Previous Article | Next Article 
Journal of Clinical Microbiology, August 1998, p. 2359-2362, Vol. 36, No. 8
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Rapid Screening for Penicillin Susceptibility of Systemic
Pneumococcal Isolates by Restriction Enzyme Profiling of the
pbp2B Gene
Bernard
Beall,*
Richard R.
Facklam,
Delois M.
Jackson, and
Holly H.
Starling
Centers for Disease Control and Prevention,
Childhood and Respiratory Infections, Atlanta, Georgia 30333
Received 23 March 1998/Returned for modification 30 April
1998/Accepted 13 May 1998
 |
ABSTRACT |
Restriction digest profiling of pneumococcal
pbp2b-specific amplicons was effective for screening
penicillin resistance. The pbp2b amplicon of all
pneumococcal isolates for which the MICs of penicillin were 
0.03
µg/ml had one of two different susceptible restriction profiles, and
all 33 isolates for which MICs were 0.5 µg/ml or greater had one of
seven distinct resistant profiles. Low-concentration penicillin
resistance (MICs = 0.06 µg/ml to 0.25 µg/ml) was associated
with sensitive HaeIII profiles in some isolates; however,
RsaI profiling and pbp2b sequence analysis of
such isolates revealed that some isolates contained low-level resistant
pbp2b alleles, while others had susceptible
pbp2b alleles. This data indicates that low-level
penicillin resistance is sometimes conferred by determinants other than
pbp2b.
| |
TEXT |
Penicillin resistance in
Streptococcus pneumoniae is believed to be due to
interspecies recombination events that have occurred between
penicillin-binding protein (PBP) genes, resulting in pneumococcal PBPs
with decreased affinity for penicillin (1, 3-12).
Penicillin-resistant pneumococci are characterized by mosaic PBP genes
that exhibit a remarkable degree of variation; PBP genes of
penicillin-sensitive pneumococci typically show little variation
(4, 6, 8, 11).
Previous studies have indicated that alterations in pbp2b
are usually associated with penicillin MICs of 
0.1 µg/ml (9, 11), suggesting that the pbp2b gene might be the
single best target for deducing penicillin nonsusceptibility. Using
frequently cutting restriction enzymes for fingerprinting PBP genes
(1, 7), we noted that the enzyme cleavage patterns of the
resistant pbp2b alleles in the GenBank database
differed from those of the sensitive pbp2b alleles. In the
present study we tested this approach with a diverse group of
pneumococcal clinical isolates.
Bacterial strains.
All pneumococci were isolated from blood
obtained from hospital patients from metropolitan Atlanta, Ga., with
invasive pneumococcal disease during January and February of 1998. Isolates representative of many different serotypes and for which
penicillin MICs varied widely were chosen. Isolate serotypes were
determined by latex agglutination and confirmed by positive Quellung
reactions. Penicillin MICs were determined by the Pasco MIC/ID system
(Difco Laboratories, Detroit, Mich.). Centers for Disease Control and
Prevention stock cultures of Streptococcus sanguis (SS910),
Streptococcus gordonii (SS983), Streptococcus
mitior (SS1165), Streptococcus oralis (SS1236 and
SS1519), Streptococcus mitis (SS1246), Enterococcus
faecium (SS935), and Streptococcus pyogenes (SS1457)
were used to test the specificity of the primer pair used.
PCR and restriction analysis.
Strains were grown overnight on
Trypticase soy agar containing 5% sheep blood. For the template,
crude pneumococcal lysates were prepared by resuspending a loopful of
overnight growth in 300 µl of 0.85% saline, followed by 5 min
of incubation at 75°C. The cells were centrifuged, resuspended in 50 µl of TE buffer (10 mM Tris [pH 8], 1 mM EDTA) containing 9 U of
mutanolysin (Sigma), and incubated at 37°C for 10 min. These samples
were heated at 100°C for 3 min and centrifuged 30 s before 1 µl was removed from the surface to be used in PCRs. PCR primers
pF (GATCCTCTAAATGATTCTCAGGTGGCTGT) and pR (GTCAATTAGCTTAGCAATAGGTGTTGGAT)
flank the 3' 486 codons of pbp2B (4). The
Expand High Fidelity PCR system (Boehringer Mannheim) was used for
20-µl reaction mixtures containing 15 mM MgCl2, 1.4 µM
(each) primer, 200 µM deoxyribonucleotides, and 0.5 U of the thermostable DNA polymerase mixture. The samples were subjected to an
initial denaturation cycle at 95°C for 1 min, followed by 10 cycles
at 94°C for 15 s, annealing at 58°C for 30 s, and
elongation at 72°C for 1 min. This procedure was followed by 20 cycles of the same parameters but with sequential 10-s increments of
the elongation cycle. A 7-min extension followed the final cycle.
Three units of HaeIII or RsaI (Gibco-BRL)
was added to 5 µl of unpurified PCR product. Following a
20-min incubation at 37°C, the restriction digests were
electrophoresed for 20 min at 150 mA through 2% agarose gels
containing ethidium bromide and photographed with a UV
transilluminator.
The
HaeIII reaction conditions used were close to optimal
(data not shown). Even so, all
HaeIII profiles generated in
this
study are comprised of bright bands, which depict the true
restriction
pattern, and a minor background pattern of incomplete
pbp2b amplicon
digest fragments (Fig.
1). Both the major and the minor
components
of these profiles were identical for all members exhibiting
a
given profile.
View larger version (123K):
[in this window]
[in a new window]
|
FIG. 1.
HaeIII profiles of pbp2b amplicons
from penicillin-susceptible (MICs, 0.03 µg/ml) (s1 and s2) and
penicillin-resistant (MICs, 0.06 to 4.0 µg/ml) (r1 to r9) clinical
blood isolates of pneumococci. Lane 1, r2; lane 2, r8; lane 3, r5; lane
4, r4; lane 5, r3; lane 6, r1; lane 7, r9; lane 8, r7; lane 9, r6; lane
10, s2; lane 11, s1, lane 12, Gibco-BRL kilobase ladder.
|
|
DNA sequence analysis.
Dye-deoxy terminator kits
were used as described by the manufacturer (Applied Biosystems,
Inc.) with oligonucleotides pF, pR, p5 (5a), and p6
(5a). Reaction mixtures were loaded onto 4.25%
polyacrylamide gels and electrophoresed on an Applied Biosystems, Inc.,
model 377 sequencer.
Results and discussion.
PCR with primers pF and pR with crude
pneumococcal template yielded a single abundant product of
approximately 1.5 kb. None of the other species tested yielded a
product. As shown in Table 1, all 63 isolates for which penicillin MICs were 0.03 µg/ml had
HaeIII profile s1 or s2 (Fig. 1, lanes 11 and 12) and
represented 20 capsular serotypes. Additionally, five of six isolates
for which MICs were 0.06 µg/ml, one of seven isolates for which MICs were 0.12 µg/ml, and four of nine isolates for which MICs were 0.25 µg/ml exhibited one of these two profiles.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
HaeIII profile distribution among systemic
pneumococcal isolates of various serotypes for which penicillin
MICs vary
|
|
All 33 isolates for which MICs were
0.5 µg/ml exhibited one of
seven
HaeIII profiles (Fig.
1) that differed from the two
susceptible profiles and represented nine capsular serotypes (Table
1).
Pattern r1, the most-frequent resistant profile, was possessed
by 15 isolates with four different capsular serotypes. Each of
the other
resistant profiles was exhibited by at least two independent
isolates.
Two
pbp2b profiles were found only with isolates for which
MICs were 0.06 to 0.25 µg/ml. Pattern r4 appeared only in isolates
for which penicillin MICs were 0.06 to 0.12 µg/ml, suggesting
that
this profile might represent a
pbp2b allele that confers
no
more than low-level penicillin resistance. Similarly, pattern
r6 was
found only with isolates for which MICs were 0.25 µg/ml.
Previous studies have demonstrated that resistant isolates for which
MICs were
0.125 µg/ml had alterations within the 300-bp
transpeptidase-encoding region encompassed between annealing sites
for
P5 and P6 (
4,
5a,
11). However, the presence of the
s1 and
s2 profiles in 10 of 22 isolates for which penicillin MICs
ranged from
0.06 to 0.25 µg/ml indicated that in these strains
one or more other
PBP genes might confer this low level of penicillin
resistance. To test
this hypothesis and to analyze the rest of
the
pbp2b
sequence, we sequenced the entire
pbp2b 1,500-bp amplicon
from two isolates with susceptible
pbp2b HaeIII profiles for
which
MICs were 0.12 to 0.25 µg/ml. One of these isolates, designated
isolate 11, was serotype 23F with
pbp2b profile s2. The
1.5-kb
pbp2b amplicon from isolate 11 contained three base
changes compared
with the susceptible strain R6
pbp2b allele
(
4), but these
differences did not result in an amino acid
change. The other
isolate, designated isolate 5, was serotype 14 with
pbp2b profile
s1. Sequence analysis of
pbp2b from
isolate 5 revealed numerous
differences throughout the 1.5-kb fragment
compared to
pbp2b in
the susceptible strain R6.
Extensive differences were observed
within the 636 bp between primer P5
and P6 annealing sites (Fig.
2). Within
this region, the two alleles had about 91% sequence
identity,
resulting in four nonconservative and seven nonconservative
amino acid
substitutions (Fig.
2). The sequence encoding one of
the
nonconservative substitutions is overlapped by a perfect match
to
primer R2 devised by previous investigators to detect pneumococcal
penicillin resistance (
5a). This PCR approach
(
5a) with isolates
5 and 11 would have detected resistance
only in the former strain.
View larger version (66K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of the pbp2b sequence of low-level
penicillin-resistant (MIC, 0.25) pneumococcal isolate 5 with that of
penicillin-susceptible strain R6. Nucleotide numbering was taken from
reference 4. Codons encoding amino acid
substitutions and the indicated RsaI site are in bold-faced
type. Nonconservative codon substitutions and a perfect match to the R2
primer sequence used by du Plessis et al. in detecting penicillin
resistance (5a) are underlined.
|
|
Sequence analysis revealed that the isolate 5
pbp2b amplicon
could be differentiated from susceptible
pbp2b allele
amplicons
by
RsaI profiles. In Fig.
2, the
RsaI
site shown in the
pbp2B gene of strain R6 is absent from the
corresponding
pbp2b sequence
in isolate 5.
RsaI profiles of
pbp2b amplicons from all 63 sensitive
isolates for which MICs were
0.03 µg/ml revealed that one
sensitive
RsaI profile differed from the
RsaI
profile for isolate 5 (Fig.
3, compare
lanes 2 to 4, 9, and 10 with lane 8). The MICs for
three other
isolates, besides isolates 5 and 29, were 0.25 to
0.25 µg/ml and were
associated with sensitive
HaeIII profiles
(Table
1).
Two of these isolates had a
pbp2b amplicon
RsaI
profile
that differed from that for the susceptible profile (Fig.
3,
compare
lanes 5 and 7 with lanes 2 to 4, 9, and 10), and limited
sequence
analysis of the isolates represented in lanes 5 and 7 revealed
pbp2b sequences that diverged extensively from that of the
sensitive
R6 allele (data not shown). The third isolate was like
isolate
11 in that it had the susceptible
RsaI profile (Fig.
3, lane 6)
and
HaeIII profile, with a
pbp2b
sequence nearly identical to
that of the R6
pbp2b allele. In
summary, it appears that
pbp2b alleles conferring low to
intermediate penicillin resistance can
be detected more efficiently
with
RsaI or
RsaI plus
HaeIII double
digests than with
HaeIII alone. This method cannot detect
all
isolates for which MICs are lower because, as seen here, isolates
sometimes have wild-type susceptible
pbp2b alleles
(e.g., isolate
11 and the strain represented in Fig.
3, lane 6).
View larger version (116K):
[in this window]
[in a new window]
|
FIG. 3.
pbp2b amplicon RsaI profiles of
pneumococci susceptible to penicillin and of pneumococci with low-level
resistance. Lanes 1, 5, and 8 are profiles of isolates for which MICs
were 0.25 µg/ml; lanes 1 and 8 are from isolates 11 and 5, respectively. Lanes 6 and 7 are profiles of isolates for which MICs
were 0.12 µg/ml. Lanes 2 to 4 and 9 to 10 are profiles of
penicillin-susceptible isolates (MICs, 0.03 µg/ml). Lane 11, Gibco-BRL 1-kb ladder.
|
|
The greatest range in MICs (0.5 to 4.0 µg/ml) was for isolates with
the r1 and r2
HaeIII profiles, indicating that with these
alleles, variation in another PBP gene(s) probably causes incremental
resistance. Studies have shown that MICs of
0.1 µg/ml result
from
alterations in
pbp1a and
pbp2x, while higher
resistances
(MICs,
0.25 µg/ml) are associated with alterations in
pbp2b (
2,
5,
10). The results presented here for
isolates with the
wild-type sensitive
pbp2b gene sequence
for which MICs are 0.12
to 0.25 µg/ml suggest that intermediate MICs
of 0.06 to 0.25 µg/ml
sometimes arise due to alterations in PBP genes
other than
pbp2b.
Pneumococcal pneumonia or bacteremia with isolates for which MICs are
within the range of
0.03 to 0.25 µg/ml is generally
treated with
penicillin. All of the MICs for isolates with susceptible
HaeIII patterns were between
0.03 and 0.25 µg/ml, and
susceptible
HaeIII patterns were exhibited by 73 of the 85 isolates (86%)
for which MICs fell in this range. Therefore, if the
results for
these isolates are generally applicable, this system could
allow
the rapid identification of a majority of pneumococcal pneumonia
and bacteremia cases treatable with penicillin. Cases of otitis
media
and meningitis would require antibiotic therapies other
than
penicillin; however, resistant
pbp2b profiles could
influence
the choice of therapies for these infections.
An approach based on the simultaneous examination of the PBP gene
amplicon profiles representing
pbp2b,
pbp1a,
pbp2a, and
pbp2x will possibly allow the
detection of all levels of penicillin
resistance in pneumococci. In
addition, this approach may allow
a more quantitative assessment of
penicillin resistance by correlating
different combinations of
pbp alleles with different levels of
resistance.
Additionally, as noted previously (
1,
2,
7),
this approach
allows the differentiation of different
pbp alleles
for
epidemiologic purposes.
The speed with which antibiotic susceptibility is determined is
critical in treating pneumococcal bacteremia. Deducing pneumococcal
penicillin sensitivity by
HaeIII and
RsaI
profiling requires only
about 3 h, whereas susceptibility testing
requires approximately
24 h.
Culture methods currently used to identify pneumococci require about
24 h. Another potential use of this approach is the detection
of
penicillin-sensitive and -resistant pneumococcal isolates from
clinical
specimens, since the primer pair used for amplification
appears to be
specific for the pneumococcal
pbp2b gene.
| |
ACKNOWLEDGMENTS |
We thank Alma Ruth Franklin and Lesyle LaClaire for assistance with
serotyping and susceptibility testing and the Georgia Emerging
Infection Program for collection of isolates used in this study. We are
grateful to Benjamin Schwartz for information concerning treatment of
pneumococcal infections.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Centers for
Disease Control and Prevention, Childhood and Respiratory
Infections, 1600 Clifton Rd., Mailstop C02, Atlanta, GA 30333. Phone: (404) 639-1237. Fax: (404) 639-3123. E-mail:
beb0{at}cdc.gov.
| |
REFERENCES |
| 1.
|
Coffey, T. J.,
C. G. Dowson,
M. Daniels,
J. Zhou,
C. Martin,
B. G. Spratt, and J. M. Musser.
1991.
Horizontal transfer of multiple penicillin-binding protein genes, and capsular biosynthetic genes, in natural populations of Streptococcus pneumoniae.
Mol. Microbiol.
5:2255-2260[Medline].
|
| 2.
|
Coffey, T. J.,
C. G. Dowson,
M. Daniels, and B. G. Spratt.
1995.
Genetics and molecular biology of  -lactam-resistant pneumococci.
Microb. Drug Resist.
1:29-34.
[Medline] |
| 3.
|
Dowson, C. G.,
A. Hutchison,
J. A. Brannigan,
R. C. George,
D. Hansman,
J. Liñares,
A. Tomasz,
J. Maynard Smith, and B. G. Spratt.
1989.
Horizontal transfer of penicillin-binding protein genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae.
Proc. Natl. Acad. Sci. USA
87:5858-5862[Abstract/Free Full Text].
|
| 4.
|
Dowson, C. G.,
A. Hutchison, and G. G. Spratt.
1989.
Extensive remodeling of the transpeptidase domain of penicillin-binding protein 2B of a penicillin-resistant South African isolate of Streptococcus pneumoniae.
Mol. Microbiol.
3:95-102[Medline].
|
| 5.
|
Dowson, C. G.,
A. P. Johnson,
E. Cercenado, and R. C. George.
1994.
Genetics of oxacillin resistance in clinical isolates of Streptococcus pneumoniae that are oxacillin resistant and penicillin susceptible.
Antimicrob. Agents Chemother.
38:49-53[Abstract/Free Full Text].
|
| 5a.
|
du Plessis, M.,
A. M. Smith, and K. P. Klugman.
1998.
Rapid detection of penicillin-resistant Streptococcus pneumoniae in cerebrospinal fluid by a seminested-PCR strategy.
J. Clin. Microbiol.
36:453-457[Abstract/Free Full Text].
|
| 6.
|
Hakenbeck, R.,
M. Tarpay, and A. Tomasz.
1980.
Multiple changes of penicillin binding proteins in penicillin-resistant clinical isolates of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
17:364-371[Abstract/Free Full Text].
|
| 7.
|
Kell, C. M.,
J. Z. Jordens,
M. Daniels,
T. J. Coffey,
J. Bates,
J. Paul,
C. Gilks, and B. G. Spratt.
1993.
Molecular epidemiology of penicillin-resistant pneumococci isolated in Nairobi, Kenya.
Infect. Immun.
61:4382-4391[Abstract/Free Full Text].
|
| 8.
|
Laible, G.,
B. G. Spratt, and R. Hakenbeck.
1991.
Interspecies recombinational events during the evolution of altered PBP 2x genes in penicillin-resistant clinical isolates of Streptococcus pneumoniae.
Mol. Microbiol.
5:1993-2002[Medline].
|
| 9.
|
Martin, C.,
C. Sibold, and R. Hakenbeck.
1992.
Relatedness of penicillin-binding protein 1a genes from different clones of penicillin-resistant Streptococcus pneumoniae isolated in South Africa and Spain.
EMBO J.
11:3831-3836[Medline].
|
| 10.
|
Muñoz, R.,
C. G. Dowson,
M. Daniels,
T. J. Coffey,
C. Martin,
R. Hakenbeck, and B. G. Spratt.
1992.
Genetics of resistance to third-generation cephalosporins in clinical isolates of Streptococcus pneumoniae.
Mol. Microbiol.
6:2461-2465[Medline].
|
| 11.
|
Smith, A. M., and K. P. Klugman.
1995.
Alterations in penicillin-binding protein 2B from penicillin-resistant wild-type strains of Streptococcus pneumoniae.
Antimicrob. Agents Chemother.
39:859-867[Abstract].
|
| 12.
|
Smith, A. M.,
K. P. Klugman,
T. J. Coffey, and B. G. Spratt.
1993.
Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.
Antimicrob. Agents Chemother.
37:1938-1944[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, August 1998, p. 2359-2362, Vol. 36, No. 8
0095-1137/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Harris, K. A., Turner, P., Green, E. A., Hartley, J. C.
(2008). Duplex Real-Time PCR Assay for Detection of Streptococcus pneumoniae in Clinical Samples and Determination of Penicillin Susceptibility. J. Clin. Microbiol.
46: 2751-2758
[Abstract]
[Full Text]
-
Pai, R., Gertz, R. E., Whitney, C. G., Beall, B., the Active Bacterial Core Surveillance Team,
(2005). Clonal Association between Streptococcus pneumoniae Serotype 23A, Circulating within the United States, and an Internationally Dispersed Clone of Serotype 23F. J. Clin. Microbiol.
43: 5440-5444
[Abstract]
[Full Text]
-
Harris, K. A., Hartley, J. C.
(2003). Development of broad-range 16S rDNA PCR for use in the routine diagnostic clinical microbiology service. J Med Microbiol
52: 685-691
[Abstract]
[Full Text]
-
Facklam, R.
(2002). What Happened to the Streptococci: Overview of Taxonomic and Nomenclature Changes. Clin. Microbiol. Rev.
15: 613-630
[Abstract]
[Full Text]
-
du Plessis, M., Bingen, E., Klugman, K. P.
(2002). Analysis of Penicillin-Binding Protein Genes of Clinical Isolates of Streptococcus pneumoniae with Reduced Susceptibility to Amoxicillin. Antimicrob. Agents Chemother.
46: 2349-2357
[Abstract]
[Full Text]
-
Kearns, A. M., Graham, C., Burdess, D., Heatherington, J., Freeman, R.
(2002). Rapid Real-Time PCR for Determination of Penicillin Susceptibility in Pneumococcal Meningitis, Including Culture-Negative Cases. J. Clin. Microbiol.
40: 682-684
[Abstract]
[Full Text]
-
Gherardi, G., Inostrozo, J. S., O'ryan, M., Prado, V., Prieto, S., Arellano, C., Facklam, R. R., Beall, B.
(1999). Genotypic Survey of Recent beta -Lactam-Resistant Pneumococcal Nasopharyngeal Isolates from Asymptomatic Children in Chile. J. Clin. Microbiol.
37: 3725-3730
[Abstract]
[Full Text]
Top
Abstract
Text
