Previous Article | Next Article 
Journal of Clinical Microbiology, October 1999, p. 3405-3408, Vol. 37, No. 10
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Transmission of an Azole-Resistant Isogenic Strain
of Candida albicans among Human Immunodeficiency
Virus-Infected Family Members with Oropharyngeal Candidiasis
Frank-Michael C.
Müller,1,2,*
Miki
Kasai,1
Andrea
Francesconi,1
Beth
Brillante,1
Maureen
Roden,1
Joanne
Peter,1
Stephen J.
Chanock,1 and
Thomas
J.
Walsh1,*
Immunocompromised Host Section, Pediatric Oncology Branch,
National Cancer Institute, National Institutes of Health, Bethesda,
Maryland,1 and Institut für
Molekulare Infektionsbiologie, Universität Würzburg,
Würzburg, Germany2
Received 18 March 1999/Returned for modification 29 April
1999/Accepted 22 July 1999
 |
ABSTRACT |
We report transmission of an azole-resistant, isogenic strain of
Candida albicans in a human immunodeficiency virus
(HIV)-infected family of two children with symptomatic oropharyngeal
candidiasis and a mother with asymptomatic colonization over a 5-year
period. These findings were confirmed by three different molecular
epidemiology methods: interrepeat PCR, Southern hybridization with a
C. albicans repetitive element 2 probe, and electrophoretic
karyotyping. This study contributes to an evolving understanding of the
mode of transmission of C. albicans, particularly in
children, and underscores the importance of monitoring specimens from
family members of HIV-infected patients.
| |
TEXT |
Transmission of genetically
indistinguishable strains of Candida albicans between human
immunodeficiency virus (HIV)-infected adult partners has been reported
previously (1, 3, 4-6, 18). However, little is known about
the transmission of azole-resistant C. albicans between
children and within families (16). We report the
transmission of an isogenic C. albicans strain within an
HIV-infected family. All isolates were biotyped by interrepeat PCR
(IR-PCR), Southern blot hybridization with a C. albicans
repetitive element 2 (CARE-2) probe, and electrophoretic karyotyping
(EK) in order to demonstrate the degree of genetic relatedness.
(This work was presented in part at the 5th Candida and Candidiasis
Conference of the American Society for Microbiology, 1999 [11].)
Two brothers and their mother were monitored in a prospective study for
5 years in the Pediatric Oncology Branch of the National Cancer
Institute (Table 1). The brothers had
acquired HIV vertically and had a history of recurrent symptomatic
oropharyngeal candidiasis (OPC), which had been treated with courses of
clotrimazole (CLT), ketoconazole (KTC), itraconazole (ITC), fluconazole
(FLC), amphotericin B (AMB), and cyclodextrin itraconazole (CD ITC).
During the 5-year observation period, the mother was not treated for
asymptomatic colonization with antifungal agents. A total of 13 oral
surveillance cultures from the oral mucosa were obtained from the three
patients between September 1993 and April 1998. Patient isolates were
identified by the Clinical Microbiology Laboratory of the Warren Grant
Magnuson Clinical Center of the National Institutes of Health. The 20C Analytic Profile Index strip (Biomerieux, Marcy l'Etoile, France) was
used to identify C. albicans. Candida dubliniensis was
distinguished from C. albicans by its differential growth at
42 and 45°C. All isolates were stored on potato dextrose agar (PDA)
at 
70°C and tested for antifungal susceptibilities at a later time.
Stock solutions of AMB (Bristol-Myers Squibb, Princeton, N.J.) and FLC (Pfizer, Groton, Conn.) were prepared by using RPMI-1640 buffered with
0.165 M morpholinepropanesulfonic acid (MOPS) to pH 7.0 (BioWhittaker, Walkersville, Md.). Polyethylene glycol 400 was used to solubilize ITC
and KTC (Janssen Pharmaceutica, Piscataway, N.J.). Serial twofold
dilutions were further performed with the appropriate diluent. The
final concentrations were 0.03 to 16 µg/ml for AMB, KTC, and ITC and
0.125 to 64 µg/ml for FLC. Broth microdilution testing was performed
according to reference method M27-A of the National Committee for
Clinical Laboratory Standards (Table 2) (12). All MICs at 24 and 48 h were determined at least three times for each isolate.
Molecular biotyping of the Candida strains was performed by
using two DNA fingerprinting methods, IR-PCR and Southern hybridization with a CARE-2 probe, as well as EK. All typing was repeated at least
three times to ensure reproducibility. For the IR-PCR assay, genomic
DNA from Candida isolates was extracted with the DNeasy kit
(Qiagen, Chatsworth, Calif.). The oligonucleotide pair 1245 (5'
AAGTAAGTGACTGGGGTGAGCG 3') and 1246 (5'
ATGTAAGCTCCTGGGGATTCAC 3') was used under the following
conditions (21): a final amplification buffer of
6.25 mM MgCl2, 83 mM KCl, 16.7 mM Tris-HCl, 0.001%
(wt/vol) gelatin, 1.33 mM deoxynucleoside triphosphates (Boehringer
Mannheim, Indianapolis, Ind.), 0.01 µg of each primer/ml, 1.25 U of
Taq DNA polymerase (Boehringer Mannheim), and 25 to 50 ng of
genomic DNA/µl. Amplification conditions were as follows: 95°C for
5 min, 95°C for 1 min, 25°C for 1 min, and 74°C for 2 min for 35 cycles, followed by 74°C for 5 min. Amplification products were
visualized on an ethidium bromide-stained 1.5% agarose gel. For the
CARE-2 analysis, genomic DNA was extracted by using phenol-chloroform as described by Millon et al. (10). A 954-bp CARE-2 fragment was amplified by PCR as described previously (7). Ten
micrograms of chromosomal DNA was digested with EcoRI,
electrophoresed, and vacuum blotted onto a nylon membrane (Pall,
Portsmouth, England) (17). After UV cross-linking, the
filter was hybridized with 200 ng of enzyme chemiluminescence-labeled
(ECL) (Amersham, Braunschweig, Germany) CARE-2 DNA. Detection of the
chemiluminescent signal was performed according to the manufacturer's
directions. DNA was extracted for EK from agarose-embedded cells
exposed to enzymatic digestion with minor modifications as described
previously (19), by using the Bio-Rad (Hercules, Calif.)
contour-clamped homogeneous electric field (CHEF) DR-III device. DNA
was run on a 0.9% SeaKem Gold Agarose gel (FMC Bioproducts, Rockland,
Maine). The gel was run at 14°C and 4.5 V/cm with a 120° angle.
Running time was 36 h with a 60- to 300-s linear ramp
(8). We analyzed isolate 8621 as a standard control for
IR-PCR, CARE-2, and EK, and we analyzed four more unrelated clinical
isolates (9329, 4389, 1672, and 2771) of C. albicans as
controls for IR-PCR and CARE-2.
The isolates of C. albicans from both children demonstrated
resistance to FLC and ITC (Table 2). One
Candida isolate obtained from the mother was identified as
C. albicans, with a MIC profile similar to those for the
isolates from the two children, and the other isolate from the mother
was characterized as a C. dubliniensis strain susceptible to
FLC.
Molecular analysis of each isolate demonstrated that the same
azole-resistant isogenic strain of C. albicans was shared
among the two brothers and the mother. The three molecular typing
methods also clearly distinguished between isolates of C. albicans and C. dubliniensis (Fig.
1 through
3). The separation of chromosomes in the
EK demonstrated that within the index strain of C. albicans there were three variants differing at the level of chromosome rearrangement (Fig. 3). This chromosomal rearrangement may be a form of
microevolution under antifungal azole pressure. As recommended by
several investigators (2, 9, 13, 14, 20), we used other
molecular methods to further determine the genotypic relatedness of
these variant isolates. The evidence from a combination of a PCR-based
method (IR-PCR) and Southern hybridization with CARE-2 supports the
hypothesis that these isolates are highly related.
View larger version (68K):
[in this window]
[in a new window]
|
FIG. 1.
(A) IR-PCR banding patterns generated from genomic DNA
of patients' isolates by using the primer pair 1245 and 1246. S1,
sibling 1; S2, sibling 2; M, mother; C, control lab isolate. (B)
Distinct IR-PCR banding patterns generated from genomic DNA of
unrelated clinical isolates of C. albicans: isolates 9329, 4389, 1672, and 2771. Each of these isolates was run in duplicate in
parallel lanes (lanes A and B) to document the reproducibility of the
gel pattern for each strain.
|
|
View larger version (68K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Southern hybridization of EcoRI-digested
genomic DNA of patients' isolates probed with a CARE-2 probe. S1,
sibling 1; S2, sibling 2; M, mother; C, control lab isolate. (B)
Distinct CARE-2 probe banding patterns generated from genomic DNA of
unrelated clinical isolates of C. albicans: isolates 9329, 4389, 1672, and 2771. Each of these isolates was run in duplicate in
parallel lanes (lanes A and B) to document the reproducibility of the
gel pattern for each strain.
|
|
View larger version (78K):
[in this window]
[in a new window]
|
FIG. 3.
Electrophoretic karyotypes of chromosomal DNA of
patients' isolates obtained by pulsed-field gel electrophoresis. S1,
sibling 1; S2, sibling 2; M, mother; C, control lab isolate. The
banding pattern is similar for all isolates of the index strain. Note
that there are three types of variants evidenced by alterations in
chromosomes.
|
|
Azole-resistant OPC in HIV-infected patients develops after long-term
exposure to azoles (15, 22, 23). However, our findings also
reveal that transmission from symptomatic to asymptomatic family
members is possible and perhaps represents a previously underappreciated factor in families with HIV infection, among whom more
than one family member is at risk for serious and chronic complications
of OPC. Asymptomatic family members, who have not received antifungal
therapy, may also be colonized with azole-resistant C. albicans. The mode of transmission of azole-resistant C. albicans among siblings and parents may be the exchange of
contaminated fomites, which commonly occurs in the sharing of food,
utensils, and toys. The acquisition of an azole-resistant strain of
C. albicans by an asymptomatic HIV-infected patient has
important clinical implications and may result in de novo presentation
of OPC refractory to initial azole therapy. The consequence is earlier
use of AMB, a more toxic and inconvenient treatment alternative. Other
families with children suffering from immunodeficiencies such as severe combined immunodeficiency, Wiskott-Aldrich syndrome, or chronic granulomatous disease carry similar risks for intrafamilial
transmission of azole-resistant C. albicans and should be
included in future infection control programs.
| |
ACKNOWLEDGMENTS |
We are grateful to Beatrice B. Magee and Paul T. Magee for the
discussion of chromosome variants.
F.-M. C. Müller was supported by a grant from the
Bundesministerium für Bildung und Forschung (BMBF).
| |
FOOTNOTES |
*
Corresponding author. Mailing address for Frank-Michael
C. Müller: Institut für Molekulare Infektionsbiologie,
Universität Würzburg, Röntgenring 11, D-97070
Würzburg, Germany. Phone: 49-931-312575. Fax: 49-931-312578. E-mail: fmmueller{at}mail.uni-wuerzburg.de. Mailing address
for Thomas J. Walsh: Immunocompromised Host Section, Pediatric Oncology
Branch, National Cancer Institute, Building 10, Room 13N240, Bethesda,
MD 20892. Phone: (301) 402-0023. Fax: (301) 402-0575. E-mail:
walsht{at}mail.nih.gov.
| |
REFERENCES |
| 1.
|
Barchiesi, F.,
R. J. Hollis,
M. D. Poeta,
D. A. McGough,
G. Scalise,
M. G. Rinaldi, and M. A. Pfaller.
1995.
Transmission of fluconazole-resistant Candida albicans between patients with AIDS and oropharyngeal candidiasis documented by pulsed-field gel electrophoresis.
Clin. Infect. Dis.
21:561-564[Medline].
|
| 2.
|
Barton, R. C.,
A. van Belkum, and S. Scherer.
1995.
Stability of karyotype in serial isolates of Candida albicans from neutropenic patients.
J. Clin. Microbiol.
33:794-796[Abstract].
|
| 3.
|
Boerlin, P.,
M. Addo,
F. Boerlin-Petzold,
C. Durussel,
J. L. Pagani,
J. P. Chave, and J. Bille.
1995.
Transmission of oral Candida albicans strains between HIV-positive patients.
Lancet
345:1052-1053[Medline].
|
| 4.
|
Cartledge, J. D.,
J. Midgley, and B. G. Gazzard.
1998.
Transmission of fluconazole-resistant Candida strains between HIV-positive patients and their sexual partners.
AIDS
12:1249-1251[Medline].
|
| 5.
|
Diaz-Guerra, T. M.,
J. V. Martinez-Suarez,
F. Laguna,
E. Valencia, and J. L. Rodriguez-Tudela.
1998.
Change in fluconazole susceptibility patterns and genetic relationship among oral Candida albicans isolates.
AIDS
12:1601-1610[Medline].
|
| 6.
|
Dromer, F.,
L. Improvisi,
B. Dupont,
M. Eliaszewicz,
G. Pialoux,
S. Fournier, and V. Feuillie.
1997.
Oral transmission of Candida albicans between partners in HIV-infected couples could contribute to dissemination of fluconazole-resistant isolates.
AIDS
15:1095-1101.
|
| 7.
|
Lasker, B. A.,
L. S. Page,
T. J. Lott, and G. S. Kobayashi.
1992.
Isolation, characterization and sequencing of Candida albicans repetitive element 2.
Gene
116:51-57[Medline].
|
| 8.
| Magee, B., and P. T. Magee. Personal
communication.
|
| 9.
|
Merz, W. G.
1990.
Candida albicans strain delineation.
Clin. Microbiol. Rev.
3:321-334[Abstract/Free Full Text].
|
| 10.
|
Millon, L.,
A. Manteaux,
G. Reboux,
C. Drobacheff,
M. Monod,
T. Barale, and Y. Michel-Briand.
1994.
Fluconazole-resistant recurrent oral candidiasis in human immunodeficiency virus-positive patients: persistence of Candida albicans strains with the same genotype.
J. Clin. Microbiol.
32:1115-1118[Abstract/Free Full Text].
|
| 11.
|
Müller, F. M. C.,
M. Kasai,
A. Francesconi,
B. Rishforth,
M. McEvoy,
J. Peter,
S. J. Chanock, and T. J. Walsh.
1999.
Transmission of azole-resistant isogenic Candida albicans strains among HIV-infected family members with oropharyngeal candidiasis, abstr. C36, p. 58-59.
In
Abstracts of the 5th Candida and Candidiasis Conference of the American Society for Microbiology. American Society for Microbiology, Washington, D.C.
|
| 12.
|
National Committee for Clinical Laboratory Standards.
1997.
Reference method for broth dilution antifungal susceptibility testing of yeasts; approved standard. NCCLS M27-A, vol. 17, no. 9.
National Committee for Clinical Laboratory Standards, Villanova, Pa.
|
| 13.
|
Odds, F. C.,
D. L. Brawner,
J. Staudinger,
P. T. Magee, and D. R. Soll.
1992.
Typing of Candida albicans strains.
J. Med. Vet. Mycol.
1:87-94.
|
| 14.
|
Pfaller, M. A.
1995.
Epidemiology of fungal infections: the promise of molecular typing.
Clin. Infect. Dis.
20:1535-1539[Medline].
|
| 15.
|
Rex, J. H.,
M. G. Rinaldi, and M. A. Pfaller.
1995.
Resistance of Candida species to fluconazole.
Antimicrob. Agents Chemother.
39:1-8[Medline].
|
| 16.
|
Ruhnke, M.,
I. Grosch-Wörner,
A. Steinmüller, and A. Neubauer.
1997.
Molecular epidemiology of Candida infections in HIV-infected mothers and their children.
Wien. Med. Wochenschr.
147:446-449[Medline].
|
| 17.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 18.
|
Sangeorzan, J. A.,
S. F. Bradley,
X. He,
L. T. Zarins,
G. L. Ridenour,
R. N. Tiballi, and C. A. Kauffman.
1994.
Epidemiology of oral candidiasis in HIV-infected patients: colonization, infection, treatment, and emergence of fluconazole resistance.
Am. J. Med.
97:339-346[Medline].
|
| 19.
| Scherer, S. 15 April 1999, posting date.
[Online.] Candida albicans information.
http://alces.med.umn.edu/Candida.html. [10 July 1999, last date
accessed.]
|
| 20.
|
Taylor, J. W.,
D. M. Geiser,
A. Burt, and V. Koufopanou.
1999.
The evolutionary biology and population genetics underlying fungal strain typing.
Clin. Microbiol. Rev.
12:126-146[Abstract/Free Full Text].
|
| 21.
|
van Belkum, A.,
W. Melchers,
B. E. de Pauw,
S. Scherer,
W. Quint, and J. F. Meis.
1994.
Genotypic characterization of sequential Candida albicans isolates from fluconazole-treated neutropenic patients.
J. Infect. Dis.
169:1062-1070[Medline].
|
| 22.
|
vanden Bossche, H.,
F. Dromer,
I. Improvisi,
M. Lozano-Chiu,
J. H. Rex, and D. Sanglard.
1998.
Antifungal drug resistance in pathogenic fungi.
Med. Mycol.
36:119-128.
|
| 23.
|
White, T. C.,
K. A. Marr, and R. A. Bowden.
1998.
Clinical, cellular, and molecular factors that contribute to antifungal drug resistance.
Clin. Microbiol. Rev.
11:382-402[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, October 1999, p. 3405-3408, Vol. 37, No. 10
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
de Repentigny, L., Lewandowski, D., Jolicoeur, P.
(2004). Immunopathogenesis of Oropharyngeal Candidiasis in Human Immunodeficiency Virus Infection. Clin. Microbiol. Rev.
17: 729-759
[Abstract]
[Full Text]
-
Makarova, N. U., Pokrowsky, V. V., Kravchenko, A. V., Serebrovskaya, L. V., James, M. J., McNeil, M. M., Lasker, B. A., Warnock, D. W., Reiss, E.
(2003). Persistence of Oropharyngeal Candida albicans Strains with Reduced Susceptibilities to Fluconazole among Human Immunodeficiency Virus-Seropositive Children and Adults in a Long-Term Care Facility. J. Clin. Microbiol.
41: 1833-1837
[Abstract]
[Full Text]
-
Bartie, K. L., Williams, D. W., Wilson, M. J., Potts, A. J. C., Lewis, M. A. O.
(2001). PCR Fingerprinting of Candida albicans Associated with Chronic Hyperplastic Candidosis and Other Oral Conditions. J. Clin. Microbiol.
39: 4066-4075
[Abstract]
[Full Text]
-
Weig, M., Müller, F.-M. C.
(2001). Synergism of Voriconazole and Terbinafine against Candida albicans Isolates from Human Immunodeficiency Virus-Infected Patients with Oropharyngeal Candidiasis. Antimicrob. Agents Chemother.
45: 966-968
[Abstract]
[Full Text]
Top
Abstract
Text
