Previous Article | Next Article 
Journal of Clinical Microbiology, August 1998, p. 2333-2335, Vol. 36, No. 8
Department of Medical Microbiology,
Received 6 February 1998/Returned for modification 24 March
1998/Accepted 12 May 1998
The methyl- Enterococci have been shown to be
the second most common cause of nosocomial infection in the United
States (15). Enterococcus faecalis is responsible
for the majority of enterococcal infections, whereas E. faecium, while responsible for significantly fewer infections, is more commonly associated with resistance to
beta-lactams, fluoroquinones, and glycopeptides (9, 10) and
is associated with greater morbidity and mortality (7). As
the prevalence of infections caused by vancomycin-resistant enterococci
(VRE) is presently low, the screening of stool for identification of colonizers in high-risk patients is the focus of several
epidemiological studies (10, 13). It is critical in such
screening studies to differentiate E. faecalis and
E. faecium from other enterococcal species, such as
E. gallinarum and E. casseliflavus,
which do not normally cause human disease but commonly demonstrate
intrinsic low-level glycopeptide resistance (1). Recent
reports suggest that motility alone as the criterion for
differentiating between E. gallinarum and E. faecium (3) is inadequate and may lead to the
misidentification of isolates of nonmotile E. gallinarum as E. faecium (5).
Recently, Devriese and coworkers have shown the
methyl- Frozen stock cultures of 33 vancomycin-resistant E. faecium isolates (MIC, 4 µg/ml) obtained in the VRE prevalence
study were subcultured onto Trypticase soy-5% sheep blood agar and
incubated at 37°C for 24 h for MDG testing and PCR lysate
preparation. MDG testing of all VRE isolates was performed as
previously described by Devriese et al. (4).
Enterococcal species identification of each isolate was confirmed
by sequencing the V6-to-V8 region (12) of the 16S rDNA which corresponds to bp 929 to 1369 of the Escherichia
coli 16S rRNA sequence (2). The following ATCC strains
were chosen for sequence determination: E. faecalis
ATCC 29212, E. faecium ATCC 35667, E. gallinarum ATCC 35038, and E. casseliflavus
ATCC 12755. Thirty-two enterococcal isolates from the stool
surveillance project had also been sequenced to confirm the specificity
and consistency of all sequences: 9 E. faecium
isolates, 10 E. faecalis isolates, 5 E. casseliflavus isolates, and 8 E. gallinarum
isolates. Subsequently, sequencing of the V6-V8 region of the 16S rDNAs
of all 33 VRE isolates tested for MDG was performed. DNA extracts were
prepared by using one or two colonies from the 24-h subcultures. DNA
was isolated by using the QIAamp tissue kit (Qiagen, Santa Clarita, Calif.) in accordance with the manufacturer's protocol. PCR
amplification was performed by using universal 16S rDNA gene primers
91E(G) (5'TCAAAGGAATTGACGGGGGC) and 13B
(5'AGGCCCGGGAACGTATTCAC) (14). A 50-µl PCR
mixture contained 5 µl of DNA template; 5 µl of 25 mM
MgCl2-10× PCR buffer; 1.25 mM each dCTP, dGTP, dATP, and
dUTP · dTTP in an 8:1 ratio; 0.5 µl of 100 mM each primer; 0.5 U of uracil DNA glycosylase (GibcoBRL, Burlington, Canada); 2.5 U of Taq DNA polymerase (Pharmacia Biotech, Baie d'Urfé,
Canada); and 30 µl of sterile distilled H2O. The PCR was
performed with a Perkin-Elmer GeneAmp PCR System 9600 with cycles of
37°C for 10 min and 95°C for 10 min and 30 cycles of 95, 55, and
72°C for 1 min each and incubated at 72°C for 10 min for final
extension.
Sequencing reactions were performed with the ABI PRISM Dye Terminator
Cycle Sequencing Ready Reaction kit (PE Applied Biosystems, Foster City, Calif.). The primer used for the sequencing reaction was
91E(G) or 13B diluted 1:100 in Tris-EDTA buffer. Cycle sequencing on
the GeneAmp PCR System 9600 was performed, and sequencing analysis was
performed with the PE-ABI 373 DNA sequencing system and Software 373 in
accordance with the manufacturers' instructions.
The results obtained by MDG testing for all 33 VRE isolates
demonstrated that 22 isolates were MDG negative, showing concordance with prior motility-based E. faecium identification.
However, 11 VRE isolates tested MDG positive, indicating that they were in fact not E. faecium as originally reported
but, instead, nonmotile E. gallinarum (Table 1). These
11 strains all possessed low-level glycopeptide resistance,
with vancomycin and teicoplanin MICs of 4 to 8 µg/ml and
0.25 to 0.5 µg/ml, respectively.
The MDG results were confirmed by sequencing the 16S rDNA
V6-to-V8 regions. E. faecalis and E. faecium each showed specific and consistent sequence
variability. E. gallinarum and E. casseliflavus showed a 2-bp difference from E. faecium and a 10-bp difference from E. faecalis
but could not be differentiated from each other by using this area of
the 16S rDNA gene (Fig. 1). Therefore,
sequencing served to differentiate E. faecium from
E. gallinarum and E. casseliflavus. Sequencing of the 33 VRE isolates which had previously all been identified as E. faecium confirmed that 22 isolates
were E. faecium and 11 were nonmotile E. gallinarum (Table 1). E. gallinarum was
differentiated from E. casseliflavus by its lack of
pigment. There have been reported cases of nonpigmented E. casseliflavus (16); however, from a clinical point of
view, this is not significant.
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Screening of Stool Samples for Identification of
Vancomycin-Resistant Enterococcus Isolates Should Include
the Methyl-
-DGlucopyranoside Test To Differentiate
Nonmotile Enterococcus gallinarum from E. faecium
ABSTRACT
Top
Abstract
Text
References
-D-glucopyranoside (MDG) test has been
shown to be superior to motility testing in differentiating
Enterococcus faecium from E. gallinarum. In the
present study, 33 vancomycin-resistant enterococcus (VRE) isolates
collected as part of a stool surveillance study were compared by using
motility and MDG. Motility testing identified all 33 isolates as
E. faecium, whereas MDG identified 11 of the 33 isolates
as nonmotile E. gallinarum. The MDG
results were confirmed by sequencing the 16S rDNA V6-to-V8 region.
We conclude that the MDG test is a necessary component of
routine VRE screening.
TEXT
Top
Abstract
Text
References
-D-glycopyranoside (MDG) test to be reliable and
accurate in differentiating E. casseliflavus and
E. gallinarum from E. faecalis and
E. faecium (4). We were interested in
determining the impact of the MDG test using a collection of
vancomycin-resistant E. faecium isolates taken from a
recent stool surveillance project (10) in which 1,500 enterococcal isolates had been identified to species level with a
conventional identification algorithm, not containing MDG (8). The susceptibilities to glycopeptides vancomycin and
teicoplanin and the glycopeptide resistance genotypes were also
determined (6, 11).
TABLE 1.
Comparison of MDG testing and species identification
using sequencing with conventional testing of 33 VRE (E. faecium) isolates
View larger version (13K):
[in a new window]
FIG. 1.
Sequence variability in the V7-V8 region of the 16S rDNA
gene (bp 1130 to 1330) among E. faecalis (Efa),
E. faecium (Efe), E. gallinarum (Ega),
and E. casseliflavus (Eca).
The clinical significance of this work is apparent, as misidentification of vancomycin-resistant E. gallinarum as vancomycin-resistant E. faecium causes great concern. The prevalence of nonmotile E. gallinarum may be even higher due to the fact that vancomycin-sensitive nonmotile E. gallinarum can also be misidentified as vancomycin-sensitive E. faecium, although this is not a great concern.
Sequencing, which provided us with definitive identification of Enterococcus species, is not a realistic approach for routine VRE screening. Yet, it can serve as a tool for definitive identification of important pathogens or of strains of questionable identity. We conclude that the MDG test is a reliable, rapid, and cost-effective method for identification of clinically relevant Enterococcus species and that it is a necessary component for routine VRE screening.
Nucleotide sequence accession numbers. The determined sequences comprising the V6-to-V8 regions of the 16S rDNA gene for each Enterococcus species used in this study have been submitted to GenBank with the following accession numbers: E. faecalis, AF023101; E. faecium, AF023102; E. gallinarum, AF023103; E. casseliflavus, AF023104.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Clinical Microbiology, Health Sciences Centre, MS6-820 Sherbrook St., Winnipeg, Manitoba R3A 1R9, Canada. Phone: (204) 787-4696. Fax: (204) 787-4699. E-mail: umturen0{at}cc.UManitoba.ca.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Arthur, M., and P. Courvalin.
1993.
Genetics and mechanisms of glycopeptide resistance in enterococci.
Antimicrob. Agents Chemother.
37:1563-1571 |
| 2. |
Brosius, J.,
M. L. Palmer,
P. J. Kennedy, and H. F. Noller.
1978.
Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli.
Proc. Natl. Acad. Sci. USA
75:4801-4805 |
| 3. | Cartwright, C. P., F. Stock, G. A. Fahle, and V. J. Gill. 1995. Comparison of pigment production and motility tests with PCR for reliable identification of intrinsically vancomycin-resistant enterococci. J. Clin. Microbiol. 33:1931-1933[Abstract]. |
| 4. |
Devriese, L. A.,
B. Pot,
K. Karsters,
S. Lauwers, and F. Haesebrouck.
1996.
Acidification of methyl--D-glycopyranoside: a useful test to differentiate Enterococcus casseliflavus and Enterococcus gallinarum from Enterococcus faecium and Enterococcus faecalis.
J. Clin. Microbiol.
34:2607-2608[Abstract].
|
| 5. | Donabedian, S., J. W. Chow, D. M. Shlaes, M. Green, and M. Zervos. 1995. DNA hybridization and contour-clamped homogeneous electric field electrophoresis for identification of enterococci to the species level. J. Clin. Microbiol. 33:141-145[Abstract]. |
| 6. | Dukta-Malen, S., S. Evers, and P. Courvalin. 1995. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J. Clin. Microbiol. 33:24-27[Abstract]. |
| 7. | Edmond, M. B., J. F. Ober, J. D. Dawson, D. L. Weinbaum, and R. P. Wenzel. 1996. Vancomycin-resistant enterococcal bacteremia: natural history and attributable mortality. Clin. Infect. Dis. 23:1234-1239[Medline]. |
| 8. |
Facklam, R. R., and M. D. Collins.
1989.
Identification of Enterococcus species isolated from human infections by a conventional test scheme.
J. Clin. Microbiol.
27:731-734 |
| 9. | Gin, A. S., and G. G. Zhanel. 1996. Vancomycin-resistant enterococci. Ann. Pharmacother. 30:615-624[Abstract]. |
| 10. | Hoban, D., L. Palatnick, B. Weshnoweski, A. Kabani, S. Zelenitsky, J. Karlowsky, and G. Zhanel. 1997. Comparative in vitro activity of LY333328, a new glycopeptide against Enterococcus gallinarum and Enterococcus casseliflavus, abstr. F-7, p. 147. In Program and abstracts of the 37th Interscience Conference on Antimicrobial Agents and Chemotherapy. American Society for Microbiology, Washington, D.C. |
| 11. | National Committee for Clinical Laboratory Standards. 1997. Methods for dilution of antimicrobial susceptibility tests for bacteria that grow aerobically, 4th ed. Publication M7-A4 National Committee for Clinical Laboratory Standards, Wayne, Pa. |
| 12. |
Neefs, J.,
Y. V. de Peer,
P. De Rijk,
S. Chapelle, and R. De Wachter.
1993.
Compilation of small ribosomal subunit RNA structures.
Nucleic Acids Res.
21:3025-3049 |
| 13. |
Ofner-Agostini, M. E.,
J. Conly,
S. Paton,
A. Kureishi,
L. Nicolle,
M. Mulvey,
W. Johnson,
L. Johnston, and the Canadian Hospital Epidemiological Committee.
1997.
Vancomycin-resistant enterococci (VRE) in Canada results of the Canadian nosocomial infection surveillance program 1996 VRE Point Prevalence Surveillance Project.
Can. J. Infect. Dis.
8:73-78.
|
| 14. | Relman, D. A., T. M. Schmidt, R. P. MacDermott, and S. Falkow. 1992. Identification of the uncultured bacillus of Whipple's disease. N. Engl. J. Med. 327:293-301[Abstract]. |
| 15. | Schaberg, D. R., D. H. Culver, and R. P. Gaynes. 1991. Major trends in the microbial etiology of nosocomial infection. Am. J. Med. 91:72S-75S[Medline]. |
| 16. |
Vincent, S.,
R. G. Knight,
M. Green,
D. F. Sahm, and D. M. Shlaes.
1991.
Vancomycin susceptibility and identification of motile enterococci.
J. Clin. Microbiol.
29:2335-2337 |
Journal of Clinical Microbiology, August 1998, p. 2333-2335, Vol. 36, No. 8
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zhanel, G. G., Laing, N. M., Nichol, K. A., Palatnick, L. P., Noreddin, A., Hisanaga, T., Johnson, J. L., the NAVRESS Group, , Hoban, D. J.
(2003). Antibiotic activity against urinary tract infection (UTI) isolates of vancomycin-resistant enterococci (VRE): results from the 2002 North American Vancomycin Resistant Enterococci Susceptibility Study (NAVRESS). J Antimicrob Chemother
52: 382-388
[Abstract] [Full Text] -
Van Horn, K., Toth, C., Kariyama, R., Mitsuhata, R., Kumon, H.
(2002). Evaluation of 15 Motility Media and a Direct Microscopic Method for Detection of Motility in Enterococci. J. Clin. Microbiol.
40: 2476-2479
[Abstract] [Full Text] -
Zhanel, G. G., Hoban, D. J., Karlowsky, J. A.
(2001). Nitrofurantoin Is Active against Vancomycin-Resistant Enterococci. Antimicrob. Agents Chemother.
45: 324-326
[Abstract] [Full Text] -
Chen, D. K., Pearce, L., McGeer, A., Low, D. E., Willey, B. M.
(2000). Evaluation of D-Xylose and 1% Methyl-alpha -D-Glucopyranoside Fermentation Tests for Distinguishing Enterococcus gallinarum from Enterococcus faecium. J. Clin. Microbiol.
38: 3652-3655
[Abstract] [Full Text] -
Kobayashi, K., Rao, M., Keis, S., Rainey, F. A., Smith, J. M. B., Cook, G. M.
(2000). Enterococci with reduced susceptibility to vancomycin in New Zealand. J Antimicrob Chemother
46: 405-410
[Abstract] [Full Text] -
Iwen, P. C., Rupp, M. E., Schreckenberger, P. C., Hinrichs, S. H.
(1999). Evaluation of the Revised MicroScan Dried Overnight Gram-Positive Identification Panel To Identify Enterococcus Species. J. Clin. Microbiol.
37: 3756-3758
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»