloona. 1987. Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction. Methods Enzymol. 155:335-350[Medline].
38. Nataro, J. P., I. C. Scaletsky, J. B. Kaper, M. M. Levine, and L. R. Trabulsi. 1985. Plasmid-mediated factors conferring diffuse and localized adherence of enteropathogenic Escherichia coli. Infect. Immun. 48:378-383[Abstract/Free Full Text].
39. Orskov, F., T. S. Whittam, A. Cravioto, and I. Orskov. 1990. Clonal relationships among classic enteropathogenic Escherichia coli (EPEC) belong to different O groups. J. Infect. Dis. 162:76-81[Medline].
40. Riley, L. W., R. S. Remis, S. D. Helgerson, H. B. McGee, J. G. Weels, B. R. Davis, R. J. Herbert, E. S. Olcott, L. M. Johnson, N. T. Hargett, P. A. Blake, and M. L. Cohen. 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med. 308:681-685[Abstract].
41. Scaletsky, I. C., M. L. de Silva, and L. R. Trabulsi. 1984. Distinctive patterns of adherence of enteropathogenic Escherichia coli to HeLa cells. Infect. Immun. 45:534-536[Abstract/Free Full Text].
42. Schauer, D. B., and S. Falkow. 1993. Attaching and effacing locus of a Citrobacter freundii biotype 4280 that causes transmissible murine colonic hyperplasia. Infect. Immun. 61:2486-2492[Abstract/Free Full Text].
43. Sherman, P., R. Soni, and M. Karmali. 1988. Attaching and effacing adherence of Vero cytotoxin-producing Escherichia coli O157:H7 to rabbit intestinal epithelium in vivo. Infect. Immun. 56:756-761[Abstract/Free Full Text].
44. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354[Abstract/Free Full Text].
45. Ulsen, M. H., and J. L. Rollo. 1980. Pathogenesis of Escherichia coli gastroenteritis in man: another mechanism. N. Engl. J. Med. 302:99-101[Medline].
46. Whittam, T. S., and E. A. McGraw. 1996. Clonal analysis of EPEC serogroups. Rev. Microbiol. Sao Paulo 27(Supp. 1):7-16.
47. Whittam, T. S., M. L. Wolfe, I. K. Wachsmuth, F. Orskov, I. Orskov, and R. A. Wilson. 1993. Clonal relationships among Escherichia coli strains that cause hemorrhagic colitis and infantile diarrhea. Infect. Immun. 61:1619-1629[Abstract/Free Full Text].
48. World Health Organization. 1987. Programme for control of diarrhoeal diseases, p. 48. In Manual for laboratory investigations of acute enteric infections. World Health Organization, Geneva, Switzerland.
49. Yu, J., and J. B. Kaper. 1992. Cloning and characterization of the eae gene of enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 6:411-417[Medline].


Journal of Clinical Microbiology, March 1998, p. 662-668, Vol. 36, No. 3
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles: