Previous Article | Next Article 
Journal of Clinical Microbiology, April 1998, p. 1090-1095, Vol. 36, No. 4
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Nested PCR Assay for Detection of
Granulocytic Ehrlichiae
Robert F.
Massung,1,*
Kim
Slater,1
Jessica H.
Owens,1
William L.
Nicholson,1
Thomas N.
Mather,2
Victoria B.
Solberg,3 and
James G.
Olson1
National Center for Infectious Diseases,
Centers for Disease Control and Prevention, Atlanta, Georgia
303331;
Center for Vector-Borne
Disease, University of Rhode Island, Kingston, Rhode Island
028812; and
Department of
Entomology, Walter Reed Army Institute of Research, Washington,
D.C. 20307-51003
Received 6 August 1997/Returned for modification 10 November
1997/Accepted 12 January 1998
 |
ABSTRACT |
A sensitive and specific nested PCR assay was developed for the
detection of granulocytic ehrlichiae. The assay amplifies the 16S rRNA
gene and was used to examine acute-phase EDTA-blood and serum samples
obtained from seven humans with clinical presentations compatible with
human granulocytic ehrlichiosis. Five of the seven suspected cases were
positive by the PCR assay using DNA extracted from whole blood as the
template, compared with a serologic assay that identified only one
positive sample. The PCR assay using DNA extracted from the
corresponding serum samples as the template identified three positive
samples. The sensitivity of the assay on human samples was examined,
and the limit of detection was shown to be fewer than 2 copies of the
16S rRNA gene. The application of the assay to nonhuman samples
demonstrated products amplified from template DNA extracted from
Ixodes scapularis ticks collected in Rhode Island and from
EDTA-blood specimens obtained from white-tailed deer in Maryland. All
PCR products were sequenced and identified as specific to granulocytic
ehrlichiae. A putative variant granulocytic ehrlichia 16S rRNA gene
sequence was detected among products amplified from both the ticks and
the deer blood specimens.
 |
INTRODUCTION |
The ehrlichiae are obligately
intracellular bacteria and have been characterized as pathogens of
medical and veterinary importance. Two forms of human ehrlichiosis have
been reported in the United States: human monocytic ehrlichiosis (HME)
and human granulocytic ehrlichiosis (HGE). The first cases of HME were
described in 1987 (32), and the etiologic agent was
subsequently identified as Ehrlichia chaffeensis (2,
15). HGE was first described in 1994 and differs from HME in that
granulocytic leukocytes serve as the primary target cells
(13). The Ehrlichia species responsible for HGE
has not been defined, although the nucleotide sequence of the 16S rRNA
gene (16S rDNA) of the HGE agent suggests a close relationship to
Ehrlichia equi, the agent of equine granulocytic ehrlichiosis, and Ehrlichia phagocytophila, which is
responsible for infections of ruminants in Europe (13).
Studies supporting the close relationship of the HGE agent to E. equi and E. phagocytophila have included descriptions
of the serologic cross-reactivity of these organisms (3, 19)
and a report that a horse experimentally infected with the HGE agent
was resistant to an E. equi challenge (7).
The initial reports of HGE were in Minnesota and Wisconsin, but recent
studies have shown that the disease also occurs in the northeastern
United States and northern California (3, 11, 13, 21, 25, 28,
42). Human infections with a granulocytic Ehrlichia
species have also been described in Europe (4, 10, 22, 36,
38). The HGE agent has been associated with the deer tick,
Ixodes scapularis (3, 34, 35), which might serve as the primary vector. Additional vectors, and a mammalian reservoir, have not been determined, although dogs living in areas where HGE is
endemic can be naturally infected with granulocytic ehrlichiae (GE)
(27, 31, 37). Rodents, particularly white-footed mice (Peromyscus leucopus), are competent experimental hosts and
may serve as a natural reservoir (39, 40, 42).
HGE presents clinically as an acute febrile illness, although the
nonspecific symptoms of infection, most commonly fever, headache, and
myalgia, make the diagnosis problematic. Likewise, HGE-associated
laboratory findings, including leukopenia, thrombocytopenia, and
elevated liver enzymes, are relatively nonspecific. A history of tick
bite or tick exposure, while suggestive, is not diagnostic. Although
several recent reports have described successful cultivation of the HGE
agent (26, 29), the procedure is lengthy and the sensitivity
has not been determined. Serologic tests, particularly indirect
immunofluorescence antibody (IFA) assays, are commonly used but are
often negative during the acute phase of infection. The recognition of
cytoplasmic inclusions, or morulae, in infected cells during the
examination of blood smears can be diagnostic; however, morulae have
not been observed in numerous cases subsequently confirmed by other
criteria (1, 5). PCR assays have been used often, mostly in
research-oriented settings, and have the advantage of being able to
yield positive results during the early acute phase of illness.
PCR-based assays have proven critical for the identification and
subsequent characterization of the ehrlichiae and have been developed
for use with various clinical samples, but whole blood is the most
commonly used source (2, 9, 12, 30). A PCR assay has been
shown to be sensitive for identifying E. chaffeensis in
acute-phase human blood samples (2, 24), and a nested PCR
assay was used in the initial study that identified an
Ehrlichia species as being the etiologic agent of HGE
(13). More recent HGE studies have mainly used the primer set originally described by Chen et al. (13) for
identification of the agent (23). To date, several
alternative PCR assays have been described (6, 35), but
these assays have not been thoroughly tested on human and veterinary
specimens. The goal of this study was to develop a sensitive and
specific PCR assay for the diagnosis of HGE and for the identification
of GE in potential vector and host species.
 |
MATERIALS AND METHODS |
Samples.
EDTA-whole-blood and serum samples were collected
in June 1995 from seven human patients with suspected ehrlichiosis in
Westchester County, N.Y. I. scapularis ticks were collected
from Trustom Pond, R.I. Blood specimens from white-tailed deer were
collected from Prince Georges County, Md. Human blood samples were
stored at 4°C prior to DNA extraction. DNA was extracted from each
sample within 4 weeks of the date the blood samples were drawn.
White-tailed deer blood samples and ticks were stored at
20°C prior
to DNA extraction.
Controls.
A PCR-amplified region of the 16S rDNA was cloned
and used as a positive control for subsequent amplifications. The
cloned fragment was amplified from DNA extracted from the blood of one of the PCR-positive patients from Westchester County, N.Y., by using
primers ec12 and ec9 as previously described (2). The amplified product was purified by using the manufacturer's recommended protocol with the Wizard PCR Preps DNA Purification System (Promega Corporation, Madison, Wis.). The purified product was ligated into
plasmid vector pGEM-T, by using the pGEM-T Vector System kit (Promega).
The ligation product was transformed into Escherichia coli
XL1-Blue (Stratagene, La Jolla, Calif.) by electroporation, and
individual white colonies were selected after growth on Luria-Bertani agarose with ampicillin (50 µg/ml). Plasmid DNA was purified from overnight cultures by using the Qiagen (Chatsworth, Calif.) Plasmid Kit, and the insertion was confirmed as the HGE agent 16S rRNA gene by
DNA sequencing. This construct, named pFC4, was used as a positive
control where indicated in the text.
Serologic testing.
An IFA assay was used to screen human
sera for anti-HGE agent antibodies by using E. equi antigen
slides as a surrogate antigen (Fuller Laboratories, Fullerton, Calif.).
Sera were initially screened at dilutions of 1:64 and 1:128.
Fluorescein isothiocyanate (FITC)-conjugated goat anti-human
immunoglobulin G (IgG) (heavy and light chain; Kirkegaard & Perry
Laboratories, Gaithersburg, Md.) was used to identify antibodies
reactive to E. equi-infected horse neutrophils. Positive-
and negative-control sera were included in each assay. Titers of
positive serum samples were subsequently determined to end point. The
IgM-specific IFA assay utilized FITC-conjugated goat anti-human IgM
(Kirkegaard & Perry Laboratories). Sera for the IgM assay were first
depleted of IgG by use of a protein G affinity method (Quik-Sep IgM;
Isolab, Akron, Ohio).
DNA purification.
Total DNA was purified from 200 µl of
EDTA-whole blood (from humans or white-tailed deer) with the QIAamp
blood kit (Qiagen). The protocol used was that suggested by the
manufacturer. Briefly, detergent lysis was carried out in the presence
of proteinase K for 10 min at 70°C. The lysed material was applied to
a spin column containing a silica gel-based membrane and was washed
twice. Purified DNA was eluted from the columns in 200 µl of Tris (10 mM; pH 8.0) and was stored at 4°C until it was used as the template for PCR amplification.
DNA was purified from serum samples by using the QIAamp blood kit
essentially as described above. The only modification from the
EDTA-blood protocol was an initial concentration step that involved the
centrifugation of approximately 1 ml of each serum sample for 2 min at
12,000 × g. The supernatant was removed except for
approximately 200 µl that was used to resuspend the serum sediment.
The resuspended material was then used for DNA extraction.
DNA was purified from adult
I. scapularis ticks by using a
modification of the QIAamp tissue kit protocol (Qiagen). Individual
ticks were placed in 1.5-ml microcentrifuge tubes containing 50
µl of
phosphate-buffered saline (10 mM; pH 7.4) and were crushed
with a
disposable micropestle (Kontes Scientific Glassware/Instruments,
Vineland, N.J.). After the addition of 150 µl of phosphate-buffered
saline (10 mM; pH 7.4), the QIAamp tissue extraction protocol
was
followed as described by the manufacturer (Qiagen).
PCR amplification.
PCR amplifications were performed in a
Perkin-Elmer 9600 thermal cycler, and reagents were from the GeneAmp
PCR Kit with AmpliTaq DNA polymerase (Perkin-Elmer, Applied Biosystems
Division, Foster City, Calif.). Primary reactions used 5 µl of
purified DNA as the template in a total volume of 50 µl.
Amplifications contained 200 µM each deoxynucleoside triphosphate
(dATP, dCTP, dGTP, and dTTP), 1.25 U of Taq polymerase, and
0.5 µM each primer. Primers were ge3a (5'
CACATGCAAGTCGAACGGATTATTC) and ge10r (5'
TTCCGTTAAGAAGGATCTAATCTCC). Cycling conditions involved an
initial 2-min denaturation at 95°C, followed by 40 cycles, each
consisting of a 30-s denaturation at 94°C, a 30-s annealing at
55°C, and a 1-min extension at 72°C. These 40 cycles were followed
by a 5-min extension at 72°C. Reaction products were subsequently
maintained at 4°C until they were analyzed by agarose gel
electrophoresis or used as templates for nested reactions.
Nested amplifications used 1 µl of the primary PCR product as the
template in a total volume of 50 µl. Each nested amplification
contained 200 µM each deoxynucleoside triphosphate (dATP, dCTP,
dGTP,
and dTTP), 1.25 U of
Taq polymerase, and 0.2 µM each
primer:
ge9f (5' AACGGATTATTCTTTATAGCTTGCT) and ge2 (5'
GGCAGTATTAAAAGCAGCTCCAGG).
Nested cycling conditions were as
described for the primary amplification,
except that 30 cycles were
used. Reaction products were subsequently
maintained at 4°C until
they were analyzed by agarose gel electrophoresis
or purified for DNA
sequencing.
Quality control included both positive and negative controls that were
extracted and PCR amplified in parallel with all specimens.
Human
whole-blood DNA extractions and PCR amplifications were
done in
duplicate. In order to minimize the potential for contamination,
DNA
extractions, PCR setup, and agarose gel electrophoresis were
performed
in three separate rooms.
DNA sequencing and data analysis.
DNA sequencing reactions
used fluorescence-labeled dideoxynucleotide technology (Dye Terminator
Cycle Sequencing Ready Reaction Kit; Perkin-Elmer, Applied Biosystems
Division). Sequencing reaction products were separated, and data were
collected with an ABI 377 automated DNA sequencer (Perkin-Elmer,
Applied Biosystems Division). Sequences were edited and assembled with
the Staden software programs (17) and were analyzed with the
Wisconsin Sequence Analysis Package (Genetics Computer Group, Madison,
Wis.) (18). The 16S rDNA sequences used for comparison were
obtained from the GenBank database and included the HGE agent
(accession no. U02521), E. equi (M73223), and E. phagocytophila (M73220).
 |
RESULTS |
Nested PCR assay design and use with human whole blood.
The
initial testing of PCR assays used numerous primers and primer
combinations and included both direct and nested PCR protocols (data
not shown). A nested assay using primers ge3a and ge10r in the primary
reaction, followed by ge9f and ge2 in a nested reaction, appeared to
provide excellent sensitivity. The locations of these primers within
the 16S rRNA gene of the HGE agent are illustrated in Fig.
1. Primers ge9f and ge10r were previously described by Chen et al. (13). Samples were collected from
seven humans in Westchester County, N.Y., an area within the geographic range of I. scapularis ticks. These patients were suspected
of having HGE on the basis of clinical presentation, and both
EDTA-whole-blood and serum samples from the acute phase were
available. Results of the nested assay using template DNA extracted
from EDTA-whole-blood specimens are shown in Fig.
2. Samples 1, 2, and 4 were positive in
the primary amplification (Fig. 2A, lanes 1, 2, and 4), as indicated by
the 932-bp product. Two of the three positives showed low levels of
product (Fig. 2A, lanes 1 and 2). Sample 4 (Fig. 2A, lane 4) showed an
amount of product fairly comparable to that of the positive control.
The results of the nested PCR assay (Fig. 2B) demonstrated that samples
1, 2, 4, 5, and 6 (lanes 1, 2, 4, 5, and 6) were positive, as indicated
by the 546-bp product. Products from each of the five positive samples
show bands clearly evident on the ethidium bromide-stained agarose gel,
and the intensity of each band is comparable to that of the positive
control. Duplicate aliquots of each human blood sample were
independently extracted and PCR amplified, and these produced results
identical to those shown in Fig. 2 (data not shown).

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic representation of the GE 16S rDNA, showing the
relative locations of PCR primers used for the primary (ge3a and ge10r)
and nested (ge9f and ge2) amplification reactions. The orientation of
each primer is indicated by an arrowhead, and the sizes of the primary
and nested products are shown. Scale, 16S rDNA base numbering. Small
rectangle, region where sequence differences between the HGE agent,
E. equi, and the GE variant were noted.
|
|

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 2.
PCR products amplified from DNA purified from human
EDTA-blood samples (lanes 1 to 7) and from positive (+) and negative
( ) controls. (A) Primary amplification products. The expected size
(932 bp) is indicated. (B) Nested amplification products. The expected
size (546 bp) is noted. Lanes M are size standards and show the
HaeIII digest of phage X174 DNA.
|
|
PCR assay using human serum.
PCR was performed on DNA
extracted from serum samples obtained from the same seven patients
whose whole-blood specimens were tested by PCR as described above. The
products of the amplifications on the serum-derived templates are shown
in Fig. 3. Whereas the primary
amplification produced no detectable products for any of the serum
samples (Fig. 3A, lanes 1 to 7), the nested PCR assays showed products
of the appropriate size for samples 2, 4, and 5 (Fig. 3B, lanes 2, 4, and 5).

View larger version (49K):
[in this window]
[in a new window]
|
FIG. 3.
PCR products amplified from DNA purified from human
serum samples (lanes 1 to 7) and from positive (+) and negative ( )
controls. (A) Primary amplification products. The expected size (932 bp) is indicated. (B) Nested amplification products. The expected size
(546 bp) is noted. Lanes M are size standards and show the
HaeIII digest of phage X174 DNA.
|
|
Serologic testing of human samples.
The serum samples from the
seven human patients were tested for antibodies by IFA assay, and six
of the seven were negative (IFA titer, <64). The only IFA-positive
serum was from patient 1, with a reciprocal titer of 512. Furthermore,
an isotype-specific IFA assay showed that the response of this patient
was restricted to the IgM class, indicative of an acute infection. The
results of the PCR and IFA assays for the human blood and serum samples are summarized in Table 1.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Results of serologic and PCR assays for acute-phase
samples collected from suspected HGE patients residing in
Westchester County, N.Y.
|
|
PCR detection of ehrlichial DNA in ticks.
Application of the
assay to potential vector species was tested with DNA extracted from 31 flat, unengorged female I. scapularis ticks and 30 flat,
unengorged female Dermacentor variabilis ticks collected
from Trustom Pond, R.I. Whereas none of the amplifications using
the DNA extracted from D. variabilis ticks showed any
products (data not shown), five of the Ixodes extracts
(16%) showed products of the correct size. Figure
4A shows the results of the nested amplification using template DNA extracted from 13 of the I. scapularis ticks and includes the five positive products (lanes 1, 4, 6, 7, and 12). All the tick extracts were negative when tested by PCR assay for E. chaffeensis (data not shown).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
Nested PCR products amplified from DNA purified from
I. scapularis ticks (A) and white-tailed deer (B). Positive
(+) and negative ( ) controls are shown, and the expected size of the
nested products (546 bp) is indicated. Lanes M are size standards and
show the HaeIII digest of phage X174 DNA.
|
|
PCR of ehrlichial DNA from white-tailed deer.
DNA was
also extracted from EDTA-whole-blood samples obtained from
white-tailed deer in Prince Georges County, Md. Thirty-two deer
blood samples were tested with the HGE-specific nested PCR assay,
and products of the correct size were amplified from three of
these (9.4%). Figure 4B shows the nested PCR products for 13 of the
deer templates, including the three positives (lanes 4, 7, and 12). All
the deer blood extracts were negative when tested by PCR assay for
E. chaffeensis (data not shown).
Sensitivity of the nested PCR assay.
The sensitivity of the
assay was assessed by a spiking experiment that involved the addition
of a known quantity of a plasmid (pFC4) containing the HGE 16S rRNA
gene sequence to DNA extracted from ehrlichia PCR-negative human
EDTA-blood samples. Each primary reaction mixture contained the same
amount of background human genome DNA (5 µl) and 1 µl from a series
of 10-fold serial dilutions of pFC4. The nested reactions were
performed as described in Materials and Methods and used
1 µl of the primary reaction product as the template. By
using this approach, 10-fold serial dilutions of the purified,
quantitated plasmid DNA were tested, and the nested PCR amplification
products are shown in Fig. 5. The limit
of detection was determined to be approximately 1.93 copies (Fig. 5,
lane 8). These data were reproduced by using three different serial
dilutions of pFC4 and by using the DNA purified from three different
noninfected humans as a nonspecific competitor (data not shown).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 5.
Sensitivity testing of the GE PCR assays. (A) Products
of the primary assay using 10-fold serial dilutions of the positive
control (pFC4) as templates. Lanes 1 through 10 correspond to template
copy numbers ranging from 1.93 × 107 (lane 1) to
0.0193 (lane 10). The expected size of the primary product (932 bp) is
indicated. (B) Products of nested PCR using 1 µl of the corresponding
primary product as the template, with the expected size of the nested
PCR product (546 bp) indicated. Lanes M are molecular weight standards
and show the HaeIII digest of phage X174 DNA. Lanes C,
negative controls representing the background human genome DNA as the
template without the addition of the plasmid-cloned ehrlichia 16S
rDNA.
|
|
Specificity of the nested PCR assay.
Positive and negative
controls were included with each PCR amplification to ensure the
specificity of the assay. Negative controls consisted of human
EDTA-blood or serum samples collected from noninfected individuals and
were extracted in parallel with the test samples. No products were
amplified from any of the negative-control samples (Fig. 2 to 4). All
PCR amplifications were repeated in order to confirm the initial
results and assess the reproducibility of the assay; the results of the
repeat amplifications were identical to the results shown in Fig. 2 to
4 (data not shown). The specificity of the assay was further assessed
by attempting to amplify products from non-GE bacteria by using DNA
templates purified from infected human EDTA-blood samples or tissue
culture-grown bacteria. No products were amplified from other
Ehrlichia species that were tested, including E. chaffeensis, E. canis, E. sennetsu, and
E. risticii. Also negative were DNAs from the
phylogenetically related bacteria Bartonella henselae and
Rickettsia rickettsii and from purified DNA products
containing Rhizobium sp., Agrobacterium sp., and
Mycoplana sp. (data not shown).
DNA sequencing.
The nested PCR assays amplified a 546-bp
portion of the GE 16S rRNA gene (Fig. 1). Each PCR product was
sequenced, and the sequences determined for the products from the human
blood and serum samples, and from three of the five positive ticks,
were identical to each other and to the 16S rRNA gene sequence of the HGE agent previously described by Chen et al. (13). Two of
the tick-derived products and all three of the deer PCR products showed sequences that differed from the 16S rDNA sequence of the HGE agent by
2 bases and from the corresponding E. equi sequence by 1 nucleotide. The region near the 5' end of the 16S rRNA gene is where
the GE variant differs from the HGE agent and E. equi. This
region of variation is indicated in Fig. 1, and the nucleotides that
differ are shown in Fig. 6.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 6.
GE sequence differences. The region of the 16S rRNA gene
where sequence differences were noted is shown for the HGE agent,
E. equi, and a novel GE variant. The differing nucleotides
are boxed, and the numbers above these are the corresponding base
number designations for the HGE agent 16S rDNA sequence reported by
Chen et al. (13) (GenBank accession no. U02521). The
E. equi sequence was obtained from GenBank (accession no.
M73223).
|
|
 |
DISCUSSION |
HGE produces a wide range of clinical manifestations, from a
relatively benign febrile illness to severe and sometimes fatal infections. Tetracycline and doxycycline have been reported to be
therapeutically efficacious, and patients generally respond within
48 h of treatment (20). If administered promptly, these antibiotics can effectively prevent severe forms of the illness. Therefore, the prompt diagnosis and treatment of HGE is imperative. Diagnosis of HGE has been based primarily on IFA and PCR-based assays.
The nested PCR assay described in this report is both sensitive and
specific. The assay confirmed infection with the HGE agent in five of
the seven human samples examined. Of these five PCR-positive cases,
only one was positive by serologic (IFA) assay, and an isotype-specific
IFA assay showed that the response was restricted to the IgM class
(titer, 1:512). Follow-up studies by IFA assay on convalescent-phase
samples showed that two patients who were PCR positive and IFA negative
in this study subsequently seroconverted (41).
Convalescent-phase samples were not available for the other two
PCR-confirmed cases. These data suggest that PCR-based assays represent
a preferable method for evaluating suspected HGE cases during the acute
phase of infection. Additionally, some sera from confirmed HGE cases
are cross-reactive with antigens of the agent of HME, E. chaffeensis, when assayed by IFA assay (16, 33).
PCR-based assays are capable of discriminating between these two
closely related organisms that produce infections with very similar
clinical presentations.
The nested PCR assay was tested with template DNA purified from human
serum samples and resulted in positive results for samples collected
from three of the five patients whose whole-blood specimens were
positive by PCR. These results support the studies of Pancholi et al.
(35) and of Dumler and Bakken (21) by
demonstrating that PCR amplification of the HGE agent DNA from human
serum is feasible, although not as sensitive as PCR using EDTA-blood.
However, PCR represents a valuable adjunct to serologic testing when
only an acute-phase serum sample is available, and it will facilitate the confirmation of cases that would otherwise be missed.
The nested assay as described, from DNA extraction through
agarose gel electrophoretic analysis, can be completed by an
experienced laboratorian within an 8-h workday. A simple, commercially
available kit was used for DNA extraction, further simplifying the
procedure and making it more amenable to routine use in diagnostic
laboratories. Modifications of the assay using colorimetric,
fluorescent, and luminescent detection are currently being evaluated
and have the potential to further enhance the applicability of the
assay. The assay can be used for the routine diagnosis of HGE in human
clinical samples and is being used in this manner in the Centers for
Disease Control and Prevention (CDC) Rickettsial Laboratory, but it was designed primarily as a research tool to provide optimal sensitivity and specificity with a variety of samples. The sensitivity of the assay
requires the use of positive and negative controls for both DNA
extraction and PCR amplification, and laboratorians must be trained in
proper PCR techniques in order to avoid contamination.
The sensitivity of the PCR amplification was assessed by using a
plasmid control and was shown to be fewer than 2 copies of the 16S rRNA
gene. Infected granulocytes appear to contain many bacteria when
examined by light or electron microscopy, and ehrlichia DNA can often
be detected by less-sensitive PCR assays. However, for samples where
few bacteria are present, the sensitivity provided by this assay should
prove useful. As evidence, single-step PCR assays were negative for
each of the seven human serum samples tested in this report, while the
nested assay produced positive results from three of these samples. In
our laboratory, the assay has not produced equivocal plus/minus
results; all positives have been distinguished by products easily
visible on ethidium bromide-stained agarose gels. In addition to the
HGE cases described in this study, the assay has been used to identify
GE DNA and confirm infections in 4 cases when only acute-phase
EDTA-blood samples were available and 11 cases when only acute-phase
serum samples were available.
The ability of the assay to detect ehrlichia DNA in veterinary samples
was demonstrated. The amplification of DNA from I. scapularis ticks collected from Trustom Pond, R.I., showed
that 16% (5 of 31) were PCR positive for GE. PCR of DNA from
deer blood specimens collected in Prince Georges County, Md.,
showed that 9.4% (3 of 32) were positive. Recently, it was reported
that 50% of I. scapularis ticks collected in Connecticut
were PCR positive, although it was not indicated if these positives
were confirmed by DNA sequencing, and geographic variations in
prevalence were noted (34). The evidence accumulated to date
suggests that, like that of other tick-transmitted pathogens, the
prevalence of GE in tick populations may vary significantly based on
location and seasonal parameters.
The specificity of the assay was examined, and the assay will not
amplify products from DNA purified from the other
Ehrlichia species that have been tested or from
B. henselae or R. rickettsii. The
assay will amplify the 16S rDNA of a white-tailed deer agent determined
to be an Ehrlichia species that was recently described from
Georgia and Oklahoma (reference 14 and data not
shown). Although the white-tailed deer agent was not observed in the
current study involving deer from Maryland, positive PCR products from deer-derived templates need to be further analyzed by DNA sequencing, particularly because there may be some overlap in the geographic distribution of these agents.
The specificity of the assay was also assessed by sequencing the PCR
amplicons. The DNA sequence determined for each of these products was
strongly homologous (
99.4% identity in 497 bp) to previously
reported 16S rDNA sequences of GE. The sequences for the products
amplified from each of the human blood and serum samples were identical
to the published nucleotide sequence of the HGE agent (13).
In addition to the samples described in this report, the nested assay
has been used by the CDC Rickettsial Laboratory to test more than 500 human samples (EDTA-blood, citrated blood, and serum), and the only
products ever amplified (20 total positives, including the 5 in this
study) were identical in sequence to the HGE agent 16S rDNA. The
sequences for three of the tick-derived amplicons were also identical
to each other and to the HGE agent sequence. These data support the
correspondence between HGE and I. scapularis as a potential
vector of the disease, as previously suggested (35, 39).
However, the 16S rRNA gene sequences determined for the PCR products
from two of the ticks, and from all three positive white-tailed deer,
showed a variant GE sequence that differs from the HGE agent sequence
by 2 bases. The sequence of the GE variant we found in Maryland
white-tailed deer and Rhode Island ticks was identical to the sequence
recently described for an Ehrlichia species from
white-tailed deer in Wisconsin (8). The identification of
this variant in three diverse locations, and in populations of both
white-tailed deer and ticks, suggests that it may be relatively
widespread and constant in nature. Whether the GE variant identified in
this report causes human or veterinary disease remains to be
determined. An isolate of this variant would be valuable and would
allow experimental infection studies to address this issue.
A recent report described the PCR amplification of an ehrlichia 16S
rDNA sequence from white-footed mice in Minnesota (40). The
only difference between this sequence and the 16S rDNA sequence of the
HGE agent (GenBank accession no. U02521) is a single deletion of a
thymidine residue at position 153 of the HGE agent. This thymidine
residue is present in the GE variant described in the present study. It
remains to be determined whether the GE variant reported here (found in
ticks and deer), the HGE agent, the agent found in Minnesota
white-footed mice, E. equi, and E. phagocytophila
represent natural variants of a single species. Certainly, the 16S rDNA
sequences that have been amplified and sequenced for these organisms
are very well conserved, with 1 to 3 nucleotide differences. The
identification and DNA sequencing of genetic elements that are more
variable than the 16S rDNA will be instrumental in resolving the
phylogenetic relationship between the HGE agent and the increasing
number of GE variants that are being found in nature.
 |
ACKNOWLEDGMENTS |
We are extremely grateful to John Sumner and Dana Jones for DNA
sequencing assistance and to the Biotechnology Core Facility of the
National Center for Infectious Diseases for oligonucleotide synthesis.
We are grateful to Burt Anderson for the design of primers ge2 and ge3,
which were modified for this study.
V.B.S. acknowledges support from the American Wildlife Research
Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centers for
Disease Control and Prevention, 1600 Clifton Rd., MS G-13, Atlanta, GA 30333. Phone: (404) 639-1075. Fax: (404) 639-4436. E-mail:
rfm2{at}cdc.gov.
 |
REFERENCES |
| 1.
|
Aguero-Rosenfeld, M. E.,
H. W. Horowitz,
G. P. Wormser,
D. F. McKenna,
J. Nowakowski,
J. Munoz, and J. S. Dumler.
1996.
Human granulocytic ehrlichiosis: a case series from a medical center in New York State.
Ann. Intern. Med.
125:904-908[Abstract/Free Full Text].
|
| 2.
|
Anderson, B. E.,
J. E. Dawson,
D. C. Jones, and K. H. Wilson.
1991.
Ehrlichia chaffeensis, a new species associated with human ehrlichiosis.
J. Clin. Microbiol.
29:2838-2842[Abstract/Free Full Text].
|
| 3.
|
Bakken, J. S.,
J. S. Dumler,
S.-M. Chen,
M. R. Eckman,
L. L. Van Etta, and D. H. Walker.
1994.
Human granulocytic ehrlichiosis in the upper Midwest United States. A new species emerging?
JAMA
272:212-218[Abstract/Free Full Text].
|
| 4.
|
Bakken, J. S.,
J. Krueth,
R. L. Tilden,
J. S. Dumler, and B. E. Kristiansen.
1997.
Serological evidence of human granulocytic ehrlichiosis in Norway.
Eur. J. Clin. Microbiol. Infect. Dis.
15:829-832.
|
| 5.
|
Bakken, J. S.,
J. Krueth,
C. Wilson-Nordskog,
R. L. Tilden,
K. Asanovich, and J. S. Dumler.
1996.
Clinical and laboratory characteristics of human granulocytic ehrlichiosis.
JAMA
275:199-205[Abstract/Free Full Text].
|
| 6.
|
Barlough, J. E.,
J. E. Madigan,
E. DeRock, and L. Bigornia.
1996.
Nested polymerase chain reaction for detection of Ehrlichia equi genome DNA in horses and ticks (Ixodes pacificus).
Vet. Parasitol.
63:319-329[Medline].
|
| 7.
|
Barlough, J. E.,
J. E. Madigan,
E. DeRock,
J. S. Dumler, and J. S. Bakken.
1995.
Protection against Ehrlichia equi is conferred by prior infection with the human granulocytotropic ehrlichia (HGE agent).
J. Clin. Microbiol.
33:3333-3334[Abstract].
|
| 8.
|
Belongia, E. A.,
K. D. Reed,
P. D. Mitchell,
C. P. Kolbert,
D. H. Persing,
J. S. Gill, and J. J. Kazmierczak.
1997.
Prevalence of granulocytic Ehrlichia infection among white-tailed deer in Wisconsin.
J. Clin. Microbiol.
35:1465-1468[Abstract].
|
| 9.
|
Biswas, B.,
D. Mukherjee,
B. L. Mattingly-Napier, and S. K. Dutta.
1991.
Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).
J. Clin. Microbiol.
29:2228-2233[Abstract/Free Full Text].
|
| 10.
|
Brouqui, P.,
J. S. Dumler,
R. Lienhard,
M. Brossard, and D. Raoult.
1995.
Human granulocytic ehrlichiosis in Europe.
Lancet
346:782-783[Medline].
|
| 11.
|
Centers for Disease Control and Prevention.
1995.
Human granulocytic ehrlichiosis New York, 1995.
Morbid. Mortal. Weekly Rep.
44:593-595[Medline].
|
| 12.
|
Chang, W.-L., and M.-J. Pan.
1996.
Specific amplification of Ehrlichia platys DNA from blood specimens by two-step PCR.
J. Clin. Microbiol.
34:3142-3146[Abstract].
|
| 13.
|
Chen, S.-M.,
J. S. Dumler,
J. S. Bakken, and D. H. Walker.
1994.
Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease.
J. Clin. Microbiol.
32:589-595[Abstract/Free Full Text].
|
| 14.
|
Dawson, J. E.,
C. K. Warner,
V. Baker,
S. A. Ewing,
D. E. Stallknecht,
W. D. Davidson,
A. A. Kocan,
J. M. Lockhart, and J. G. Olson.
1996.
Ehrlichia-like 16S rDNA sequence from wild white-tailed deer (Odocoileus virginianus).
J. Parasitol.
82:52-58[Medline].
|
| 15.
|
Dawson, J. E.,
B. E. Anderson,
D. B. Fishbein,
J. L. Sanchez,
C. S. Goldsmith,
K. H. Wilson, and C. W. Duntley.
1991.
Isolation and characterization of an Ehrlichia sp. from a patient diagnosed with human ehrlichiosis.
J. Clin. Microbiol.
29:2741-2745[Abstract/Free Full Text].
|
| 16.
|
Dawson, J. E.,
L. Fuller, and S. R. Telford, III.
1996.
Serologic cross-reactivity between Ehrlichia chaffeensis and the agent of human granulocytic ehrlichiosis, abstr. 17, p. 17.
In
Abstracts of the 12th Sesqui-Annual Meeting of ASRRD. American Society for Rickettsiology and Rickettsial Diseases, Pacific Grove, Calif.
|
| 17.
|
Dear, S., and R. Staden.
1991.
A sequence assembly and editing program for efficient management of large projects.
Nucleic Acids Res.
19:3907-3911[Abstract/Free Full Text].
|
| 18.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 19.
|
Dumler, J. S.,
K. M. Asanovich,
J. S. Bakken,
P. Richter,
R. Kimsey, and J. E. Madigan.
1995.
Serologic cross-reactions among Ehrlichia equi, Ehrlichia phagocytophila, and human granulocytic ehrlichia.
J. Clin. Microbiol.
33:1098-1103[Abstract].
|
| 20.
|
Dumler, J. S., and J. S. Bakken.
1995.
Ehrlichial diseases of humans: emerging tick-borne infections.
Clin. Infect. Dis.
20:1102-1110[Medline].
|
| 21.
|
Dumler, J. S., and J. S. Bakken.
1996.
Human granulocytic ehrlichiosis in Wisconsin and Minnesota: a frequent infection with the potential for persistence.
J. Infect. Dis.
173:1027-1030[Medline].
|
| 22.
|
Dumler, J. S.,
L. Dotevall,
R. Gustafson, and M. Granström.
1997.
A population-based seroepidemiologic study of human granulocytic ehrlichiosis and Lyme disease on the west coast of Sweden.
J. Infect. Dis.
175:720-722[Medline].
|
| 23.
|
Edelman, D. C., and J. S. Dumler.
1996.
Evaluation of an improved PCR diagnostic assay for human granulocytic ehrlichiosis.
Mol. Diagn.
1:41-49[Medline].
|
| 24.
|
Everett, E. D.,
K. A. Evans,
R. B. Henry, and G. McDonald.
1994.
Human ehrlichiosis in adults after tick exposure: diagnosis using polymerase chain reaction.
Ann. Intern. Med.
120:730-735[Abstract/Free Full Text].
|
| 25.
|
Gerwirtz, A. S.,
P. J. Cornbleet,
D. J. Vugia,
C. Traver,
J. Niederhuber,
C. P. Kolbert, and D. H. Persing.
1996.
Human granulocytic ehrlichiosis: report of a case in northern California.
Clin. Infect. Dis.
23:653-654[Medline].
|
| 26.
|
Goodman, J. L.,
C. Nelson,
B. Vitale,
J. E. Madigan,
J. S. Dumler,
T. J. Kurtti, and U. G. Munderloh.
1996.
Direct cultivation of the causative agent of human granulocytic ehrlichiosis.
N. Engl. J. Med.
334:209-215[Abstract/Free Full Text].
|
| 27.
|
Greig, B.,
K. M. Asanovich,
P. J. Armstrong, and J. S. Dumler.
1996.
Geographic, clinical, serologic, and molecular evidence of granulocytic ehrlichiosis, a likely zoonotic disease, in Minnesota and Wisconsin dogs.
J. Clin. Microbiol.
34:44-48[Abstract].
|
| 28.
|
Hardalo, C. J.,
V. Quagliarello, and J. S. Dumler.
1995.
Human granulocytic ehrlichiosis in Connecticut: report of a fatal case.
Clin. Infect. Dis.
21:910-914[Medline].
|
| 29.
|
Heimer, R.,
A. Van Andel,
G. P. Wormser, and M. L. Wilson.
1997.
Propagation of granulocytic Ehrlichia spp. from human and equine sources in HL-60 cells induced to differentiate into functional granulocytes.
J. Clin. Microbiol.
35:923-927[Abstract].
|
| 30.
|
Iqbal, Z.,
W. Chaichanasiriwithaya, and Y. Rikihisa.
1994.
Comparison of PCR with other tests for early diagnosis of canine ehrlichiosis.
J. Clin. Microbiol.
32:1658-1662[Abstract/Free Full Text].
|
| 31.
|
Madewell, B. R., and D. H. Gribble.
1982.
Infection of two dogs with an agent resembling Ehrlichia equi.
J. Am. Vet. Med. Assoc.
180:512-514[Medline].
|
| 32.
|
Maeda, K.,
N. Markowitz,
R. C. Hawley,
M. Ristic,
D. Cox, and J. E. McDade.
1987.
Human infection with Ehrlichia canis, a leukocytic rickettsia.
N. Engl. J. Med.
316:853-856[Medline].
|
| 33.
|
Magnarelli, L. A.,
J. S. Dumler,
J. F. Anderson,
R. C. Johnson, and E. Fikrig.
1995.
Coexistence of antibodies to tick-borne pathogens of babesiosis, ehrlichiosis, and Lyme borreliosis in human sera.
J. Clin. Microbiol.
33:3054-3057[Abstract].
|
| 34.
|
Magnarelli, L. A.,
K. C. Stafford III,
T. N. Mather,
M.-T. Yeh,
K. D. Horn, and J. S. Dumler.
1995.
Hemocytic rickettsia-like organisms in ticks: serologic reactivity with antisera to ehrlichiae and detection of DNA of agent of human granulocytic ehrlichiosis by PCR.
J. Clin. Microbiol.
33:2710-2714[Abstract].
|
| 35.
|
Pancholi, P.,
C. P. Kolbert,
P. D. Mitchell,
K. D. Reed,
J. S. Dumler,
J. S. Bakken,
S. R. Telford, and D. H. Persing.
1995.
Ixodes dammini as a potential vector of human granulocytic ehrlichiosis.
J. Infect. Dis.
172:1007-1012[Medline].
|
| 36.
|
Petrovic, M.,
S. L. Furlan,
T. A. Zupanc,
F. Strle,
P. Brouqui,
V. Roux, and J. S. Dumler.
1997.
Human disease in Europe caused by a granulocytic Ehrlichia species.
J. Clin. Microbiol.
35:1556-1559[Abstract].
|
| 37.
|
Rodgers, S. J.,
R. J. Morton, and C. A. Baldwin.
1989.
A serological survey of Ehrlichia canis, Ehrlichia equi, Rickettsia rickettsii and Borrelia burgdorferi in dogs in Oklahoma.
J. Vet. Diagn. Invest.
1:154-159[Abstract/Free Full Text].
|
| 38.
|
Sumption, K. J.,
D. J. M. Wright,
S. J. Cutler, and B. A. S. Dale.
1995.
Human ehrlichiosis in the UK.
Lancet
346:1487-1488[Medline].
|
| 39.
|
Telford, S. R., III,
J. E. Dawson,
P. Katavolos,
C. K. Warner,
C. P. Kolbert, and D. H. Persing.
1996.
Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle.
Proc. Natl. Acad. Sci. USA
93:6209-6214[Abstract/Free Full Text].
|
| 40.
|
Walls, J. J.,
B. Greig,
D. F. Neitzel, and J. S. Dumler.
1997.
Natural infection of small mammal species in Minnesota with the agent of human granulocytic ehrlichiosis.
J. Clin. Microbiol.
35:853-855[Abstract].
|
| 41.
|
Wong, S. J.,
G. S. Brady, and J. S. Dumler.
1997.
Serological responses to Ehrlichia equi, Ehrlichia chaffeensis, and Borrelia burgdorferi in patients from New York State.
J. Clin. Microbiol.
35:2198-2205[Abstract].
|
| 42.
|
Yeh, M.-T.,
T. N. Mather,
R. T. Coughlin,
C. Gingrich-Baker,
J. W. Summer, and R. F. Massung.
1997.
Serologic and molecular detection of granulocytic ehrlichiosis in Rhode Island.
J. Clin. Microbiol.
35:944-947[Abstract].
|
Journal of Clinical Microbiology, April 1998, p. 1090-1095, Vol. 36, No. 4
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zeman, P., Jahn, P.
(2009). An entropy-optimized multilocus approach for characterizing the strains of Anaplasma phagocytophilum infecting horses in the Czech Republic. J Med Microbiol
58: 423-429
[Abstract]
[Full Text]
-
Santos, A. S., Alexandre, N., Sousa, R., Nuncio, M. S., Bacellar, F., Dumler, J. S.
(2009). Serological and molecular survey of Anaplasma species infection in dogs with suspected tickborne disease in Portugal. Vet Rec.
164: 168-171
[Abstract]
[Full Text]
-
Ladbury, G. A. F., Stuen, S., Thomas, R., Bown, K. J., Woldehiwet, Z., Granquist, E. G., Bergstrom, K., Birtles, R. J.
(2008). Dynamic Transmission of Numerous Anaplasma phagocytophilum Genotypes among Lambs in an Infected Sheep Flock in an Area of Anaplasmosis Endemicity. J. Clin. Microbiol.
46: 1686-1691
[Abstract]
[Full Text]
-
Massung, R. F., Levin, M. L., Munderloh, U. G., Silverman, D. J., Lynch, M. J., Gaywee, J. K., Kurtti, T. J.
(2007). Isolation and Propagation of the Ap-Variant 1 Strain of Anaplasma phagocytophilum in a Tick Cell Line. J. Clin. Microbiol.
45: 2138-2143
[Abstract]
[Full Text]
-
Oteo, J. A., Portillo, A., Santibanez, S., Blanco, J. R., Perez-Martinez, L., Ibarra, V.
(2006). Cluster of Cases of Human Rickettsia felis Infection from Southern Europe (Spain) Diagnosed by PCR.. J. Clin. Microbiol.
44: 2669-2671
[Abstract]
[Full Text]
-
Kawahara, M., Rikihisa, Y., Lin, Q., Isogai, E., Tahara, K., Itagaki, A., Hiramitsu, Y., Tajima, T.
(2006). Novel Genetic Variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a Novel Ehrlichia sp. in Wild Deer and Ticks on Two Major Islands in Japan. Appl. Environ. Microbiol.
72: 1102-1109
[Abstract]
[Full Text]
-
Massung, R. F., Mather, T. N., Levin, M. L.
(2006). Reservoir Competency of Goats for the Ap-Variant 1 Strain of Anaplasma phagocytophilum. Infect. Immun.
74: 1373-1375
[Abstract]
[Full Text]
-
de la Fuente, J., Massung, R. F., Wong, S. J., Chu, F. K., Lutz, H., Meli, M., von Loewenich, F. D., Grzeszczuk, A., Torina, A., Caracappa, S., Mangold, A. J., Naranjo, V., Stuen, S., Kocan, K. M.
(2005). Sequence Analysis of the msp4 Gene of Anaplasma phagocytophilum Strains. J. Clin. Microbiol.
43: 1309-1317
[Abstract]
[Full Text]
-
Lin, Q., Rikihisa, Y., Massung, R. F., Woldehiwet, Z., Falco, R. C.
(2004). Polymorphism and Transcription at the p44-1/p44-18 Genomic Locus in Anaplasma phagocytophilum Strains from Diverse Geographic Regions. Infect. Immun.
72: 5574-5581
[Abstract]
[Full Text]
-
Courtney, J. W., Kostelnik, L. M., Zeidner, N. S., Massung, R. F.
(2004). Multiplex Real-Time PCR for Detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol.
42: 3164-3168
[Abstract]
[Full Text]
-
Casey, A. N. J., Birtles, R. J., Radford, A. D., Bown, K. J., French, N. P., Woldehiwet, Z., Ogden, N. H.
(2004). Groupings of highly similar major surface protein (p44)-encoding paralogues: a potential index of genetic diversity amongst isolates of Anaplasma phagocytophilum. Microbiology
150: 727-734
[Abstract]
[Full Text]
-
Benson, M. J., Gawronski, J. D., Eveleigh, D. E., Benson, D. R.
(2004). Intracellular Symbionts and Other Bacteria Associated with Deer Ticks (Ixodes scapularis) from Nantucket and Wellfleet, Cape Cod, Massachusetts. Appl. Environ. Microbiol.
70: 616-620
[Abstract]
[Full Text]
-
Liddell, A. M., Stockham, S. L., Scott, M. A., Sumner, J. W., Paddock, C. D., Gaudreault-Keener, M., Arens, M. Q., Storch, G. A.
(2003). Predominance of Ehrlichia ewingii in Missouri Dogs. J. Clin. Microbiol.
41: 4617-4622
[Abstract]
[Full Text]
-
CAO, W.-C., ZHAO, Q.-M., ZHANG, P.-H., YANG, H., WU, X.-M., WEN, B.-H., ZHANG, X.-T., HABBEMA, J. D. F.
(2003). PREVALENCE OF ANAPLASMA PHAGOCYTOPHILA AND BORRELIA BURGDORFERI IN IXODES PERSULCATUS TICKS FROM NORTHEASTERN CHINA. Am J Trop Med Hyg
68: 547-550
[Abstract]
[Full Text]
-
Ogden, N. H., Casey, A. N. J., Woldehiwet, Z., French, N. P.
(2003). Transmission of Anaplasma phagocytophilum to Ixodes ricinus Ticks from Sheep in the Acute and Post-Acute Phases of Infection. Infect. Immun.
71: 2071-2078
[Abstract]
[Full Text]
-
Courtney, J. W., Dryden, R. L., Montgomery, J., Schneider, B. S., Smith, G., Massung, R. F.
(2003). Molecular Characterization of Anaplasma phagocytophilum and Borrelia burgdorferi in Ixodes scapularis Ticks from Pennsylvania. J. Clin. Microbiol.
41: 1569-1573
[Abstract]
[Full Text]
-
Arens, M. Q., Liddell, A. M., Buening, G., Gaudreault-Keener, M., Sumner, J. W., Comer, J. A., Buller, R. S., Storch, G. A.
(2003). Detection of Ehrlichia spp. in the Blood of Wild White-Tailed Deer in Missouri by PCR Assay and Serologic Analysis. J. Clin. Microbiol.
41: 1263-1265
[Abstract]
[Full Text]
-
Massung, R. F., Slater, K. G.
(2003). Comparison of PCR Assays for Detection of the Agent of Human Granulocytic Ehrlichiosis, Anaplasma phagocytophilum. J. Clin. Microbiol.
41: 717-722
[Abstract]
[Full Text]
-
Stuen, S., Van De Pol, I., Bergstrom, K., Schouls, L. M.
(2002). Identification of Anaplasma phagocytophila (Formerly Ehrlichia phagocytophila) Variants in Blood from Sheep in Norway. J. Clin. Microbiol.
40: 3192-3197
[Abstract]
[Full Text]
-
Bjoersdorff, A., Bagert, B., Massung, R. F., Gusa, A., Eliasson, I.
(2002). Isolation and Characterization of Two European Strains of Ehrlichia phagocytophila of Equine Origin. CVI
9: 341-343
[Abstract]
[Full Text]
-
Liz, J. S., Sumner, J. W., Pfister, K., Brossard, M.
(2002). PCR Detection and Serological Evidence of Granulocytic Ehrlichial Infection in Roe Deer (Capreolus capreolus) and Chamois (Rupicapra rupicapra). J. Clin. Microbiol.
40: 892-897
[Abstract]
[Full Text]
-
Gusa, A. A., Buller, R. S., Storch, G. A., Huycke, M. M., Machado, L. J., Slater, L. N., Stockham, S. L., Massung, R. F.
(2001). Identification of a p28 Gene in Ehrlichia ewingii: Evaluation of Gene for Use as a Target for a Species-Specific PCR Diagnostic Assay. J. Clin. Microbiol.
39: 3871-3876
[Abstract]
[Full Text]
-
Cao, W.-C., Zhao, Q.-M., Zhang, P.-H., Dumler, J. S., Zhang, X.-T., Fang, L.-Q., Yang, H.
(2000). Granulocytic Ehrlichiae in Ixodes persulcatus Ticks from an Area in China Where Lyme Disease Is Endemic. J. Clin. Microbiol.
38: 4208-4210
[Abstract]
[Full Text]
-
Wolf, L., McPherson, T., Harrison, B., Engber, B., Anderson, A., Whitt, P.
(2000). Prevalence of Ehrlichia ewingii in Amblyomma americanum in North Carolina. J. Clin. Microbiol.
38: 2795-2795
[Full Text]
-
Liz, J. S., Anderes, L., Sumner, J. W., Massung, R. F., Gern, L., Rutti, B., Brossard, M.
(2000). PCR Detection of Granulocytic Ehrlichiae in Ixodes ricinus Ticks and Wild Small Mammals in Western Switzerland. J. Clin. Microbiol.
38: 1002-1007
[Abstract]
[Full Text]
-
Baumgarten, B. U., Röllinghoff, M., Bogdan, C.
(1999). Prevalence of Borrelia burgdorferi and Granulocytic and Monocytic Ehrlichiae in Ixodes ricinus Ticks from Southern Germany. J. Clin. Microbiol.
37: 3448-3451
[Abstract]
[Full Text]
-
Stafford, K. C. III, Massung, R. F., Magnarelli, L. A., Ijdo, J. W., Anderson, J. F.
(1999). Infection with Agents of Human Granulocytic Ehrlichiosis, Lyme Disease, and Babesiosis in Wild White-Footed Mice (Peromyscus leucopus) in Connecticut. J. Clin. Microbiol.
37: 2887-2892
[Abstract]
[Full Text]
-
Childs, J. E., Sumner, J. W., Nicholson, W. L., Massung, R. F., Standaert, S. M., Paddock, C. D.
(1999). Outcome of Diagnostic Tests Using Samples from Patients with Culture-Proven Human Monocytic Ehrlichiosis: Implications for Surveillance. J. Clin. Microbiol.
37: 2997-3000
[Abstract]
[Full Text]
-
Schouls, L. M., Van De Pol, I., Rijpkema, S. G. T., Schot, C. S.
(1999). Detection and Identification of Ehrlichia, Borrelia burgdorferi Sensu Lato, and Bartonella Species in Dutch Ixodes ricinus Ticks. J. Clin. Microbiol.
37: 2215-2222
[Abstract]
[Full Text]
-
Comer, J. A., Nicholson, W. L., Sumner, J. W., Olson, J. G., Childs, J. E.
(1999). Diagnosis of Human Ehrlichiosis by PCR Assay of Acute-Phase Serum. J. Clin. Microbiol.
37: 31-34
[Abstract]
[Full Text]