Previous Article | Next Article 
Journal of Clinical Microbiology, April 1998, p. 944-948, Vol. 36, No. 4
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Diversity of Helicobacter pylori vacA and
cagA Genes and Relationship to VacA and CagA Protein
Expression, Cytotoxin Production, and Associated Diseases
Jochen
Rudi,1,*
Christof
Kolb,1
Matthias
Maiwald,2
Dirk
Kuck,1
Andreas
Sieg,1
Peter R.
Galle,1 and
Wolfgang
Stremmel1
Department of Medicine, Division of
Gastroenterology,1 and
Institute of
Microbiology,2 University of Heidelberg,
Heidelberg, Germany
Received 27 August 1997/Returned for modification 17 November
1997/Accepted 5 January 1998
 |
ABSTRACT |
The vacuolating cytotoxin and the cytotoxin-associated protein,
encoded by vacA and cagA, respectively, are
important virulence determinants of Helicobacter pylori.
Sixty-five H. pylori strains were isolated from dyspeptic
patients (19 with peptic ulcer disease, 43 with chronic gastritis, and
3 with gastric cancer) and studied for differences in the
vacA and cagA genes and their relationship to
VacA and CagA expression, cytotoxin activity, and the clinical outcome
of infection. By PCR, fifty-four (83.1%) of 65 strains had the
vacA signal sequence genotype s1 and only 10 (15.4%) had the type s2. After primer modification, the vacA
middle-region types m1 and m2 were detected in 24 (36.9%) and 41 (63.1%) strains, respectively. The combinations s1-m2 (31 [47.7%])
and s1-m1 (23 [35.4%]) occurred more frequently than s2-m2 (10 [15.4%]) (P = 0.01). No strain with the combination
s2-m1 was found. All 19 patients with peptic ulcers harbored type s1
strains, in contrast to 32 (74.4%) of 43 patients with gastritis
(P = 0.02). The vacA genotype s1 was
associated with the presence of cagA (P < 0.0001), VacA expression (P < 0.0001), and cytotoxin
activity (P = 0.003). The cagA gene was
detectable in 48 (73.8%) of 65 isolates and present in 16 (84.2%) of
19 ulcer patients and 29 (67.4%) of 43 patients with gastritis
(P = 0.17). The vacA genotypes of German H. pylori isolates are identical to those previously
reported. H. pylori strains of vacA type s1 are
associated with the occurrence of peptic ulceration and the presence of
cagA, cytotoxin activity, and VacA expression.
 |
INTRODUCTION |
Helicobacter pylori, a
spiral-shaped, microaerophilic bacterium that colonizes the stomach in
humans has been identified as the cause of chronic gastritis, peptic
ulcer disease (PUD), gastric cancer, and mucosa-associated lymphoid
tissue lymphoma (15, 18, 25, 27). Once established, it may
reside in the gastric mucosa for years, possibly for the life of the
host (21), because the immunological defense mechanisms of
the host fail to eliminate it.
There are specific virulence determinants in H. pylori
strains, apart from immunological factors in the host, that influence the clinical outcome of infection. Virulence factors found in a subset
of clinical isolates, such as the vacuolating cytotoxin (VacA) and the
cytotoxin-associated protein (CagA), have been recently identified
(4, 6, 11, 12, 16).
Only 50 to 65% of strains produce an 87-kDa cytotoxin that induces
vacuolation of HeLa or primary gastric epithelial cells in vitro
(4, 8, 12, 14, 16, 20). Infection with VacA-producing
strains is associated with the presence of PUD (5, 12, 13).
Recently, specific vacA genotypes, which are characterized
by differences in the signal sequence and middle-region of the gene,
have been identified in isolates obtained from U.S. subjects (1,
2). The vacA signal sequence type s1, but not type s2,
was closely associated with in vitro cytotoxin activity, PUD, and the
presence of the cagA gene. It is unknown whether H. pylori isolates from Europe have identical
vacA genotypes or carry vacA alleles different
from strains isolated in the United States.
The cagA gene is present in about 60 to 70% of
H. pylori strains and encodes a high-molecular-weight
protein (120 to 140 kDa) (4, 22). CagA-producing
H. pylori strains have been detected in patients with
PUD more frequently than in patients with chronic gastritis alone
(4, 6, 10, 29). Sequencing of the cagA gene in
H. pylori revealed a region of internal duplications
which may be responsible for CagA size heterogeneity (4).
However, no information is available on the influence on the clinical
outcome with respect to diversity at the cagA gene level.
The objectives of this study were (i) to characterize the
vacA alleles and analyze differences in the cagA
gene that are present in German H. pylori strains and
(ii) to correlate differences found within these genes with VacA and
CagA protein expression, in vitro cytotoxicity, and clinical outcome.
 |
MATERIALS AND METHODS |
Patients, biopsy sampling, and cultivation of H. pylori strains.
Sixty-five H. pylori
isolates from a consecutive series of patients with H. pylori infection undergoing upper gastrointestinal endoscopy and
two reference strains, H. pylori 60190 (ATCC 49503) (cytotoxin producing, cagA+) and Tx30a
(non-cytotoxin-producing, cagA negative) were used in this
study (1, 16). Endoscopic and histological diagnoses were
recorded for all patients. An ulcer was defined as an excavated mucosal
break with a diameter of >5 mm. All patients gave informed consent to
biopsy sampling. The study was approved by the Ethics Committee of the
University of Heidelberg. Gastric biopsy specimens obtained from the
antrum of all 65 patients and additionally from the corpus of 6 patients were homogenized, inoculated onto Columbia agar with 10%
human blood and 10% horse serum, and grown under microaerophilic
conditions at 37°C for 3 days. Multiple bacterial colonies were
harvested from agar plates and frozen in Brucella broth
containing 30% glycerine at
70°C. Subsequent analyses were performed on strains derived from the frozen stocks. All H. pylori isolates were positive for oxidase, catalase, and urease.
The strains were numbered, and all analyses were performed without prior knowledge of the clinical diagnosis. Moreover, each analysis was
performed by different investigators who were unaware of the other
results.
Preparation of samples for PCR amplification.
Genomic DNA
was initially isolated from H. pylori cultures by
phenol-chloroform-isoamylalcohol extraction and ethanol precipitation according to standard protocols. Identical PCR results were obtained when supernatants from bacterial suspensions in sterile water were
directly amplified. Therefore, further analyses were performed without
the DNA isolation step.
PCR amplification and detection of amplified DNA products.
For vacA, primers vac1F and vac1R were used to amplify the
signal sequence region (Table 1)
(1). Amplification fragments of 201 and 228 bp were expected
from genotype s1 and s2, respectively. The middle region of the
vacA gene was analyzed with primers vac3F and vac3R (for m1)
and vac4F and vac4R (for m2), which amplified 388-bp fragments for m1
and 346-bp fragments for m2.
For the amplification of cagA sequences, two primer sets
were used. The first primer set, cag1 and cag3, amplified a fragment of
612 to 615 bp from the hydrophilic region of cagA (Table 1) (4, 22). Primers cag2 and cag4 were derived from a region of
internal duplications (4) and amplified DNA with expected fragment lengths of 450 and 558 bp (4, 22).
PCR amplification was performed as previously described
(17), under the following conditions: initial denaturation
at 95°C for 3 min followed by 35 cycles of denaturation at 95°C for
50 s, annealing and extension for 160 s, and final extension
at 72°C for 2 min. Annealing temperatures were set at 55°C for
vac1F-vac1R, at 60°C for vac3F-vac3R and vac4F-vac4R, and at 50°C
for primers cag1-cag3 and cag2-cag4. Negative and positive controls
(DNA of strain H. pylori 60190) were assayed in each
run. Thirty microliters of each PCR mixture was subjected to gel
electrophoresis on 5% polyacrylamide gels. Aliquots of the PCR
products obtained with primers vac1F-vac1R and cag2-cag4 underwent
restriction endonuclease digestion with NlaIII (New England
Biolabs, Beverly, Mass.) for 2 h at 37°C prior to
electrophoresis.
The PCR products obtained from amplification with primers cag2 and cag4
were hybridized with the probe hyb1 (5' GATAAAGTTGATGATCTCAG 3'),
which identified the complete amplification product in undigested samples and fragments of 102 and 143 bp in NlaIII-treated
samples. Hybridization was performed as previously described
(17), except that hybridization and washing temperatures
were set at 56°C.
SDS-PAGE and Western blot analysis.
Gel electrophoresis and
Western blotting were performed as previously described
(19). In brief, supernatants of whole-cell sonicates,
containing 10 µg of protein, from each strain were separated by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).
After transfer to a nitrocellulose membrane, the membrane was blocked
with low-fat skim milk and fetal calf serum in phosphate-buffered saline and incubated with a 1:10,000 dilution of rabbit antisera to
VacA and to CagA (kindly provided by T. L. Cover, Nashville, Tenn., and by A. Covacci, Siena, Italy). Antiserum to VacA had been produced by immunizing rabbits with native VacA enriched in
supernatant preparations from H. pylori 60190 (6). Rabbit antiserum to CagA was derived from a recombinant
fusion protein obtained by subcloning a DNA fragment of cagA
into the expression vector pEx34b (28). The membrane was
incubated with alkaline phosphatase-conjugated goat anti-rabbit
immunoglobulin G antibody (dilution, 1:10,000) and then with enhanced
chemiluminescence detection reagents (Western Light Chemilumiscent
Detection System; Tropix, Bedford, Mass.) and exposed to highly
sensitive X-ray films for 30 min.
Cytotoxicity assay on HeLa cells.
HeLa cells were cultured
in plastic flasks containing Dulbecco's modified Eagle's medium with
25 mM HEPES buffer (pH 7.2), 5% fetal calf serum, and 2 mM glutamine
at 37°C in a 5% CO2 atmosphere. Cells were seeded in
12-well plates at a concentration of 105 cells per well.
H. pylori was cultured for 3 days at 37°C in 20%
brain heart infusion, 70% RPMI, and 10% fetal calf serum in a
gyratory water bath set under a microaerophilic atmosphere. Supernatants (final optical density at 550 nm, 0.6) were prepared by
centrifugation (16,000 × g at 4°C) and filtration
through a 0.2-µm-pore-size cellulose filter (12). The
culture supernatants were diluted 1:1 with medium and incubated with
HeLa cells for 24 h. Culture medium was supplemented with 10 mM
ammonium chloride to potentiate cytotoxin activity (9).
Vacuolation was assessed by light microscopy after staining with
neutral red (7). Cytotoxicity was defined as positive if
vacuolation was observed in more than 20% of cells.
Statistical methods.
Analysis of data was performed by using
the
2 test with Yates' correction and Fisher's exact
test. Probability levels (P) of <0.05 were considered
statistically significant.
 |
RESULTS |
Strain collection.
Sixty-five strains were isolated from
H. pylori-positive patients with dyspeptic symptoms.
Endoscopic and histological examination revealed gastritis in 43 patients, PUD in 19 patients (9 with gastric ulcers of the antrum and
10 with duodenal ulcers), and gastric adenocarcinoma in 3 patients. In
all patients with gastric ulcers, moderate to severe antral predominant
chronic gastritis was diagnosed histologically. Patients with duodenal
ulcers presented with duodenitis and, in some cases, with chronic
antral gastritis. In six patients, two isolates were obtained from the
antrum and the corpus. For each of these patients, both isolates showed
identical features by PCR, Southern blotting, and Western blot
analysis.
Determination of vacA genotypes and relationship
to gastrointestinal disease.
The vacA gene
was detectable in all H. pylori isolates. By using the
primers vac1F and vac1R to amplify the vacA signal
sequences, the predicted PCR products of either 201 or 228 bp were
obtained from 64 (98.5%) of 65 isolates. Fifty-four (83.1%) of 65 strains yielded the smaller product, representing genotype s1, and 10 (15.4%) yielded the larger product, representing genotype s2. None of
the strains yielded a PCR product of any other size. All amplicons from
genotype s1 but none of the amplicons from genotype s2 were cut by
NlaIII into fragments of a predicted size of 94 and 107 bp
(Fig. 1).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
PAGE after PCR amplification of H. pylori DNA using primers vac1F-vac1R and NlaIII
digestion. Only DNA amplicons obtained with vacA genotype s1
are cut by NlaIII into fragments of 107 and 94 bp. Lanes: M,
100-bp DNA marker; 1, strain H. pylori 60190 (vacA genotype s1); 2, Tx30a (vacA genotype s2);
3 to 8, type s1 isolates; 9 to 11, type s2 isolates. (The photographs
in this and subsequent figures were scanned with a Hewlett-Packard Scan
Jet 4c using the PaperPort Software Version 3.0.1 for Windows
[Visioneer Communications, Inc.])
|
|
All 65 H. pylori strains and the two reference strains
contained DNA which was amplified either by the primers vac3F and
vac3R, representing type m1, or by the primers vac4F and vac4R,
specific for type m2 (Fig. 2).
Twenty-four (36.9%) isolates were classified as type m1, and 41 (63.1%) were classified as type m2. None had DNA amplified by both
primer sets or gave PCR products of sizes other than those predicted.
Among the 65 isolates studied, vacA homologs containing
three of the four possible combinations of signal sequence and
middle-region types were identified. The s1-m1 and s1-m2 combinations
were found in 23 (35.4%) and 31 (47.7%) strains, respectively, and
the s2-m2 combination was identified in 10 (15.4%) of 65 isolates. The
s2-m1 combination was not detectable (P = 0.01).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
PAGE after PCR amplification of H. pylori DNA using primers vac3F-vac3R (a) and vac4F-vac4R (b).
Lanes: M, 100-bp DNA marker; 1 to 11, H. pylori strains
as described in the legend to Fig. 1.
|
|
Infection with a type s1 strain was found in all 19 (100%) patients
with PUD, compared with 32 (74.4%) of 43 subjects with gastritis
(P = 0.02). All type s2 strains were isolated from
patients with gastritis. The distribution of type s1-m1 and type s1-m2 strains was similar in patients with PUD (s1-m1, 8; s1-m2, 11) and
gastritis (s1-m1, 13; s1-m2, 19), indicating that the vacA middle region types were not independently associated with the occurrence of PUD.
Prevalence and size variation of the cagA gene in
H. pylori isolates.
Forty-eight (73.8%) of 65 strains were cagA+. In 47 of 48 isolates and in
reference strain H. pylori 60190, PCR products were obtained with both cagA primer sets (Fig.
3). One strain showed an amplicon only
with the primer set cag2-cag4 but not with the primer set cag1-cag3.
Sixteen (84.2%) of 19 strains isolated from patients with PUD but only
29 (67.4%) of 43 isolates obtained from patients with gastritis
carried the cagA gene (P = 0.17). All three
isolates from patients with gastric cancer were
cagA+.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
PAGE after PCR amplification of H. pylori DNA using primers cag1-cag3. Lanes: M, 100-bp DNA marker; 1 to 11, H. pylori strains as described in the legend to
Fig. 1.
|
|
The PCR products of cagA+ strains obtained with
primer set cag2-cag4 differed in size, varying from 450 bp in 8 isolates, including H. pylori 60190, to 552 to 558 bp
in 22 isolates and 654 to 660 bp in 16 isolates (Fig.
4). NlaIII digestion of the
450-bp product resulted in DNA fragments of 307 to 313 bp and 143 bp.
In addition, a fragment of 102 bp was obtained with PCR products of 552 to 558 bp and 654 to 660 bp after NlaIII digestion. Southern
blotting with the probe hyb1 identified all fragments of 143 and 102 bp, if present. cagA PCR fragments of 450 bp or 552 to 558 bp were found more frequently in H. pylori strains
isolated from patients with PUD (14 of 16 [87.5%]) than in those
from patients with only gastritis (15 of 29 [51.7%];
P = 0.012).

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
PAGE after PCR amplification of H. pylori DNA using primers cag2-cag4. Lanes: M, 100-bp DNA marker; 1 to 11, H. pylori strains as described in the legend to
Fig. 1. Note the size variation of DNA amplicons of different
H. pylori strains.
|
|
Relationship between vacA genotypes and presence of
cagA gene.
Forty-seven (87.0%) of 54 vacA
type s1 strains were cagA+ (P < 0.0001). Of the 48 cagA+ strains, 47 (97.9%)
were found to have the vacA genotype s1. The signal sequence
type could not be determined in one cagA+
strain. None of the 10 type s2 strains carried the cagA
gene. No association was found between vacA middle-region
type and cagA status.
Relationship between vacA genotype or cagA
gene and protein expression and cytotoxin activity.
By SDS-PAGE,
supernatants of whole-cell sonicates showed the CagA protein band,
varying between 120 and 140 kDa, which was recognized by immunoblotting
with CagA antiserum in 35 (85.4%) of 41 cagA+
H. pylori strains. In cagA mutant strains,
only 1 (5.9%) of 17 isolates was positive by immunoblotting
(P < 0.0001). VacA protein was detected by VacA
antiserum in 44 (75.9%) of 58 H. pylori isolates. Forty-one (87.2%) of 47 strains with the genotype s1 were detected by
VacA antiserum. In contrast, only 3 (30%) of 10 strains with vacA type s2 showed a weak protein band by Western blotting
(P < 0.0001).
Of the 58 H. pylori strains tested, supernatants from
34 (58.6%) induced vacuolation of HeLa cells (Tox+).
Seventeen (81.0%) of 21 strains with the vacA genotype
s1-m1 and 16 (61.9%) of 26 strains with s1-m2 genotype were
Tox+. In contrast, only 1 (10%) of 10 strains with the
genotype s2-m2 induced a weak vacuolation in HeLa cells. Thus, strains
possessing the vacA type s1 (33 of 47 [70.2%]) were more
frequently associated with vacuolating cytotoxicity than s2 type
strains (P = 0.001). Although H. pylori
strains isolated from patients with PUD were more likely to be
Tox+ (13 of 17 [76.5%]) than those obtained from
patients with gastritis only (21 of 37 [56.8%]), the differences
were not significant (P = 0.16). Twenty-seven (67.5%)
of 40 cagA+ strains and 8 (47.1%) of 17 cagA-negative strains induced vacuolation in HeLa cells
(P = 0.147), demonstrating that cagA is not
associated with cytotoxin activity.
 |
DISCUSSION |
In this study, new oligonucleotide primers were established to
characterize the vacA genotypes in a consecutive series of isolated H. pylori strains. Using these primers, the
vacA genotypes s1 and s2 were identified in all but one of
the H. pylori strains. In addition, restriction
endonuclease digestion with NlaIII allowed definitive
differentiation of genotypes s1 and s2 by cutting only the PCR product
of type s1. For determination of the vacA middle-region genotypes, the published oligonucleotide primers vac3R and vac4F were modified, because computer-assisted alignment of the various vacA sequences of European H. pylori strains
deposited in the GenBank database revealed single base exchanges at the
locations of the original primers (1). Therefore, primer
sequences with complete identity next to these locations were selected.
By using these primers for PCR, reliable classification of the
vacA middle-region genotype was possible in all
H. pylori strains. In contrast, use of the originally
described primers (1) allowed characterization of
middle-region types in only 70% of the H. pylori
strains isolated from German patients (18a). This suggests
that the mosaicism of the vacA gene described for
H. pylori strains from the United States is also found
in German H. pylori isolates. However, regional variation in the vacA gene may occur due to the enormous
heterogeneity of H. pylori, which would thus require
modification of the oligonucleotide primers to characterize the
vacA alleles in European H. pylori strains.
H. pylori strains with the vacA signal
sequence type s1 were predominant in the series of German H. pylori isolates, whereas strains with type s2 rarely occurred.
However, the percentage of strains with the vacA genotype s2
may have been underestimated, since the strains investigated in this
study were obtained from dyspeptic patients. Cytotoxic H. pylori strains with vacA genotype s1 may occur more
frequently in such patients. vacA genotype s1 was
strongly associated with the presence of cagA and was more frequent in patients with PUD (1, 2). The difference between vacA type s2 and type s1 leader sequences is generated by
small inserts totaling 27 bp (1). It has been hypothesized
that strains with vacA genotype s2 lack effective secretion
of VacA through the cytoplasmic membrane of the bacteria (1,
20). Alternatively, differences in the N-terminal residues of the
secreted VacA protein, arising from different signal sequence cleavage
sites in VacA for type s1 and type s2, may be responsible for
differences in protein function (1). In contrast to strains
with vacA type s1, type s2 isolates express the VacA protein
only in small amounts (1). This explains why almost all
isolates with the vacA type s1 but only 3 of 10 type s2
strains had VacA detectable by immunoblot. Furthermore, cytotoxin
activity was observed almost exclusively in type s1 strains. Only one
type s2 strain showed weak vacuolation of HeLa cells. However, some
strains with genotype s1 and lower cytotoxin activity may not have been
identified because of the use of nonconcentrated broth culture
supernatants for vacuolation testing (12).
Subgroup analysis demonstrated that the vacA middle-region
type was not independently associated with the clinical outcome of
H. pylori infection, the presence of cagA,
or detectable cytotoxin activity. Almost half of the strains contained
the combination s1-m2, a finding which is different from the results
found in the United States (1), where the genotypes s1-m1
and s2-m2 are more common. The vacA genotype s2-m1 was not
found, suggesting that strains with this genotype suffer from a
selective disadvantage or are not viable.
About 74% of all isolates were cagA+ by PCR,
which is in agreement with the results of other studies from Europe
(10, 26, 28, 29). The majority of the patients with PUD
(84%) were infected with cagA+ strains in
contrast to strains isolated from patients with gastritis only,
in whom 67% of the H. pylori strains were
cagA+ (11, 26, 28). By PCR, size
variations of the cagA gene were found within the various
H. pylori strains. This may account for the size
heterogeneity of CagA detected by immunoblot in recent studies (4,
26, 29). Restriction endonuclease analysis and Southern blotting
suggested that these size variations may have been generated by a
variable number of internal repeat units located downstream of
nucleotide 3406 of the gene (4). Unexpectedly, the fragment
length of this region of cagA after PCR was found to be
shorter in strains isolated from patients with PUD than in those from
patients with gastritis alone. It is unclear whether these differences
in the cagA gene actually effect the clinical outcome of
H. pylori infection or whether these results are
incidental. The exact role of the cagA gene, which codes for
the highly immunogenic CagA protein, is not known. The cagA
gene represents a putative virulence marker and is included in the
cag pathogenicity island, a 40-kb segment with several
genes, including picA and picB, involved in
cytokine induction (3, 24). It is conceivable that size variation of CagA could affect its antigenic properties and thereby alter the host's immune system's ability to recognize the antigen.
The presence of the cagA gene was correlated with the
expression of CagA protein as determined by immunoblotting
(29). However, cagA was not associated with
cytotoxicity in HeLa cells and only 68% of
cagA+ strains were cytotoxin positive. These
results are consistent with other reports that cytotoxin production is
derived from the vacA gene but not from the cagA
gene (23, 26).
In conclusion, the vacA genotypes in German H. pylori strains were identical to those previously reported and
could be characterized by PCR after modification of the reported
oligonucleotide primers. H. pylori strains with the
vacA signal sequence type s1 and middle-region allele m2
were predominant in German H. pylori isolates. All
combinations of these vacA alleles occurred, with the
exception of s2-m1. Type s1 strains were associated with peptic
ulceration, presence of the cagA gene, VacA expression, and
cytotoxin activity. Size variations in a distinct region of
cagA are common, but their significance for clinical outcome
needs further evaluation. The findings suggest that
cagA+ H. pylori strains with the
vacA genotype s1 increase the risk for PUD. Thus,
vacA genotyping may allow identification of infected subjects at different risk levels.
 |
ACKNOWLEDGMENTS |
We thank J. Mohr for her excellent technical help and I. Zuna for
performing the statistical analysis.
This study was supported by ASTRA GmbH, Wedel, Germany.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine, Division of Gastroenterology, University of Heidelberg,
Bergheimerstr. 58, 69115 Heidelberg, Germany. Phone: 49 6221-568611. Fax: 49 6221-565255. E-mail:
jochen_rudi{at}krzmail.krz.uni-heidelberg.de
 |
REFERENCES |
| 1.
|
Atherton, J. C.,
P. Cao,
R. M. Peek,
M. K. R. Tummuru,
M. J. Blaser, and T. L. Cover.
1995.
Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori.
J. Biol. Chem.
270:17771-17777[Abstract/Free Full Text].
|
| 2.
|
Atherton, J. C.,
R. M. Peek,
K. T. Tham,
T. L. Cover, and M. J. Blaser.
1997.
Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori.
Gastroenterology
112:92-99[Medline].
|
| 3.
|
Censini, S.,
C. Lange,
Z. Xiang,
J. E. Crabtree,
P. Ghiara,
M. Borodovsky,
R. Rappuoli, and A. Covacci.
1996.
cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors.
Proc. Natl. Acad. Sci. USA
93:14648-14653[Abstract/Free Full Text].
|
| 4.
|
Covacci, A.,
S. Censini,
M. Bugnoli,
R. Petracca,
D. Burroni,
G. Macchia,
A. Massone,
E. Papini,
Z. Xiang,
N. Figura, and R. I. Rappuoli.
1993.
Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer.
Proc. Natl. Acad. Sci. USA
90:5791-5795[Abstract/Free Full Text].
|
| 5.
|
Cover, T. L.,
P. Cao,
C. D. Lind,
K. T. Tham, and M. J. Blaser.
1993.
Correlation between vacuolating cytotoxin production by Helicobacter pylori isolates in vitro and in vivo.
Infect. Immun.
61:5008-5012[Abstract/Free Full Text].
|
| 6.
|
Cover, T. L.,
C. P. Dooley, and M. J. Blaser.
1990.
Characterization of and human serologic response to proteins in Helicobacter pylori broth culture supernatants with vacuolizing cytotoxin activity.
Infect. Immun.
58:603-610[Abstract/Free Full Text].
|
| 7.
|
Cover, T. L.,
W. Puryear,
G. I. Perez-Perez, and M. J. Blaser.
1991.
Effect of urease on HeLa cell vacuolation induced by Helicobacter pylori cytotoxin.
Infect. Immun.
59:1264-1270[Abstract/Free Full Text].
|
| 8.
|
Cover, T. L.,
M. K. R. Tummuru,
P. Cao,
S. A. Thompson, and M. J. Blaser.
1994.
Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains.
J. Biol. Chem.
269:10566-10573[Abstract/Free Full Text].
|
| 9.
|
Cover, T. L.,
S. G. Vaughn,
P. Cao, and M. J. Blaser.
1992.
Potentiation of Helicobacter pylori vacuolating cytotoxin activity by nicotine and other weak bases.
J. Infect. Dis.
166:1073-1078[Medline].
|
| 10.
|
Crabtree, J. E.,
N. Figura,
J. D. Taylor,
M. Bugnoli,
D. Armellini, and D. S. Tompkins.
1992.
Expression of 120 kilodalton protein and cytotoxicity in Helicobacter pylori.
J. Clin. Pathol.
45:733-734[Abstract/Free Full Text].
|
| 11.
|
Crabtree, J. E.,
J. D. Taylor,
J. I. Wyatt,
R. V. Heatley,
T. M. Shallcross,
D. S. Tompkins, and B. J. Rathbone.
1991.
Mucosal IgA recognition of Helicobacter pylori 120 kDa protein, peptic ulceration and gastric pathology.
Lancet
59:1264-1270.
|
| 12.
|
Figura, N.,
P. Guglielmetti,
A. Rossolini,
A. Barberi,
G. Cusi,
R. A. Musmanno,
M. Russi, and S. Quaranta.
1989.
Cytotoxin production by Campylobacter pylori strains isolated from patients with peptic ulcers and from patients with chronic gastritis only.
J. Clin. Microbiol.
27:225-226[Abstract/Free Full Text].
|
| 13.
|
Goosens, H.,
Y. Glupczynski,
A. Burette,
J.-P. Lambert,
L. Vlaes, and J.-P. Butzler.
1992.
Role of the vacuolating toxin from Helicobacter pylori in the pathogenesis of duodenal and gastric ulcer.
Med. Microbiol. Lett.
1:153-159.
|
| 14.
|
Harris, R. P.,
T. L. Cover,
D. R. Crowe,
J. M. Orenstein,
M. F. Graham,
M. J. Blaser, and P. D. Smith.
1996.
Helicobacter pylori cytotoxin induces vacuolation of primary human mucosal epithelial cells.
Infect. Immun.
64:4867-4871[Abstract].
|
| 15.
|
Hentschel, I.,
G. Brandstätter,
B. Dragosics,
A. M. Hirschl,
H. Nemec,
K. Schütze,
M. Taufer, and H. Wurzer.
1993.
Effect of ranitidine and amoxicillin plus metronidazole on the eradication of Helicobacter pylori in the pathogenensis of duodenal and gastric ulcer.
N. Engl. J. Med.
328:308-312[Abstract/Free Full Text].
|
| 16.
|
Leunk, R. D.,
P. T. Johnson,
B. C. David,
W. G. Kraft, and D. R. Morgan.
1988.
Cytotoxic activity in broth-culture filtrates of Campylobacter pylori.
J. Med. Microbiol.
26:93-99[Abstract].
|
| 17.
|
Maiwald, M.,
H.-J. Ditton,
H.-G. Sonntag, and M. von Knebel Doeberitz.
1994.
Characterization of contaminating DNA in Taq polymerase which occurs during amplification with a primer set for Legionella 5S ribosomal RNA.
Mol. Cell. Probes
8:11-14[Medline].
|
| 18.
|
Parsonnet, J.,
G. D. Friedman,
D. P. Vandersteen,
Y. Chang,
J. H. Vogelman,
N. Orenteich, and R. K. Sibley.
1991.
Helicobacter pylori infection and the risk of gastric carcinoma.
N. Engl. J. Med.
325:1127-1231[Abstract].
|
| 18a.
| Rudi, J. Unpublished observation.
|
| 19.
|
Rudi, J.,
C. Kolb,
M. Maiwald,
I. Zuna,
P. R. Galle, and W. Stremmel.
1997.
Serum antibodies against the Helicobacter pylori proteins CagA and VacA are associated with an increased risk for gastric adenocarcinoma.
Dig. Dis. Sci.
42:1652-1659[Medline].
|
| 20.
|
Schmitt, W., and R. Haas.
1994.
Genetic analysis of the Helicobacter pylori vacuolating cytotoxin: structural similarities with the IgA protease type of exported protein.
Mol. Microbiol.
12:307-319[Medline].
|
| 21.
|
Taylor, D. N., and M. J. Blaser.
1991.
The epidemiology of Helicobacter pylori infection.
Epidemiol. Rev.
13:42-59[Free Full Text].
|
| 22.
|
Tummuru, M. K. R.,
T. L. Cover, and M. J. Blaser.
1993.
Cloning and expression of a high-molecular-mass major antigen of Helicobacter pylori: evidence of linkage to cytotoxin production.
Infect. Immun.
61:1799-1809[Abstract/Free Full Text].
|
| 23.
|
Tummuru, M. K. R.,
T. L. Cover, and M. J. Blaser.
1994.
Mutation of the cytotoxin-associated cagA gene does not affect the vacuolating cytotoxin activity of Helicobacter pylori.
Infect. Immun.
62:2609-2613[Abstract/Free Full Text].
|
| 24.
|
Tummuru, M. K.,
S. A. Sharma, and M. J. Blaser.
1995.
Helicobacter pylori picB, a homologue of the Bordetella pertussis toxin secretion protein, is required for induction of IL-8 in gastric epithelial cells.
Mol. Microbiol.
18:867-876[Medline].
|
| 25.
|
Warren, J. R., and B. J. Marshall.
1983.
Unidentified curved bacilli on gastric epithelium in active chronic gastritis.
Lancet
i:1273-1274.
|
| 26.
|
Weel, J. F. L.,
R. W. M. van der Hulst,
Y. Gerrits,
P. Roorde,
M. Feller,
J. Dankert,
G. N. J. Tytgat, and A. van der Ende.
1996.
The interrelationship between cytotoxin-associated gene A, vacuolating cytotoxin, and Helicobacter pylori-related diseases.
J. Infect. Dis.
173:1171-1175[Medline].
|
| 27.
|
Wotherspoon, A. C.,
C. Ortiz-Hidalgo,
M. R. Falzon, and P. G. Isaacson.
1991.
Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma.
Lancet
338:1175-1176[Medline].
|
| 28.
|
Xiang, Z.,
M. Bugnoli,
A. Ponzetto,
A. Morgando,
N. Figura,
A. Covacci,
R. Petracca,
C. Pennatini,
S. Censini,
D. Armellini, and R. Rappuoli.
1993.
Detection in an enzyme immunoassay of an immune response to a recombinant fragment of the 128-kilodalton protein (CagA) of Helicobacter pylori.
Eur. J. Clin. Microbiol. Infect. Dis.
12:739-745[Medline].
|
| 29.
|
Xiang, Z.,
S. Censini,
P. F. Bayelli,
J. L. Telford,
N. Figura,
R. Rappuoli, and A. Covacci.
1995.
Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not necessary for expression of the vacuolating cytotoxin.
Infect. Immun.
63:94-98[Abstract].
|
Journal of Clinical Microbiology, April 1998, p. 944-948, Vol. 36, No. 4
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Argent, R. H., Hale, J. L., El-Omar, E. M., Atherton, J. C.
(2008). Differences in Helicobacter pylori CagA tyrosine phosphorylation motif patterns between western and East Asian strains, and influences on interleukin-8 secretion. J Med Microbiol
57: 1062-1067
[Abstract]
[Full Text]
-
Hussein, N. R., Mohammadi, M., Talebkhan, Y., Doraghi, M., Letley, D. P., Muhammad, M. K., Argent, R. H., Atherton, J. C.
(2008). Differences in Virulence Markers between Helicobacter pylori Strains from Iraq and Those from Iran: Potential Importance of Regional Differences in H. pylori-Associated Disease. J. Clin. Microbiol.
46: 1774-1779
[Abstract]
[Full Text]
-
Emilia, G., Luppi, M., Zucchini, P., Morselli, M., Potenza, L., Forghieri, F., Volzone, F., Jovic, G., Leonardi, G., Donelli, A., Torelli, G.
(2007). Helicobacter pylori infection and chronic immune thrombocytopenic purpura: long-term results of bacterium eradication and association with bacterium virulence profiles. Blood
110: 3833-3841
[Abstract]
[Full Text]
-
Wen, S., Velin, D., Felley, C. P., Du, L., Michetti, P., Pan-Hammarstrom, Q.
(2007). Expression of Helicobacter pylori Virulence Factors and Associated Expression Profiles of Inflammatory Genes in the Human Gastric Mucosa. Infect. Immun.
75: 5118-5126
[Abstract]
[Full Text]
-
Reyes-Leon, A., Atherton, J. C., Argent, R. H., Puente, J. L., Torres, J.
(2007). Heterogeneity in the Activity of Mexican Helicobacter pylori Strains in Gastric Epithelial Cells and Its Association with Diversity in the cagA Gene. Infect. Immun.
75: 3445-3454
[Abstract]
[Full Text]
-
Kim, J. M., Kim, J. S., Lee, J. Y., Kim, Y.-J., Youn, H.-J., Kim, I. Y., Chee, Y. J., Oh, Y.-K., Kim, N., Jung, H. C., Song, I. S.
(2007). Vacuolating Cytotoxin in Helicobacter pylori Water-Soluble Proteins Upregulates Chemokine Expression in Human Eosinophils via Ca2+ Influx, Mitochondrial Reactive Oxygen Intermediates, and NF-{kappa}B Activation. Infect. Immun.
75: 3373-3381
[Abstract]
[Full Text]
-
Panayotopoulou, E. G., Sgouras, D. N., Papadakos, K., Kalliaropoulos, A., Papatheodoridis, G., Mentis, A. F., Archimandritis, A. J.
(2007). Strategy To Characterize the Number and Type of Repeating EPIYA Phosphorylation Motifs in the Carboxyl Terminus of CagA Protein in Helicobacter pylori Clinical Isolates. J. Clin. Microbiol.
45: 488-495
[Abstract]
[Full Text]
-
Mattar, R., Marques, S. B., Monteiro, M. d. S., dos Santos, A. F., Iriya, K., Carrilho, F. J.
(2007). Helicobacter pylori cag pathogenicity island genes: clinical relevance for peptic ulcer disease development in Brazil. J Med Microbiol
56: 9-14
[Abstract]
[Full Text]
-
Zhang, Y., Argent, R. H., Letley, D. P., Thomas, R. J., Atherton, J. C.
(2005). Tyrosine Phosphorylation of CagA from Chinese Helicobacter pylori Isolates in AGS Gastric Epithelial Cells. J. Clin. Microbiol.
43: 786-790
[Abstract]
[Full Text]
-
Argent, R. H., Zhang, Y., Atherton, J. C.
(2005). Simple Method for Determination of the Number of Helicobacter pylori CagA Variable-Region EPIYA Tyrosine Phosphorylation Motifs by PCR. J. Clin. Microbiol.
43: 791-795
[Abstract]
[Full Text]
-
Henderson, I. R., Navarro-Garcia, F., Desvaux, M., Fernandez, R. C., Ala'Aldeen, D.
(2004). Type V Protein Secretion Pathway: the Autotransporter Story. Microbiol. Mol. Biol. Rev.
68: 692-744
[Abstract]
[Full Text]
-
Saribasak, H., Salih, B. A., Yamaoka, Y., Sander, E.
(2004). Analysis of Helicobacter pylori Genotypes and Correlation with Clinical Outcome in Turkey. J. Clin. Microbiol.
42: 1648-1651
[Abstract]
[Full Text]
-
Zhou, J., Zhang, J., Xu, C., He, L.
(2004). cagA genotype and variants in Chinese Helicobacter pylori strains and relationship to gastroduodenal diseases. J Med Microbiol
53: 231-235
[Abstract]
[Full Text]
-
Willhite, D. C., Cover, T. L., Blanke, S. R.
(2003). Cellular Vacuolation and Mitochondrial Cytochrome c Release Are Independent Outcomes of Helicobacter pylori Vacuolating Cytotoxin Activity That Are Each Dependent on Membrane Channel Formation. J. Biol. Chem.
278: 48204-48209
[Abstract]
[Full Text]
-
Letley, D. P., Rhead, J. L., Twells, R. J., Dove, B., Atherton, J. C.
(2003). Determinants of Non-toxicity in the Gastric Pathogen Helicobacter pylori. J. Biol. Chem.
278: 26734-26741
[Abstract]
[Full Text]
-
Marchildon, P. A., Sugiyama, T., Fukada, Y., Peacock, J. S., Asaka, M., Shimoyama, T., Graham, D. Y.
(2003). Evaluation of the Effects of Strain-Specific Antigen Variation on the Accuracy of Serologic Diagnosis of Helicobacter pylori Infection. J. Clin. Microbiol.
41: 1480-1485
[Abstract]
[Full Text]
-
Cao, P., Cover, T. L.
(2002). Two Different Families of hopQ Alleles in Helicobacter pylori. J. Clin. Microbiol.
40: 4504-4511
[Abstract]
[Full Text]
-
FIGUEROA, G., TRONCOSO, M., TOLEDO, M.S., FAUNDEZ, G., ACUNA, R.
(2002). Prevalence of serum antibodies to Helicobacter pylori VacA and CagA and gastric diseases in Chile. J Med Microbiol
51: 300-304
[Abstract]
[Full Text]
-
McClain, M. S., Cao, P., Iwamoto, H., Vinion-Dubiel, A. D., Szabo, G., Shao, Z., Cover, T. L.
(2001). A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation. J. Bacteriol.
183: 6499-6508
[Abstract]
[Full Text]
-
Ishii, E., Yokota, K., Sugiyama, T., Fujinaga, Y., Ayada, K., Hokari, I., Hayashi, S., Hirai, Y., Asaka, M., Oguma, K.
(2001). Immunoglobulin G1 Antibody Response to Helicobacter pylori Heat Shock Protein 60 Is Closely Associated with Low-Grade Gastric Mucosa-Associated Lymphoid Tissue Lymphoma. CVI
8: 1056-1059
[Abstract]
[Full Text]
-
Vinion-Dubiel, A. D., McClain, M. S., Cao, P., Mernaugh, R. L., Cover, T. L.
(2001). Antigenic Diversity among Helicobacter pylori Vacuolating Toxins. Infect. Immun.
69: 4329-4336
[Abstract]
[Full Text]
-
Kidd, M, Lastovica, A J, Atherton, J C, Louw, J A
(2001). Conservation of the cag pathogenicity island is associated with vacA alleles and gastroduodenal disease in South African Helicobacter pylori isolates. Gut
49: 11-17
[Abstract]
[Full Text]
-
Suda, Y., Kim, Y.-M., Ogawa, T., Yasui, N., Hasegawa, Y., Kashihara, W., Shimoyama, T., Aoyama, K., Nagata, K., Tamura, T., Kusumoto, S.
(2001). Chemical structure and biological activity of a lipid A component from Helicobacter pylori strain 206. Innate Immunity
7: 95-104
[Abstract]
-
Rota, C. A., Pereira-Lima, J. C., Blaya, C., Nardi, N. B.
(2001). Consensus and Variable Region PCR Analysis of Helicobacter pylori 3' Region of cagA Gene in Isolates from Individuals with or without Peptic Ulcer. J. Clin. Microbiol.
39: 606-612
[Abstract]
[Full Text]
-
Enroth, H., Kraaz, W., Engstrand, L., Nyrén, O., Rohan, T.
(2000). Helicobacter pylori Strain Types and Risk of Gastric Cancer: A Case-Control Study. Cancer Epidemiol. Biomarkers Prev.
9: 981-985
[Abstract]
[Full Text]
-
Vaucher, C., Janvier, B., Nousbaum, J.-B., Grignon, B., Pezennec, L., Robaszkiewicz, M., Gouerou, H., Picard, B., Fauchere, J.-L.
(2000). Antibody Response of Patients with Helicobacter pylori-Related Gastric Adenocarcinoma: Significance of Anti-CagA Antibodies. CVI
7: 463-467
[Abstract]
[Full Text]
-
BLASER, M J
(1999). Allelic variation in Helicobacter pylori: progress but no panacea. Gut
45: 477-478
[Full Text]
-
Kidd, M, Lastovica, A J, Atherton, J C, Louw, J A
(1999). Heterogeneity in the Helicobacter pylori vacA and cagA genes: association with gastroduodenal disease in South Africa?. Gut
45: 499-502
[Abstract]
[Full Text]
-
Atherton, J. C., Cover, T. L., Twells, R. J., Morales, M. R., Hawkey, C. J., Blaser, M. J.
(1999). Simple and Accurate PCR-Based System for Typing Vacuolating Cytotoxin Alleles of Helicobacter pylori. J. Clin. Microbiol.
37: 2979-2982
[Abstract]
[Full Text]
-
Domingo, D., Alarcón, T., Prieto, N., Sánchez, I., López-Brea;, M., Rudi, J., Stremmel, W.
(1999). cagA and vacA Status of Spanish Helicobacter pylori Clinical Isolates. J. Clin. Microbiol.
37: 2113-2114
[Full Text]
-
Donati, M., Storni, E., D'Apote, L., Moreno, S., Tucci, A., Poli, L., Cevenini, R.
(1999). PCR-Based Restriction Pattern Typing of the vacA Gene Provides Evidence for a Homogeneous Group among Helicobacter pylori Strains Associated with Peptic Ulcer Disease. J. Clin. Microbiol.
37: 912-915
[Abstract]
[Full Text]
-
Evans, D. G., Queiroz, D. M. M., Mendes, E. N., Evans, D. J. Jr.
(1998). Helicobacter pylori cagA Status and s and m Alleles of vacA in Isolates from Individuals with a Variety of H. pylori-Associated Gastric Diseases. J. Clin. Microbiol.
36: 3435-3437
[Abstract]
[Full Text]