JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Williams, K.
Right arrow Articles by Nicholson, B. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Williams, K.
Right arrow Articles by Nicholson, B. L.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, December 1999, p. 4139-4141, Vol. 37, No. 12
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Multiplex Reverse Transcriptase PCR Assay for Simultaneous Detection of Three Fish Virusesdagger

K. Williams,Dagger S. Blake, A. Sweeney,§ J. T. Singer, and B. L. Nicholson*

Department of Biochemistry, Microbiology and Molecular Biology, University of Maine, Orono, Maine 04469

Received 8 April 1999/Returned for modification 9 July 1999/Accepted 31 August 1999


    ABSTRACT
Top
Abstract
Text
References

A multiplex reverse transcriptase (RT)-PCR assay was developed for the simultaneous detection of three different fish viruses: infectious pancreatic necrosis virus (IPNV), infectious hematopoietic necrosis virus (IHNV), and viral hemorrhagic septicemia virus (VHSV). The sensitivity levels of the multiplex RT-PCR assay were 100, 1, and 32 50% tissue culture infective doses/ml for IPNV, IHNV, and VHSV, respectively.


    TEXT
Top
Abstract
Text
References

The aquatic birnaviruses are the largest and most diverse group of viruses within the family Birnaviridae and include a variety of viruses from numerous species of fish and marine invertebrates (12, 24). Many of these viruses, such as infectious pancreatic necrosis virus (IPNV), have been proven or implicated to be the etiological agents of diseases in a variety of species used in fish farming and aquaculture worldwide. Aquatic birnaviruses are characterized by a bisegmented, double-stranded RNA genome within a nonenveloped, icosahedral capsid approximately 60 nm in diameter (7). The smaller genome segment (B) encodes a single protein (VP1, 90 to 110 kDa), the virion-associated transcriptase. The larger genome segment (A) (approximately 3,000 bp) contains a large open reading frame that encodes a precursor polyprotein (100 kDa) which is subsequently cleaved to form three viral proteins (pVP2, 63 kDa; NS, 29 kDa; and VP3, 29 to 31 kDa) by protease activity associated with the NS protein (16). The proteins are encoded in the following order: pVP2, NS, and VP3. The pVP2 protein is further processed to yield the major capsid protein VP2 (50 to 55 kDa). The vast majority of aquatic birnaviruses, regardless of host species or geographic origin, are closely related antigenically and form a major serogroup (serogroup A) comprising nine serotypes (5, 6, 19).

Infectious hematopoietic necrosis virus (IHNV) is a member of the family Rhabdoviridae. It causes a lethal disease in several salmonid species (23). Epizootics of the disease generally occur in juvenile fish through waterborne horizontal transmission. Mortality levels from IHNV in the most susceptible species can reach 100%. In chronically infected populations, animals are typically debilitated and secondary bacterial infections are common. Viral hemorrhagic septicemia virus (VHSV) is another rhabdovirus which also causes a serious disease in several salmonid species (23). The disease has been found in all age groups of susceptible fish, with mortality rates reaching 80 to 100%, particularly in fry and fingerlings. It has presented serious problems to rainbow trout culture in Europe for over 50 years. Indeed, VHSV is arguably the most important cause of economic loss in the European trout farming industry. Moreover, cases of VHSV have been increasingly reported in other species, including brown trout, grayling, pike, and whitefish.

IHNV is a bullet-shaped virion 150 to 190 nm in length by 65 to 75 nm in diameter (11, 23). The enveloped, helical nucleocapsid contains a negative-sense, single-stranded RNA genome (14). The genome organization for the six separately translated genes is 3'-N, M1, M2, G, NV, L-5' (18). The proteins encoded by these viral genes are the nucleoprotein (N), matrix proteins (M1 and M2), the envelope glycoprotein (G), a nonvirion protein (NV), and the RNA polymerase (L). The morphology of VHSV is similar to those of IHNV and other rhabdoviruses. The virion is approximately 120 to 180 nm long by 60 to 90 nm wide. The viral RNA genome organization and gene products are similar to those of IHNV.

The aquatic birnavirus infectious pancreatic necrosis virus (IPNV) and the rhabdoviruses IHNV and VHSV are significant pathogens that cause high levels of mortality among artificially propagated populations of fish. Currently, the most effective method of controlling diseases caused by these viruses is by prevention of exposure of fish to the virus. Consequently, a number of countries, including the United States, have mandated fish health management programs that include inspections of artificially propagated fish for the presence of various fish pathogens, including these three viruses. The current method for detection of fish viruses requires isolation of virus by inoculation of cell cultures with homogenates of tissue samples collected from a statistically significant portion of the population (1). When a virus is isolated, identification of the virus is required. This usually is accomplished by neutralization tests with specific polyclonal antisera, which can take 1 to 4 weeks, or by enzyme immunoassays with monoclonal antibodies or polyclonal antisera (1, 5). However, individual PCR assays for detecting and identifying these fish viruses have been developed (2-4, 6, 8, 9, 15, 21-23). Increasingly, PCR assays are becoming incorporated into fish health management programs. However, the need to perform separate, individual PCR assays for each virus complicates the diagnostic process and increases the costs. McAllister et al. (17) demonstrated the potential of using a single PCR assay for the simultaneous identification of several fish viruses in a single PCR assay. Subsequently, however, it was shown that the IPNV-specific primers used in their investigation failed to identify all aquatic birnavirus serotypes (3).

In this investigation, we developed a multiplex PCR assay for the simultaneous detection of three fish viruses in a single assay: all serotypes of aquatic birnavirus serogroup A, IHNV, and VHSV. Routine testing for all three viruses is required in many fish health management programs worldwide.

Viruses and cell cultures. IPNV (West Buxton strain) and IHNV (unknown electropherotype) were propagated in Chinook salmon embryo 214 (13) cell cultures, and VHSV (Spain strain; provided by Paul Reno, Oregon State University, Newport) was propagated in epithelioma papulosum cyprini (10) cell cultures at 15 to 16°C in Eagle's minimum essential medium with L-glutamine and Earle's balanced salts solution (Sigma Chemical Co., St. Louis, Mo.) supplemented with 0.2% sodium bicarbonate (Sigma Chemical Co.) and 10% fetal bovine serum (Atlanta Biologicals, Norcross, Ga.).

RNA extraction and reverse transcription. Total RNA was extracted from 90 to 300 µl of infected cell culture supernatant with TriReagent LS (Sigma Chemical Co.) by the protocol supplied by the manufacturer. Viral cDNA was obtained by reverse transcription by incubating 4 µl of viral RNA preparation with 1 µl of random hexamer primers (1.25 mM random primer; Promega) and 2.2 µl of nuclease-free water (Promega) at 80°C for 5 min, followed by cooling to 37°C for 5 min. The sample was brought to a final volume of 20 µl with a reverse transcription mixture consisting of 4 µl of 5× reverse transcriptase (RT) buffer (250 mM Tris-HCl, 375 mM KCl, 15 mM MgCl2, 50 mM dithiothreitol [pH 8.3]; Promega), 200 U of Moloney murine leukemia virus RT (Promega), 20 U of RNasin (Promega), and 200 µM each dNTP. The cDNA was synthesized at 37°C for 1 h, and the reaction was terminated by heating to 95°C for 5 min.

Primers. The aquatic birnavirus-specific primers WB1 and WB2 (WB1, CCGCAACTTACTTGAGATCCATTATGC; WB2, CGTCTGGTTCAGATTCCACCTGTAGTG) and the IHNV-specific primers IHN3 and IHN4 (IHN3, GTTCAACTTCAACGCCAACAGG; IHN4, TGAAGTACCCCACCCCGAGCATCC) had been developed previously in our laboratory (22). Primers WB1 and WB2 (which recognize a 206-bp cDNA fragment within the VP2 gene of aquatic birnaviruses) previously had been shown to identify representative isolates of all nine serotypes of aquatic birnavirus serogroup A (23). Primers IHN3 and IHN4 recognize a 371-bp cDNA fragment within the N gene of IHNV.

Several sets of VHSV-specific primers were designed and evaluated with the aim of developing primers to specifically identify VHSV and not produce any amplification products from the other rhabdovirus, IHNV. Bruchhof et al. (4) determined that VHSV and IHNV could not be differentiated based on genomic sequences of the N gene. Considerable variation in the matrix protein genes (M1 and M2) has been demonstrated among the VHSV serotypes, and the NV genes of the North American and European strains of VHSV are markedly dissimilar. Little genomic sequence information is available for the L gene. However, considerable sequence information is available for the G gene of VHSV. Therefore, the G gene of VHSV was chosen as the target for RT-PCR amplification in this investigation. G gene sequences, including conserved regions, were available for the four serotypes from the following strains: Makah (representing the North American isolates, serotype 1), He-70 (Denmark, serotype 2), 23/75 (France, serotype 3), and 02-84 (France, serotype 4). These sequences were aligned and used to design primers that would identify common, conserved sequence fragments with the program Oligo (National Biosciences, Inc., Plymouth, Minn.). Ultimately, primers VHS3 and VHS4 (VHS3, CGGCCAGCTCAACTCAGGTGTCC; VHS4, CCAGGTCGGTCCTGATCCATTCTGTC), which amplify a 625-bp cDNA fragment within the G gene, were selected for use in the multiplex RT-PCR assay.

Multiplex PCR. For multiplex RT-PCR, IPNV, IHNV, and VHSV viral RNA templates were reverse transcribed simultaneously, and PCR was performed with different combinations of multiple primer pairs for each virus. Various thermal cycler programs were evaluated to optimize the reaction conditions. In the optimal procedure, PCR was performed with 10 µl of reverse transcribed cDNA in a 50-µl reaction mixture consisting of 4 µl of 10× PCR buffer (500 mM KCl, 100 mM Tris-HCl [pH 9.0], 1.0% Triton X-100; Promega), 1.5 mM MgCl2, 0.5 to 0.6 µM each primer, and 5 U of AmpliTaq DNA polymerase (Perkin-Elmer Co.). Amplification (40 cycles) was performed in an MJ Research (PTC-100) programmable thermal cycler by the following protocol: initial denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min 30 s, and final extension at 72°C for 10 min. Agarose gel electrophoresis was used to separate the PCR products. Agarose gels (2% agarose; SeaKem LE; FMC, Rockland, Maine) containing 0.5 µg of ethidium bromide per ml in 1× TAE electrophoresis buffer (40 mM Tris, 20 mM acetate, 2 mM EDTA) were loaded with 12 µl of PCR sample and electrophoresed at 65 V for 2 h or 100 V for 1 h. Either PCR Markers (50 to 1,000 bp), 100-bp DNA ladder (100 to 2,072 bp), or an HaeIII-digested phi X174 DNA (118 to 1,353 bp) molecular weight standard was also electrophoresed on each gel. A UV transilluminator was used to visualize the bands, and results were recorded by photography.

Typical ethidium bromide-stained agarose gels of the amplification products of the multiplex RT-PCR assay are shown in Fig. 1. Figure 1A shows amplification by the multiplex RT-PCR assay from infected cell culture supernatants of each viral template separately and of all three target templates from a mixture of the three viruses. Also, the multiplex RT-PCR assay was tested for ability to amplify the three viral templates from uninfected kidney and spleen tissue homogenates from Atlantic salmon which had been mock infected with all three viruses. Figure 1B shows amplification of all three viral templates from both infected cell culture supernatants and mock-infected tissue homogenates.


View larger version (72K):
[in this window]
[in a new window]
 
FIG. 1.   Typical agarose gels showing simultaneous RT-PCR identification of IPNV (West Buxton strain), IHNV, and VHSV. (A) Lane 1, IPNV alone; lane 2, IHNV alone; lane 3, VHSV alone; lane 4, multiplex RT-PCR (IPNV plus IHNV plus VHSV); lane 5, HaeIII-digested phi X174 DNA marker ladder (118 to 1,353 bp). (B) Lane 1, negative cell culture control; lane 2, multiplex RT-PCR (IPNV plus IHNV plus VHSV from infected cell culture supernatants); lane 3, HaeIII-digested phi X174 DNA marker ladder (118 to 1,353 bp); lane 4, multiplex RT-PCR (IPNV plus IHNV plus VHSV from mock-infected fish tissue [kidney and spleen] homogenates).

Sensitivity of multiplex PCR assay. The sensitivity of the PCR assay was determined with 10-fold serial dilutions of each virus. RNA was extracted from 90 µl of each sample. RT-PCR was performed as previously described. The sensitivity was determined from the highest dilution of the sample exhibiting a positive PCR result. The sensitivity levels of the multiplex RT-PCR assay were 100, 1, and 32 50% tissue culture infective doses [TCID50]/ml by the method of Reed and Muench [20]) for IPNV, IHNV, and VHSV, respectively (Fig. 2). These levels of sensitivity are comparable to those of direct isolation of virus in cell culture with dilutions of fish tissue homogenates.


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 2.   Agarose gel showing sensitivity of multiplex RT-PCR assay for detection of virus in infected cell culture supernatants. Lanes 1 to 7, IPNV (107.0, 106.0, 105.0, 104.0, 103.0, 102.0, and 101.0 TCID50/ml, respectively), IHNV (106.0, 105.0, 104.0, 103.0, 102.0, 101.0 and 100 TCID50/ml, respectively), and VHSV (106.5, 105.5, 104.5, 103.5, 102.5, and 101.5 and 100 TCID50/ml, respectively); lane 8, HaeIII-digested phi X174 DNA marker ladder (118 to 1,353 bp).

In summary, the multiplex RT-PCR assay, which can be completed in 48 h or less, provides significant savings in time, cost, and materials in comparison to the antibody neutralization tests or the separate, individual PCR assays presently used to identify viruses isolated in cell culture from clinical materials. Furthermore, the data presented here and from other preliminary investigations (data not shown) in our laboratory indicate that the multiplex RT-PCR assay compares in sensitivity to isolation of virus in cell cultures for the direct detection of these viruses in clinical specimens. Confirmation of the sensitivity of the multiplex RT-PCR assay in field trials using tissue samples from naturally infected fish will provide a diagnostic assay with significant advantages over the current method of virus isolation in cell culture, which requires 3 to 4 weeks.


    ACKNOWLEDGMENTS

This work was supported by grants from the NOAA Sea Grant (R/FMD-217 and R/FMD-235), the NSF EPSCoR Program (EHR 91-08766), and the Maine Agricultural and Forest Experiment Station.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Biochemistry, Microbiology and Molecular Biology, University of Maine, Orono, ME 04469. Phone: (207) 581-2800. Fax: (207) 581-2801. E-mail: brucen{at}maine.maine.edu.

dagger Maine Agricultural and Forest Experiment Station publication no. 2369.

Dagger Present address: DNA Sequencing Facility, University of Maine, Orono, ME 04469-5735.

§ Present address: Department of Dermatology, University of North Carolina, Chapel Hill, NC 27599.


    REFERENCES
Top
Abstract
Text
References

1. Amos, K. H., K. A. Hopper, and L. LeVander. 1989. Absence of infectious hematopoietic necrosis virus in adult sockeye salmon. J. Aquat. Anim. Health 1:281-283.
2. Arakawa, C. K., R. E. Deering, K. H. Higman, K. H. Oshima, P. J. O'Hara, and J. R. Winton. 1990. Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus. Dis. Aquat. Org. 8:165-170.
3. Blake, S. L., W. B. Schill, P. E. McAllister, M. K. Lee, J. T. Singer, and B. L. Nicholson. 1995. Detection and identification of aquatic birnaviruses by PCR assay. J. Clin. Microbiol. 33:835-839[Abstract].
4. Bruchhof, B., O. Marquardt, and P.-J. Enzmann. 1995. Differential diagnosis of fish pathogenic rhabdoviruses by reverse transcriptase-dependent polymerase chain reaction. J. Virol. Methods 55:111-119[Medline].
5. Caswell-Reno, P., V. Lipipun, P. W. Reno, and B. L. Nicholson. 1989. Use of a group-reactive and other monoclonal antibodies in an enzyme immunodot assay for identification and presumptive serotyping of aquatic birnaviruses. J. Clin. Microbiol. 27:1924-1929[Abstract/Free Full Text].
6. Chiou, P. P., B. S. Drolet, and J. C. Leong. 1995. Polymerase chain amplification of infectious hematopoietic necrosis virus RNA extracted from fixed and embedded fish tissue. J. Aquat. Anim. Health 7:9-15.
7. Dobos, P., B. J. Hill, R. Hallett, D. T. C. Kells, H. Becht, and D. Teninges. 1979. Biophysical and biochemical characterization of five animal viruses with bisegmented double-stranded RNA genomes. J. Virol. 32:593-605[Abstract/Free Full Text].
8. Einer-Jensen, K., N. J. Olesen, N. Lorenzen, and P. E. V. Jorgensen. 1995. Use of the polymerase chain reaction (PCR) to differentiate serologically similar viral haemorrhagic septicemia (VHS) virus isolates from Europe and America. Vet. Res. 26:464-469[Medline].
9. Estepa, A., C. De Blas, F. Ponz, and J. M. Coll. 1995. Detection of trout haemorrhagic septicaemia rhabdovirus by capture with monoclonal antibodies and amplification with PCR. Vet. Res. 26:530-532[Medline].
10. Fijan, N., D. Sulimanovic, M. Bearzotti, D. Muzinic, L. O. Zwillenberg, S. Chilmonoczyk, J. F. Vautherot, and P. De Kinkelin. 1983. Some properties of Epithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Ann. Virol. (Paris) 134:207-220.
11. Hill, B. J. 1975. Physico-chemical and serological characterization of five rhabdoviruses infecting fish. J. Gen. Virol. 27:369-378[Abstract/Free Full Text].
12. Hill, B. J., and K. Way. 1983. Serological classification of fish and shellfish birnaviruses, Abstracts of the First International Conference of the European Association for Fish Pathology. European Association of Fish Pathologists, Plymouth, England, p. 10. .
13. Lannan, C. N., J. R. Winton, and J. L. Fryer. 1984. Fish cell lines: establishment and characterization of nine cell lines from salmonids. In Vitro 20:107-144.
14. Levy, J. A., H. Fraenkel-Conrat, and R. A. Owens. 1994. Virology, p. 77-84. Prentice Hall, Inc., Englewood Cliffs, N.J.
15. Lopez-Lastra, M., M. Gonzalez, M. Jashes, and A. M. Sandino. 1994. A detection method for infectious pancreatic necrosis virus (IPNV) based on reverse transcription (RT)-polymerase chain reaction (PCR). J. Fish Dis. 17:269-282.
16. Manning, D. S., and J. C. Leong. 1990. Expression in Escherichia coli of the large genomic segment of infectious pancreatic necrosis virus. Virology 179:16-25[Medline].
17. McAllister, P. E., W. B. Schill, W. J. Owens, and D. L. Hodge. 1991. Infectious pancreatic necrosis virus: a comparison of methods used to detect and identify virus in fluids and tissues of fish, p. 191-201. In J. L. Fryer (ed.), Proceedings of the Second International Symposium of Viruses of Lower Vertebrates. Oregon State University, Corvallis, Oreg.
18. Morzunov, S. P., J. R. Winton, and S. T. Nichol. 1995. The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus. Virus Res. 38:175-192[Medline].
19. Nicholson, B. L. 1993. Use of monoclonal antibodies in fish disease research. Annu. Rev. Fish Dis. 1993:241-257.
20. Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty percent end points. Am. J. Hyg. 27:493-497.
21. Rodriguez, S., M. P. Vilas, M. Alonso, and S. L. Perez. 1995. Study of a viral-dual infection in rainbow trout (Oncorhynchus mykiss) by seroneutralization, Western blot, and polymerase chain reaction assays. Microbiol. Semin. 11:461-470.
22. Sweeney, A. 1996. Multiplex PCR assay for the simultaneous detection of IPNV and IHNV. M.S. thesis. University of Maine, Orono, Maine.
23. Sweeney, A., S. Blake, J. T. Singer, and B. L. Nicholson. 1997. Detection and identification of infectious pancreatic necrosis virus (IPNV) and infectious hematopoietic necrosis virus (IHNV) by polymerase chain reaction (PCR), p. 42-47. In Y. Inui, and J. Winton (ed.), New approaches to viral disease of aquatic animals. National Research Institute of Aquaculture, Nansei, Japan.
24. Wolf, K. 1988. Fish viruses and fish viral diseases, Cornell University Press, Ithaca, N.Y., p. 83-158. , 217-249.


Journal of Clinical Microbiology, December 1999, p. 4139-4141, Vol. 37, No. 12
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Williams, K.
Right arrow Articles by Nicholson, B. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Williams, K.
Right arrow Articles by Nicholson, B. L.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS