INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

Enteropathogenic Escherichia coli (EPEC) is a major cause of acute and persistent infantile diarrhea in developing parts of the world (33). Traditionally, EPEC strains are considered to belong to 12 different O serogroups: O26, O55, O86, O111, O114, O119, O125, O126, O127, O128, O142, and O158 (48). Population genetic surveys, using multilocus enzyme electrophoresis, have shown that the classical EPEC strains have diverged into two major groups of related clones, designated EPEC clones 1 and 2 (39, 47). Within each group, a variety of O antigens are present while the somatic flagellar (H) antigens are conserved. Strains belonging to EPEC clone 1 typically express H6 and H34, whereas EPEC clone 2 strains express H2 (39, 46).

Small-bowel biopsies of children infected with EPEC reveal discrete colonies of bacteria attached to the mucosa (45). Binding of EPEC to the brush border triggers a cascade of transmembrane and intracellular signals leading to cytoskeletal reorganization and formation of a specific lesion, termed the attachment-and-effacement (A/E) lesion (36). This lesion is characterized by destruction of brush border microvilli and intimate adherence of bacteria to cup-like pedestals formed by the bare enterocyte cell membrane (28). High concentrations of polymerized actin are present in the enterocyte beneath the site of bacterial attachment (29). Infection of cultured epithelial cells by EPEC not only induces A/E lesions morphologically similar to those seen in biopsies but also produces a characteristic pattern of adherence, termed localized adherence (LA) (41). A/E lesions are also induced by other enterobacteria, including enterohemorrhagic E. coli (EHEC), the causative agent of bloody and nonbloody diarrhea, as well as of hemolytic-uremic syndrome, in humans (40, 43); Hafnia alvei, which has been isolated from children with diarrhea (3); Citrobacter rodentium, the causative agent of transmissible colonic hyperplasia in laboratory mice (4, 42); and rabbit-specific EPEC strains; including rabbit diarrheagenic E. coli RDEC-1, which cause diarrhea in rabbits (8).

Experiments with cultured epithelial cells have implicated several genes in LA and A/E lesion formation by EPEC. These genes map predominantly to two sites. The first is a 35-kbp pathogenicity island termed the locus of enterocyte effacement or the LEE region (26, 35). This locus, found in all A/E lesion-forming bacteria (35), encodes a type III secretion system (22), a series of secreted proteins (EPEC-secreted proteins or Esps) (12, 27, 32), and intimin, the product of the eae gene (23, 24) that mediates intimate bacterial adhesion to epithelial cells and is required for full virulence in volunteers (13, 14). The second is the ca. 90-kbp EPEC-adherence factor (EAF) plasmid common to all typical EPEC strains (25, 38). The EAF plasmid encodes the bundle-forming pilus (Bfp) protein, which plays a role in LA, facilitates the formation of the A/E lesion (11, 18), and contains a regulatory locus (the per locus) (19) that appears to control and coordinate the expression of several EPEC virulence factors, including intimin (19, 30).

The eae genes of several EPEC and EHEC strains, RDEC-1, and C. rodentium and the 3' end of eae of H. alvei have been cloned and sequenced (1, 5, 15, 23, 42, 49). Comparison of the amino acid sequences of the different intimins has revealed that the N-terminal regions are highly conserved, while the C termini show much less similarity. Nevertheless, two Cys residues at the C termini are conserved among all of the intimin family members. Recently, we expressed the 280-amino-acid C-terminal domain of intimin (Int280) and derivatives of this domain containing N- and C-terminal deletions as maltose-binding protein (MBP) fusions and tested their cell-binding properties (15, 16). Cell-binding activity was observed only with the MBP-Int280 and MBP-Int150 fusions, localizing a cell-binding function of intimin to the C-terminal 150 amino acids (16). Cell-binding activity was abolished when Cys937 was replaced with Ser (16).

Preliminary evidence from volunteer and epidemiological studies suggests that anti-intimin antibodies might play a key role in protection against EPEC infection (7). In this report, we describe the production and characterization of polyclonal antisera raised against Int280, expressed as a His-tagged polypeptide, from EPEC clone 1 and 2 strains of serotypes O127:H6 (ant-Int280-H6) and O114:H2 (ant-Int280-H2), respectively. We found that antigenic variation exists within the cell-binding domain of intimins expressed by different clinical EPEC and EHEC isolates. By using PCR primers designed on the basis of the eae sequences of EPEC strains of serotypes O127:H6, O114:H2, and O86:H34 and EHEC of serotype O157:H7, we classified the intimin family into at least five distinct subtypes.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Bacterial strains. The bacterial strains used in this study included clinical EPEC strains of serotypes O127:H6 (E2348/69 [34] and ICC64 [15]), O114:H2 (ICC61) (21), O111:H (B171) (18), and O86:H34 (ICC95) (this study); an eae serotype O127:H6 mutant (CVD206) (10); and strains of the serotypes listed in Tables 1 and 2. Bacterial strains were grown in L broth or L agar. The medium used was supplemented with 100-µg/ml ampicillin or 30-µg/ml kanamycin when appropriate. For immunodetection of intimin in whole-cell extracts, stationary-phase L-broth cultures were diluted 1:100 in Dulbecco's modified Eagle's medium containing 2 mM L-glutamine (DMEM) and incubated at 28 or 37°C.

Preparation of MBP-Int fusion proteins. MBP-Int280 fusion protein from EPEC ICC64 (Int280-H6) was purified as previously described (15). MBP-Int280 fusions from EPEC strains ICC61 (Int280-H2) and B171 were constructed and purified as described for the other MBP-Int280 fusion protein (15).

Preparation of His-Int280-H6 and His-Int280-H2. To express Int280 from ICC64 and ICC61 separately from MBP, the DNA fragments encoding this domain within pMAL-c2 were gel purified with the Prep-A-Gene DNA purification system (Bio-Rad) after EcoRI/HindIII endounuclease digestion. The fragments were then subcloned into a similarly digested pET-28a vector (Novagen Biotechnology), and the recombinant plasmids were transformed into E. coli BL21. The His-Int280 polypeptides were purified as suggested by the manufacturer. Briefly, 1 ml of an overnight culture of BL21 containing the recombinant pET28a plasmid was inoculated into 100 ml of L broth supplemented with 0.2% glucose and 30-µg/ml kanamycin. The culture was incubated for 2 h at 37°C with shaking, and expression of His-Int280 was induced by addition of 24 mg of isopropyl--D-thiogalactopyranoside (IPTG). After an additional 4 h of incubation at 30°C, the cells were harvested by centrifugation, the supernatant was discarded, and the pellet was resuspended in 8 ml of binding buffer (5 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9) and frozen overnight. The culture was then sonicated at maximum intensity in 10-s bursts for a total of 3 min with 1-min intervals. The lysate was centrifuged at 3,200 × g for 30 min, and the supernatant was loaded onto a prewashed nickel column with a 2.5-ml bed volume. After loading of the cell extract the column was washed with 25 ml of binding buffer and 7.5 ml each of wash buffers 1 (30 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9), and 2 (60 mM imidazole, 0.5 M NaCl, 20 mM Tris-HCl, pH 7.9). The bound protein was eluted with 15 ml of elute buffer (500 mM imidazole). The fractions were analyzed by electrophoresis on a 10% polyacrylamide gel (see below).

Preparation of polyclonal sera. Female Sandy half-lop rabbits were immunized subcutaneously with 50 to 100 µg of His-Int280-H6 (made from ICC64) or His-Int280-H2 (made from ICC61) in complete Freund's adjuvant. The animals were boosted twice with the same antigen in incomplete Freund's adjuvant at 3-week intervals before exsanguination.

PAGE. Polyacrylamide gel electrophoresis (PAGE) in the presence of sodium dodecyl sulfate (SDS) was performed as described by Laemmli (31). Protein samples and bacterial extracts to be separated were diluted in an equal volume of 2× sample buffer (2% [wt/vol] SDS, 2% [vol/vol] 2-mercaptoethanol, 20% [wt/vol] glycerol, and 0.01% [wt/vol] bromophenol blue in 0.0065 M Tris, pH 6.8) and boiled for 5 min prior to loading onto 7.5 to 10% gels. Molecular sizes were estimated by using Rainbow molecular size markers (Amersham). Following electrophoresis, the separated proteins were visualized by staining the gel with Coomassie stain or transferred to nitrocellulose membrane.

Western blotting (immunoblotting). Proteins separated by SDS-PAGE were transferred electrophoretically onto nitrocellulose membranes (Schleicher & Schuell) and immunoblotted as described by Towbin et al. (44) and Burnette (6), at 80 V for 90 min. The membranes were blocked overnight in 3% bovine serum albumin (BSA), washed three times with phosphate-buffered saline (PBS) containing 0.05% Tween 20 (PBST), and then reacted with the antiserum of interest for 2 h. Anti-Int280-H6 and anti-Int280-H2 sera were diluted 1:750 and 1:5,000, respectively, in PBST containing 0.1% BSA. After three washes with PBST, the bound antibodies were reacted with horseradish peroxidase-conjugated swine anti-rabbit serum (1:1,000 dilution; DAKO) and the membranes were developed with hydrogen peroxide and 3'3'-diaminobenzidine (Sigma).

Enzyme-linked immunosorbent assay (ELISA). Briefly, 96-well enzyme immunoassay-radioimmunoassay plates (Costar) were coated overnight at 4°C with 2.5-µg/ml Int280 in PBS at 50 µl/well. The wells were washed three times in PBST and blocked for 1 h at 37°C with PBST-1% BSA. The plates were washed again and then incubated with fivefold serial dilutions of the primary antibody to determine the antiserum titer. Two-hour incubations with primary and secondary antibodies, diluted in PBST-0.1% BSA, were carried out at 37°C with PBST washes after each step. Fifty microliters of substrate (10-mg o-phenylenediamine tablet [Sigma] in 12.125 ml of 0.1 M citric acid-12.875 ml of 0.25 M NaHPO₄-10 µl of 30% H₂O₂) was added to each well. The enzymatic reaction was terminated by addition of 12.5% H₂SO₄. The colorimetric reactions were recorded by using a Ceres 900 HDi (Bio-Tek Instruments, Inc.) microtiter plate reader. The optical density values were plotted for each sample, and the titers were determined as the reciprocal dilution giving an A₄₉₀ of 0.3 above the background. All titrations and experiments were performed in duplicate. A positive reference serum was used on each plate, and the results were adjusted accordingly.

Immunogold labelling of bacterial cells. For immunogold labelling of bacteria, stationary-phase L-broth cultures of representative strains were diluted 1:100 in DMEM and grown at 37°C for 4 h. Samples (10 µl) of washed bacterial suspensions were applied to carbon-coated grids, and after 5 min, excess liquid was removed and the grids were immediately placed face down on drops of anti-Int280-H6 or anti-Int280-H2 serum (diluted 1:40 in PBS containing 0.2% BSA [PBS/BSA]) for 30 min. After thorough washing in PBS/BSA, grids were placed on drops of 10-nm gold-labelled goat anti-rabbit serum (diluted 1:20; British BioCell International) and incubated for 30 min. After further washing with PBS/BSA and distilled water, grids were air dried and viewed under a JEOL 1200EX electron microscope operated at 80 kV.

Immunofluorescent labelling of bacterial cells. Immunofluorescent staining was performed on bacteria adhering to HEp-2 cells following a 3-h incubation of HEp-2 cell monolayers with overnight cultures (30). Formalin-fixed and washed infected-cell monolayers were incubated with anti-Int280-H6 or anti-Int280-H2 serum (diluted 1:40) for 45 min. After three 5-min washes with PBS/BSA, monolayers were stained with fluorescein isothiocyanate-conjugated goat anti-rabbit immunoglobulin G (IgG; Sigma; diluted 1:20) for 45 min. HEp-2 cell preparations were also labelled for cellular actin by simultaneously staining coverslips with a 5-µg/ml solution of tetramethyl rhodamine isocyanate-phalloidin (Sigma) (30). Preparations were washed three times with PBS, mounted in glycerol-PBS, and examined by incident-light fluorescence by using a Leitz Dialux microscope. Fluorescence and phase-contrast images of the same field were recorded.

DNA sequencing of Int280 from ICC61 and ICC95. The DNA sequence of Int280 from ICC61 was determined from the recombinant pET28a construct and from three independent Taq polymerase (Appligene) PCR products cloned into vector pGEM-T (Promega). The DNA sequence of Int280 from ICC95 was determined from a vent polymerase (New England Biolabs) PCR product cloned into pGEM-T. The primers used were pET28 T7 promoter (5' TTAATACGACTCACTATAGG), pET28 T7 terminator (5' CTAGTTATTGCTCAGCGGT), pGEM-T V1 (5' TGTAAAACGAAGGCCAGT), and pGEM-T V2 (5' ATGTTGTGTGAATTGTG). Plasmids were purified from a 4.5-ml overnight culture. After centrifugation, the bacterial pellets were resuspended in 200 µl of 50 mM Tris-HCl (pH 7.5) and a 10 mM EDTA solution containing 100-µg/ml RNase A. A lysis solution (200 µl of 0.2 M NaOH-1% SDS) was added before the mixtures were neutralized with 200 µl of 1.32 M potassium acetate (pH 4.8). Following 5 min of centrifugation, the supernatants were extracted twice with 400 µl of chloroform and the plasmid DNA was precipitated in an equal volume of isopropanol. After washing with 70% ethanol, the DNA pellets were dried under vacuum, dissolved in 32 µl of deionized water, and then reprecipitated by addition of 8 µl of 4 M NaCl and 40 µl of 13% polyethylene glycol 8000. Following 20 min of incubation on ice, the mixtures were centrifuged at 4°C for 15 min and the pellets were rinsed with 70% ethanol, dried under vacuum, and resuspended in 25 µl of deionized water. DNA sequencing was performed by using 0.5 to 1 µg of template DNA and a vector-derived primer with a Perkin Elmer ABI/Prism 377 automated DNA sequencer in accordance with the manufacturer's instructions. On the basis of the emerging DNA sequence, additional (walking) primers were synthesized in the forward and reverse orientations (for sequencing of both DNA strands). Sequence analysis and contig assembly were carried out by using Genejockey II in an Apple Macintosh computer.

PCR. PCR (37) was used to amplify a segment of the eae gene. Thirty amplification cycles of 95°C for 20 s, 45°C for 1 min, and 74°C for 1 min (except for the Int- primer, for which the annealing temperature was 55°C) were employed. A 25-pmol sample of each primer (Table 3) and 1.5 U of Taq DNA polymerase (Appligene, Durham, United Kingdom) were used. For each reaction, about one-third of a colony was transferred to a 0.5-ml tube containing the PCR mixture and primers and the tubes were incubated at 95°C for 5 min prior to the PCR cycling. Ten microliters of each reaction mixture was analyzed by agarose gel electrophoresis.

Nucleotide sequence accession numbers. The nucleotide sequences encoding Int280 from ICC61 and ICC95 have been submitted to the EMBL database under accession no. Y13111 and Y13112, respectively.

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Immunoreactivity of anti-Int280-H6 serum. The cell-binding domain of intimin from EPEC strain ICC64 (O127:H6), expressed as a His-tagged polypeptide, was used to raise polyclonal anti-Int280-H6 serum. To find conditions that will enable efficient and reproducible immunodetection of intimin in whole bacterial cell extracts, we conducted a systematic investigation of the levels of intimin expression in cultured ICC64 bacteria. We found, in agreement with previous reports (19, 30), that intimin expression is induced when EPEC is grown to the mid-log growth phase in DMEM at 37°C. In contrast, intimin was undetectable when the DMEM cultures were incubated at 28°C (data not shown). When the rabbit polyclonal antiserum was reacted with Western blots of whole bacterial cell extracts after overnight bacterial cultures had been diluted in DMEM and grown at 37°C for approximately 3 h, until the mid-log growth phase was reached, only some of the selected EPEC strains reacted strongly with the antiserum while other strains (including CVD206, an intimin-deficient derivative of E2348/69 [O127:H6]) showed no or weak reactivity (Table 1). This lack of reactivity could reflect either interbacterial differences in expression levels or antigenic variation within the intimin cell-binding domain expressed by the different EPEC strains.

Preparation of anti-Int280-H2 sera: reactivity of anti-Int280-H6 and anti-Int280-H2 sera with intimin. To investigate the possible existence of antigenic variation within the intimin family of polypeptides, His-Int280-H2 was constructed from a representative of EPEC clone 2 (ICC61) and used to raise anti-Int280-H2 serum in rabbits. Forty-one typical EPEC strains belonging to eight serogroups, together with 2 serotype O55:H7 and 7 EHEC strains from widely separated geographical sources (North and South America, Europe, and Asia), were analyzed by using the anti-Int280-H6 and anti-Int280-H2 sera. Only some of the EPEC strains (belonging to serotypes O55:H6, O127:H6, O142:H6, and O142:H34), as well as H. alvei, reacted strongly with anti-Int280-H6 serum, while the other strains (belonging to EPEC serotypes O55:H, O55:H7 O86:H34, O111:H2, O111:H, O114:H2, O119:H2, O119:H6, O127:H40, and O128:H2 and EHEC serotypes O26:H, O26:H11, and O157:H7, as well as C. rodentium and E. coli RDEC-1) showed weak or no reactivity (Fig. 1A and Table 1). In contrast, the anti-Int280-H2 serum reacted strongly with the strains belonging to EPEC serotypes O111:H2, O111:H, O114:H2, O119:H2, O119:H6, and O128:H2, EHEC serotypes O26:H11 and O26:H, C. rodentium, and E. coli RDEC-1. A weak reaction or no reaction was observed with strains belonging to EPEC serotypes O55:H, O55:H6, O55:H7, O86:H34, O127:H6, O127:H40, O142:H6, and O142:H34 and to EHEC serotype O157:H7 (Fig. 1B and Table 1). Figure 1 shows immunoblotting of 14 representatives of these strains (summary in Table 1). No reactivity was observed when the strains were probed with normal rabbit serum (data not shown). These findings show antigenic variation within the cell-binding domain and indicate that by using these sera, intimin can be divided antigenically into at least three serogroups (Table 1). These were designated intimin , recognized strongly by anti-Int280-H6 serum; intimin , recognized strongly by anti-Int280-H2 serum; and nontypeable (NT), recognized poorly by either antiserum (Table 1).

View larger version (45K): [in this window] [in a new window]   FIG. 1.   Immunoblotting analysis of polyclonal antisera against various EPEC strains. Each sample (optical density, 0.05) was loaded onto an SDS-7.5% PAGE gel, and the bacterial cell extracts were reacted with anti-Int280-H6 (A) or anti-Int280-H2 (B) serum. Molecular size markers (in kilodaltons) are shown in lane 1. Strain E2348/69 of serotype O127:H6 (lane 2) and strains of serotypes O142:H34 (lane 7), O55:H6 (lane 9), and O142:H6 (lane 13) reacted strongly with the anti-Int280-H6 serum, while strains of serotypes O111:H (lane 4), O114:H2 (lane 5), O119:H6 (lane 6), O111:H2 (lane 8), O119:H2 (lane 11), and O128:H2 (lane 15) reacted strongly with the anti-In280-H2 serum. Weak or no reactivity was observed with both antisera with strains CVD206 (lane 3) and strains of serotypes O55:H (lane 10), O86:H34 (lane 12), and O127:H40 (lane 14).

Immunogold and immunofluorescent labelling of whole bacterial EPEC and EHEC cells. The existence of antigenic variation in different intimins expressed on the bacterial cell surface was confirmed directly by immunogold and immunofluorescence. Both immunogold labelling (Fig. 2a to c) and immunofluorescence labelling of EPEC using anti-intimin  and anti-intimin  sera confirmed surface intimin expression in logarithmic-phase DMEM-grown cultures of strains belonging to EPEC clones 1 (Fig. 2a) and 2 (Fig. 2b) and revealed a uniform distribution of intimin over the bacterial surface; other EPEC strains did not react with either antiserum (Fig. 2c). Strains belonging to serogroups O55:H6, O127:H6, O142:H6, and O142:H34 stained strongly with anti-intimin  serum, while strains belonging to serogroups O55:H, O86:H34, O111:H, O111:H2, O114:H2, O119:H2, O119:H6, and O127:H40 showed weak or no staining (Fig. 2a and e and Table 1). In contrast, EPEC strains belonging to serotypes O111:H, O111:H2, O114:H2, O119:H2, and O119:H6 stained strongly with anti-intimin  serum, and weak or no staining was seen with strains of serotypes O55:H6, O127:H6, O142:H6, and O142:H34 (Fig. 2b and f and Table 1). Weak or no staining with either anti-intimin  or  serum was observed with strains of serotypes O55:H, O86:H34, and O127:H40 (Fig. 2c and g and Table 1), although complementary fluorescence actin staining and phase-contrast microscopy confirmed that the cells were covered with A/E bacteria (data not shown).

View larger version (158K): [in this window] [in a new window]   FIG. 2.   Immunogold labelling of logarithmic-phase, DMEM-grown cultures of EPEC (a to c) and EHEC (d) and immunofluorescence labelling of HEp-2 cell-adherent EPEC (e to g) and EHEC (h to l) strains showing a serotype O127:H6 EPEC strain expressing intimin  (a and e), a serotype O114:H2 EPEC strain expressing intimin  (b and f), a serotype O86:H34 EPEC strain that expresses neither intimin  nor  (c and g), a serotype O157:H7 EHEC strain expressing neither intimin  nor  (d and h), a serotype O26:H EPEC strain expressing intimin  (i), and a serotype O26:H11 EHEC strain expressing intimin  (j) but not intimin  (k). Although not stained with anti-intimin  serum, the phase-contrast micrograph of field k shows cell-adherent bacteria (l). Original magnifications: a to d, ×30,000; e to l, ×5,500.

Identification of intimin derivatives by PCR. The amino acid sequence of the C-terminal domain of intimin from EPEC ICC61 (O114:H2) and ICC95 (O86:H34) was deduced from the DNA sequence of the cloned domains. Alignment of Int280 from ICC61 (excluding the primer-derived sequence) with the published intimin sequences revealed 50% identity with that of E2348/69 (23); 79.8% identity with Int280 from C. rodentium (42); 46.7% identity with that of O157:H7 (49); 100% identity with those of RDEC-1 (1), O26:H11 (GenBank accession no. U62656), and O26:B6 (Genbank accession no. U62657); 99.6% identity with O111:H (Genbank accession no. U62655); and 47% identity with that of H. alvei (15). Comparison of Int280 from ICC95 with those of E2348/69 and O157:H7 revealed 49.6 and 46.7% identity, respectively, and 47 and 77.6% identity, respectively, with those of H. alvei and C. rodentium, while 75% identity with those of E. coli RDEC-1 and serotypes O114:H2, O111:H, O26:H11, and O26:B6 was revealed.

View larger version (83K): [in this window] [in a new window]   FIG. 3.   Detection of intimins  and  by PCR. Representative strains are shown. PCR products obtained with primer Int- were obtained from E2348/69 (A, lane 2) and from all of the serotype O55:H6 strains tested (A, lanes 4-9) but with none of the serotype O111:H2 strains (B, lanes 2 to 9) or strain CVD206 (A, lane 3). All of the serotype O119:H2 (C, lanes 2 and 4 to 7) and O119:H6 (D, lanes 2 to 7) strains tested, but not E2348/69 (C, lane 3), produced a positive PCR product with the Int- primer. Molecular size markers (1-kb ladder; Bethesda Research Laboratories) were loaded in lanes 1. The complete DNA analysis is presented in Table 2.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

In the present study, we used the cell-binding domain of intimin from two EPEC strains, representatives of EPEC clones 1 and 2, to raise polyclonal anti-intimin sera. Reaction of the anti-intimin sera with whole EPEC cell extracts (41 different strains belonging to eight serogroups) revealed antigenic variation within this domain, which seems to be in accordance with the reported diversity in the linear amino acid sequences. Nevertheless, on the basis of the Western blots, the tested EPEC strains could be divided into three groups. The first group consisted of strains which reacted strongly with anti-intimin  serum. Importantly, all of these strains which belong to EPEC clone 1 (serotypes O55:H6, O127:H6, O142:H6, and O142:H34) were also positive in a PCR using the Int- primer. The second group included strains that reacted strongly with anti-intimin  serum. These strains (serotypes O111:H2, O111:H, O114:H2, O119:H2, O119:H6, and O128:H2), with the exception of that belonging to serotype O119:H6 (20) all belong to EPEC clone 2 (39, 46) and produced a positive PCR product when the Int- primer was used. Seventeen serotype O119:H6 strains were analyzed by PCR, and all gave consistent results. The third group of strains (serotypes O55:H, O86:H34, and O127:H40) was recognized poorly by both antisera and produced a PCR product with neither primer Int- nor Int-. However, this group of strains, designated NT by immunological criteria, could be further classified genetically by using primers designed on the basis of the eae sequences from strains of serotypes O157:H7 (Int-) and O86:H34 (Int-). It is necessary to raise antiserum to Int280 from a representative of the NT group of strains to complete the immunological classification. By using immunological and genetic bioassays, we obtained consistent results with all (but two) of the strains belonging to a specific serotype. In addition, the classification of intimin according to diversity within the cell-binding domain, with the exception of O119:H6 and O86:H34 (which, although they belong to EPEC clone 1, comprise a different clonal phylogeny [46]), seems to follow the clonal lineages. Significantly, cross-reactivity with anti-intimin serum was observed with C. rodentium and E. coli RDEC-1, which also produced PCR products with the Int- primer, while H. alvei cross-reacted with anti-intimin  serum.

EHEC strains capable of forming A/E lesions and lacking the EAF plasmid are also divided into two divergent clonal groups (46, 47). EHEC clone 1 includes the serotype O157:H7 clone, while EHEC clone 2 is composed of Shiga-like toxin-producing serotype O26:H11 and O111:H8 strains. Recently, it was shown that serotype O55:H7, an atypical EPEC clone, is closely related to EHEC clone 1 (46, 47). Reacting the anti-intimin sera with representatives of the two EHEC clones revealed that while strains related to EHEC clone 1 were recognized by neither antiserum, strong cross-reactivity was observed with anti-intimin  serum and strains of EHEC clone 2. Similar results were obtained by PCR: while the serotype O26:H11 strains produced PCR products with the Int- primer, strains belonging to serotypes O55:H7 and O157:H7 produced specific PCR products with the Int- primer. Significantly, like O55:H7, the typical EPEC serotype O55:H was classified by using PCR together with EHEC O157:H7. By using immunogold and immunofluorescent labelling, we have directly demonstrated the existence of antigenic variation in the epitopes of different intimins expressed on the bacterial cell surface of EPEC and EHEC.

Previously published data from Agin and Wolf (2) and Jerse and Kaper (24) have been brought together to provide proof of the existence of at least three immunologically distinct groups of intimins, i.e., those similar to intimins from RDEC-1, EPEC E2348/69 (O127:H6), and EHEC (O157:H7). This cross-reactivity did not appear to be serogroup specific. In contrast, our study provides comprehensive evidence, obtained with immune sera, PCR, and a large number of clinical isolates of EPEC and EHEC, of the existence of at least five intimin subtypes which segregated in a serogroup-serotype fashion. An important feature of the antiserum used by Jerse and Kaper is the fact that it was raised by using an alkaline phosphatase-intimin fusion, containing the whole conserved N-terminal region of intimin, as the immunogen. This difference may explain, in part, the differences between the findings of Agin and Wolf and those presented here. In addition, by using immunological and genetic bioassays, we showed that both E. coli RDEC-1 and C. rodentium express intimin . The reason for the lack of cross-reactivity between these two intimins reported by Agin and Wolf is not clear.

An investigation of pathogen-specific factor that protect children from Brazil against diarrheal disease revealed that breastfeeding is protective against EPEC infection. Analysis of colostrum IgA showed that the antibodies reacted strongly with a 94-kDa protein and could prevent the adherence of EPEC to cells in culture (9). Recently, we assayed murine mucosal IgA responses to intimin in the C. rodentium model and found that in all of the immunologically naive mice that survived the initial infection, mucosal IgA antibodies to intimin were detected 28 days postchallenge, while no such responses were seen in any of the mice infected with the eae mutant of C. rodentium (17). Since intimin is highly immunogenic, it is possible that the diversity within the polypeptide cell-binding domain is driven by natural selection. However, it is important to note that despite the high diversity in this region, two stretches of six and seven amino acids (WLQYGQ and WAAGANKY) are identical in all intimins but are not found in any other sequences in the databases. It is possible, although not yet proven, that these amino acids form part of the binding site. According to the level of the immunological cross-reaction between intimins  and , these conserved amino acid sequences do not seem to be highly immunogenic. However, only our current investigation, aimed at mapping the immunodominant epitopes within Int280, will confirm this experimentally. The high immunogenicity of intimin in infected hosts provides a rational basis to support the concept of engineering an intimin molecule as a basis for an EPEC vaccine.

In conclusion, in the present study, we used immunological and genetic approaches to study antigenic variation and classify the cell-binding domain of intimin expressed by A/E lesion-forming pathogens. Our results revealed the presence of at least five intimin subtypes: , , , , and an untypeable intimin expressed by EPEC of serotype O127:H40.