This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leutenegger, C. M.
Right arrow Articles by Lutz, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leutenegger, C. M.
Right arrow Articles by Lutz, H.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, October 1999, p. 3390-3391, Vol. 37, No. 10
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Molecular Evidence of Coinfection of Ticks with Borrelia burgdorferi Sensu Lato and the Human Granulocytic Ehrlichiosis Agent in Switzerland

Christian M. Leutenegger,1,* Nicola Pusterla,1 Caroline N. Mislin,1 Rainer Weber,2 and Hans Lutz1

Clinical Laboratory, Department of Internal Veterinary Medicine, University of Zurich, 8057 Zurich,1 and Division of Infectious Diseases and Hospital Epidemiology, Department of Internal Medicine, University Hospital of Zurich, 8091 Zurich,2 Switzerland

Received 26 April 1999/Returned for modification 15 June 1999/Accepted 1 July 1999


    ABSTRACT
Top
Abstract
Text
References

Adult Ixodes ricinus ticks were collected in Switzerland and tested for the presence of coinfection with Borrelia burgdorferi sensu lato and the human granulocytic ehrlichiosis (HGE) agent by real-time PCR. Of 100 ticks, 49% were positive for B. burgdorferi and 2% were positive for the HGE agent. The two HGE agent-positive ticks were also found to be positive for B. burgdorferi.


    TEXT
Top
Abstract
Text
References

Lyme borreliosis and human granulocytic ehrlichiosis (HGE) are emerging infectious diseases of both humans and animals that are transmitted by ticks. In Switzerland, Ehrlichia phagocytophila has been identified in cattle (11) and an agent with 100% homology in its 16S rRNA gene to the agent of HGE has been detected in dogs (14) and horses (15). HGE is a recently discovered syndrome in humans (3) caused by an agent phylogenetically closely related to E. phagocytophila and Ehrlichia equi and was found in the United States and also in Europe (10). Coexistence of antibodies to tick-borne pathogens, such as Babesia microti, HGE agent, and Borrelia burgdorferi, have been reported (7), indicating that humans and animals may be infected simultaneously by these pathogens through tick bites.

In the present study, 100 DNA samples of adult female ticks were tested to find molecular evidence of coinfection with B. burgdorferi and the HGE agent in Switzerland.

Tick collection. A total of 100 adult Ixodes ricinus ticks were collected in Wangen, Canton of Zurich, Switzerland, a region with a sporadic occurrence of granulocytic ehrlichiosis in animals caused by an HGE-like agent. The ticks were collected with an umbrella that was covered with a terry cloth towel and repeatedly pushed through the low underbrush in forests. Ticks attached to the towel were removed, placed into tubes, and stored individually at -20°C until DNA extraction was performed.

DNA extraction. After thawing, ticks were placed in 200 µl of buffered phosphate solution in an Eppendorf tube and mechanically crushed with sterile scissors. DNA extraction was performed with a QIAamp tissue kit (Qiagen, Basel, Switzerland) according to the manufacturer's recommendations.

PCR and DNA sequencing. All DNA samples were examined for the presence of B. burgdorferi sensu lato by real-time TaqMan PCR and for the presence of Ehrlichia of the E. phagocytophila genogroup (13). The Borrelia-specific TaqMan PCR, designed for the inner part of the flagellin gene, was carried out with the following oligonucleotides (5'right-arrow3'): forward primer B.398f, GGGAAGCAGATTTGTTTGACA; reverse primer B.484r, ATAGAGCAACTTACAGACGAAATTAATAGA, and probe B.421p, ATGTGCATTTGGTTATATTGAGCTTGATCAGCAA. The agent of the Borrelia TaqMan PCR reacted with Borrelia species but not with 30 other bacterial species tested. This indicates the high analytical specificity for Borrelia species of the TaqMan PCR. The analytical sensitivity was 10 copies of a cloned PCR product (6a). Negative controls included DNAs from 50 noninfected, laboratory-reared adult ticks of the I. ricinus species that were purchased from the Institute of Zoology in Neuchâtel (Switzerland). Borrelia- and Ehrlichia-specific DNAs were verified by conventional nested-PCR amplification and sequencing of the amplified products. Visualization of the PCR amplification products was performed by gel electrophoresis on 1.8% agarose gels. Single bands were purified (QIAquick gel extraction kit; Qiagen), cloned with a TOPO TA cloning kit (Invitrogen, NV, Leek, The Netherlands), and sequenced with a fluorescence-based automated sequencing system (ABI 377 DNA sequencing; Microsynth, Balgach, Switzerland).

Of the 100 individually processed ticks, 49 were positive for B. burgdorferi and 2 were positive for the agent of HGE. The two HGE agent-positive ticks were also found to be positive for B. burgdorferi. The 50 control ticks were negative for the presence of both Borrelia and Ehrlichia.

The nucleotide sequences obtained from DNAs purified from the two coinfected ticks were identified as being part of the flagellin gene of Borrelia and of the 16S rRNA gene of Ehrlichia spp. One of the coinfected ticks showed evidence of Borrelia afzelii infection (its sequence was comparable to GenBank accession no. X75202), and the other tick was infected with B. burgdorferi sensu stricto (its sequence was comparable to GenBank accession no. X75200). The nucleotide sequences of the 16S rRNA genes of both ticks showed 100% sequence homology to the agent of HGE from the United States (GenBank accession no. U02521) and to the agent of canine and equine granulocytic ehrlichiosis from Switzerland (accession no. AF057707).

To our knowledge, this is the first report showing ticks to be coinfected with two human pathogens, B. burgdorferi sensu lato and the HGE agent, in Europe. Endemicity of Lyme borreliosis in or near tick-infested forests is well documented (8), and B. afzelii and B. burgdorferi sensu stricto are well-described human pathogens.

The E. phagocytophila genogroup consists of closely related species of Ehrlichia, including E. phagocytophila, the cause of tick-borne fever in sheep, goats, and cattle, E. equi, the cause of equine ehrlichiosis, and the HGE agent, a recently discovered species that infects humans (1, 3). Each of these three ehrlichial agents infects a different host species, has a different geographical distribution, and may cause different clinical signs. However, research indicates that they may be variants of the same species (1, 5). In Switzerland, prevalence of Ehrlichia-infected ticks was found to vary to some extent in different regions (8, 12). For this reason, a region with large tick populations and with a known occurrence of granulocytic ehrlichiosis in dogs and horses was chosen for the present study. Coinfection of ticks with B. burgdorferi and members of the E. phagocytophila genogroup has been reported in the United States with various levels prevalence of 1.9% (4) up to 29.6% (16).

Our molecular findings add further evidence that infections with Ehrlichia spp. may occur in tick-infested areas. Earlier studies suggest that coinfection with these agents may occur as a consequence of tick bites; coinfection may explain the variable clinical signs seen in humans and animals with Lyme borreliosis and ehrlichiosis (6, 9, 17). Patients who present with unexplained febrile illnesses (severe headache, arthralgias, and myalgias) and who have leukopenia, anemia, and/or thrombocytopenia together with elevated values of transaminases following tick bites (2) may have had exposure to multiple tick-borne pathogens, including ehrlichiae (17).

The results of this study emphasize that ticks coinfected with B. burgdorferi and the agent of HGE are prevalent in the central part of Europe and, thus, that dual tick-borne infections may occur. Although the probability of dual infections appears low, differential diagnosis of dual infections and appropriate laboratory diagnosis is important because HGE agent does not respond to the beta-lactam antibiotics that are frequently used to treat Lyme borreliosis.

Nucleotide sequence accession numbers. The sequence of the flagellin gene of the Borrelia-positive ticks has been deposited in GenBank under the accession no. AF127531 (B. burgdorferi sensu stricto) and AF127532 (B. afzelii). The sequence of the 16S rRNA gene of the HGE agent-positive ticks has been deposited in GenBank under the accession no. AF084907.


    ACKNOWLEDGMENTS

This work was supported by the United Bank of Switzerland "on behalf of a customer."

We gratefully acknowledge R. Wicki, PE Biosystems, Rotkreuz, Switzerland, for excellent technical support with the ABI Prism 7700.


    FOOTNOTES

* Corresponding author. Present address: Department of Medicine and Epidemiology, School of Veterinary Medicine, University of California, Davis, CA 95616. Phone: (530) 752-5032. Fax: (530) 752-0414. E-mail: cmleutenegger{at}ucdavis.edu.


    REFERENCES
Top
Abstract
Text
References

1. Anderson, B. E., J. E. Dawson, D. C. Jones, and K. H. Wilson. 1991. Ehrlichia chaffeensis, a new species associated with human ehrlichiosis. J. Clin. Microbiol. 29:2838-2842[Abstract/Free Full Text].
2. Bakken, J. S., J. Krueth, C. Wilson-Nordskog, R. L. Tilden, K. Asanovich, and J. S. Dumler. 1996. Clinical and laboratory characteristics of human granulocytic ehrlichiosis. JAMA 275:199-205[Abstract/Free Full Text].
3. Chen, S. M., J. S. Dumler, J. S. Bakken, and D. H. Walker. 1994. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 32:589-595[Abstract/Free Full Text].
4. Daniels, T. J., T. M. Boccia, S. Varde, J. Marcus, J. Le, D. J. Bucher, R. C. Falco, and I. Schwartz. 1998. Geographic risk for Lyme disease and human granulocytic ehrlichiosis in southern New York state. J. Clin. Microbiol. 64:4663-4669.
5. Dumler, J. S., K. M. Asanovich, J. S. Bakken, P. Richter, R. Kimsey, and J. E. Madigan. 1995. Serologic cross-reactions among Ehrlichia equi, Ehrlichia phagocytophila, and human granulocytic ehrlichia. J. Clin. Microbiol. 33:1098-1103[Abstract].
6. Larsen, H. J., G. Overnes, H. Waldeland, and G. M. Johansen. 1994. Immunosuppression in sheep experimentally infected with Ehrlichia phagocytophila. Res. Vet. Sci. 56:216-224[Medline].
6a. Leutenegger, C. M. Submitted for publication.
7. Magnarelli, L. A., J. S. Dumler, J. F. Anderson, R. C. Johnson, and E. Fikrig. 1995. Coexistence of antibodies to tick-borne pathogens of babesiosis, ehrlichiosis, and Lyme borreliosis in human sera. J. Clin. Microbiol. 33:3054-3057[Abstract].
8. Maiwald, M., R. Oehme, O. March, T. N. Petney, P. Kimmig, K. Naser, H. Zappe, D. Hassler, and M. von Knebel Doeberitz. 1998. Transmission risk of Borrelia burgdorferi sensu lato from Ixodes ricinus ticks to humans in southwest Germany. Epidemiol. Infect. 121:103-108[Medline].
9. Nadelman, R. B., F. Strle, H. W. Horowitz, W. A. Agger, and G. P. Wormser. 1997. Leukopenia, thrombocytopenia, and Lyme borreliosis: is there an association? Clin. Infect. Dis. 24:1027-1029[Medline].
10. Petrovec, M., S. L. Furlan, T. A. Zupanc, F. Strle, P. Brouqui, V. Roux, and J. S. Dumler. 1997. Human disease in Europe caused by a granulocytic Ehrlichia species. J. Clin. Microbiol. 35:1556-1559[Abstract].
11. Pfister, K., P. H. Boss, and B. Balsiger. 1987. Ehrlichia phagocytophila als Erreger des Weidefiebers im Berner Oberland. Schweiz. Arch. Tierheilkd. 129:343-347[Medline].
12. Pusterla, N., J. Huder, C. Wolfensberger, B. Litschi, A. Parvis, and H. Lutz. 1997. Granulocytic ehrlichiosis in two dogs in Switzerland. J. Clin. Microbiol. 35:2307-2309[Abstract].
13. Pusterla, N., J. B. Huder, K. Feige, and H. Lutz. 1998. Identification of a granulocytic Ehrlichia strain isolated from a horse in Switzerland and comparison with other rickettsiae of the Ehrlichia phagocytophila genogroup. J. Clin. Microbiol. 36:2035-2037[Abstract/Free Full Text].
14. Pusterla, N., C. M. Leutenegger, J. B. Huder, R. Weber, U. Braun, and H. Lutz. 1999. Evidence of the human granulocytic ehrlichiosis agent in Ixodes ricinus ticks in Switzerland. J. Clin. Microbiol. 37:1329-1331[Abstract/Free Full Text].
15. Pusterla, N., J. B. Huder, C. M. Leutenegger, U. Braun, J. E. Madigan, and H. Lutz. 1999. Quantitative real-time PCR for the detection of members of the Ehrlichia phagocytophila genogroup in host animals and Ixodes ricinus ticks. J. Clin. Microbiol. 37:1332-1334[Abstract/Free Full Text].
16. Schauber, E. M., S. J. Gertz, W. T. Maple, and R. S. Ostfeld. 1998. Coinfection of blacklegged ticks (Acari: Ixodidae) in Dutchess County, New York, with the agents of Lyme disease and human granulocytic ehrlichiosis. J. Med. Entomol. 35:901-903[Medline].
17. Weber, R., N. Pusterla, M. Loy, and H. Lutz. 1998. Fever, leukopenia, and thrombocytopenia in a patient with acute Lyme borreliosis were due to human granulocytic ehrlichiosis. Clin. Infect. Dis. 26:253-254[Medline].

Journal of Clinical Microbiology, October 1999, p. 3390-3391, Vol. 37, No. 10
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Adjemian, J. Z., Adjemian, M. K., Foley, P., Chomel, B. B., Kasten, R. W., Foley, J. E. (2008). Evidence of Multiple Zoonotic Agents in a Wild Rodent Community in the Eastern Sierra Nevada. J Wildl Dis 44: 737-742 [Abstract] [Full Text]  
  • Foley, J. E., Brown, R. N., Gabriel, M. W., Henn, J., Drazenovich, N., Kasten, R., Green, S. L., Chomel, B. B. (2007). Spatial analysis of the exposure of dogs in rural north-coastal California to vectorborne pathogens. Vet Rec. 161: 653-657 [Abstract] [Full Text]  
  • Grab, D. J., Nyarko, E., Barat, N. C., Nikolskaia, O. V., Dumler, J. S. (2007). Anaplasma phagocytophilum-Borrelia burgdorferi Coinfection Enhances Chemokine, Cytokine, and Matrix Metalloprotease Expression by Human Brain Microvascular Endothelial Cells. CVI 14: 1420-1424 [Abstract] [Full Text]  
  • Swanson, S. J., Neitzel, D., Reed, K. D., Belongia, E. A. (2006). Coinfections Acquired from Ixodes Ticks. Clin. Microbiol. Rev. 19: 708-727 [Abstract] [Full Text]  
  • Ferquel, E., Garnier, M., Marie, J., Bernede-Bauduin, C., Baranton, G., Perez-Eid, C., Postic, D. (2006). Prevalence of Borrelia burgdorferi Sensu Lato and Anaplasmataceae Members in Ixodes ricinus Ticks in Alsace, a Focus of Lyme Borreliosis Endemicity in France. Appl. Environ. Microbiol. 72: 3074-3078 [Abstract] [Full Text]  
  • Rauter, C., Hartung, T. (2005). Prevalence of Borrelia burgdorferi Sensu Lato Genospecies in Ixodes ricinus Ticks in Europe: a Metaanalysis. Appl. Environ. Microbiol. 71: 7203-7216 [Abstract] [Full Text]  
  • Coulter, P., Lema, C., Flayhart, D., Linhardt, A. S., Aucott, J. N., Auwaerter, P. G., Dumler, J. S. (2005). Two-Year Evaluation of Borrelia burgdorferi Culture and Supplemental Tests for Definitive Diagnosis of Lyme Disease. J. Clin. Microbiol. 43: 5080-5084 [Abstract] [Full Text]  
  • Arsenault, W. G., Messick, J. B. (2005). Acute Granulocytic Ehrlichiosis in a Rottweiler. Journal of the American Animal Hospital Association 41: 323-326 [Abstract] [Full Text]  
  • Grab, D. J., Perides, G., Dumler, J. S., Kim, K. J., Park, J., Kim, Y. V., Nikolskaia, O., Choi, K. S., Stins, M. F., Kim, K. S. (2005). Borrelia burgdorferi, Host-Derived Proteases, and the Blood-Brain Barrier. Infect. Immun. 73: 1014-1022 [Abstract] [Full Text]  
  • Hofmann-Lehmann, R., Meli, M. L., Dreher, U. M., Gonczi, E., Deplazes, P., Braun, U., Engels, M., Schupbach, J., Jorger, K., Thoma, R., Griot, C., Stark, K. D. C., Willi, B., Schmidt, J., Kocan, K. M., Lutz, H. (2004). Concurrent Infections with Vector-Borne Pathogens Associated with Fatal Hemolytic Anemia in a Cattle Herd in Switzerland. J. Clin. Microbiol. 42: 3775-3780 [Abstract] [Full Text]  
  • Wang, G., Liveris, D., Brei, B., Wu, H., Falco, R. C., Fish, D., Schwartz, I. (2003). Real-Time PCR for Simultaneous Detection and Quantification of Borrelia burgdorferi in Field-Collected Ixodes scapularis Ticks from the Northeastern United States. Appl. Environ. Microbiol. 69: 4561-4565 [Abstract] [Full Text]  
  • CAO, W.-C., ZHAO, Q.-M., ZHANG, P.-H., YANG, H., WU, X.-M., WEN, B.-H., ZHANG, X.-T., HABBEMA, J. D. F. (2003). PREVALENCE OF ANAPLASMA PHAGOCYTOPHILA AND BORRELIA BURGDORFERI IN IXODES PERSULCATUS TICKS FROM NORTHEASTERN CHINA. Am J Trop Med Hyg 68: 547-550 [Abstract] [Full Text]  
  • Zhi, N., Ohashi, N., Tajima, T., Mott, J., Stich, R. W., Grover, D., Telford III, S. R., Lin, Q., Rikihisa, Y. (2002). Transcript Heterogeneity of the p44 Multigene Family in a Human Granulocytic Ehrlichiosis Agent Transmitted by Ticks. Infect. Immun. 70: 1175-1184 [Abstract] [Full Text]  
  • Hristova, K. R., Lutenegger, C. M., Scow, K. M. (2001). Detection and Quantification of Methyl tert-Butyl Ether-Degrading Strain PM1 by Real-Time TaqMan PCR. Appl. Environ. Microbiol. 67: 5154-5160 [Abstract] [Full Text]  
  • Christova, I., Schouls, L., van de Pol, I., Park, J., Panayotov, S., Lefterova, V., Kantardjiev, T., Dumler, J. S. (2001). High Prevalence of Granulocytic Ehrlichiae and Borrelia burgdorferi Sensu Lato in Ixodes ricinus Ticks from Bulgaria. J. Clin. Microbiol. 39: 4172-4174 [Abstract] [Full Text]  
  • Chomel, B. B., Mac Donald, K. A., Kasten, R. W., Chang, C.-C., Wey, A. C., Foley, J. E., Thomas, W. P., Kittleson, M. D. (2001). Aortic Valve Endocarditis in a Dog Due to Bartonella clarridgeiae. J. Clin. Microbiol. 39: 3548-3554 [Abstract] [Full Text]  
  • Alekseev, A. N., Dubinina, H. V., Van De Pol, I., Schouls, L. M. (2001). Identification of Ehrlichia spp. and Borrelia burgdorferi in Ixodes Ticks in the Baltic Regions of Russia. J. Clin. Microbiol. 39: 2237-2242 [Abstract] [Full Text]  
  • Cao, W.-C., Zhao, Q.-M., Zhang, P.-H., Dumler, J. S., Zhang, X.-T., Fang, L.-Q., Yang, H. (2000). Granulocytic Ehrlichiae in Ixodes persulcatus Ticks from an Area in China Where Lyme Disease Is Endemic. J. Clin. Microbiol. 38: 4208-4210 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leutenegger, C. M.
Right arrow Articles by Lutz, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leutenegger, C. M.
Right arrow Articles by Lutz, H.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»