Previous Article | Next Article ![]()
Journal of Clinical Microbiology, December 1999, p. 4139-4141, Vol. 37, No. 12
Department of Biochemistry, Microbiology and
Molecular Biology, University of Maine, Orono, Maine 04469
Received 8 April 1999/Returned for modification 9 July
1999/Accepted 31 August 1999
A multiplex reverse transcriptase (RT)-PCR assay was developed for
the simultaneous detection of three different fish viruses: infectious
pancreatic necrosis virus (IPNV), infectious hematopoietic necrosis
virus (IHNV), and viral hemorrhagic septicemia virus (VHSV). The
sensitivity levels of the multiplex RT-PCR assay were 100, 1, and 32 50% tissue culture infective doses/ml for IPNV, IHNV, and VHSV, respectively.
The aquatic birnaviruses are the
largest and most diverse group of viruses within the family
Birnaviridae and include a variety of viruses from numerous
species of fish and marine invertebrates (12, 24). Many of
these viruses, such as infectious pancreatic necrosis virus (IPNV),
have been proven or implicated to be the etiological agents of diseases
in a variety of species used in fish farming and aquaculture worldwide.
Aquatic birnaviruses are characterized by a bisegmented,
double-stranded RNA genome within a nonenveloped, icosahedral capsid
approximately 60 nm in diameter (7). The smaller genome
segment (B) encodes a single protein (VP1, 90 to 110 kDa), the
virion-associated transcriptase. The larger genome segment (A)
(approximately 3,000 bp) contains a large open reading frame that
encodes a precursor polyprotein (100 kDa) which is subsequently cleaved
to form three viral proteins (pVP2, 63 kDa; NS, 29 kDa; and VP3, 29 to
31 kDa) by protease activity associated with the NS protein
(16). The proteins are encoded in the following order: pVP2,
NS, and VP3. The pVP2 protein is further processed to yield the major
capsid protein VP2 (50 to 55 kDa). The vast majority of aquatic
birnaviruses, regardless of host species or geographic origin, are
closely related antigenically and form a major serogroup (serogroup A)
comprising nine serotypes (5, 6, 19).
Infectious hematopoietic necrosis virus (IHNV) is a member of the
family Rhabdoviridae. It causes a lethal disease in several salmonid species (23). Epizootics of the disease generally
occur in juvenile fish through waterborne horizontal transmission.
Mortality levels from IHNV in the most susceptible species can reach
100%. In chronically infected populations, animals are typically
debilitated and secondary bacterial infections are common. Viral
hemorrhagic septicemia virus (VHSV) is another rhabdovirus which also
causes a serious disease in several salmonid species (23).
The disease has been found in all age groups of susceptible fish, with
mortality rates reaching 80 to 100%, particularly in fry and
fingerlings. It has presented serious problems to rainbow trout culture
in Europe for over 50 years. Indeed, VHSV is arguably the most
important cause of economic loss in the European trout farming
industry. Moreover, cases of VHSV have been increasingly reported in
other species, including brown trout, grayling, pike, and whitefish.
IHNV is a bullet-shaped virion 150 to 190 nm in length by 65 to 75 nm
in diameter (11, 23). The enveloped, helical nucleocapsid contains a negative-sense, single-stranded RNA genome (14). The genome organization for the six separately translated genes is
3'-N, M1, M2, G, NV, L-5' (18). The proteins encoded by
these viral genes are the nucleoprotein (N), matrix proteins (M1 and M2), the envelope glycoprotein (G), a nonvirion protein (NV), and the
RNA polymerase (L). The morphology of VHSV is similar to those of IHNV
and other rhabdoviruses. The virion is approximately 120 to 180 nm long
by 60 to 90 nm wide. The viral RNA genome organization and gene
products are similar to those of IHNV.
The aquatic birnavirus infectious pancreatic necrosis virus (IPNV) and
the rhabdoviruses IHNV and VHSV are significant pathogens that cause
high levels of mortality among artificially propagated populations of
fish. Currently, the most effective method of controlling diseases
caused by these viruses is by prevention of exposure of fish to the
virus. Consequently, a number of countries, including the United
States, have mandated fish health management programs that include
inspections of artificially propagated fish for the presence of various
fish pathogens, including these three viruses. The current method for
detection of fish viruses requires isolation of virus by inoculation of
cell cultures with homogenates of tissue samples collected from a
statistically significant portion of the population (1).
When a virus is isolated, identification of the virus is required. This
usually is accomplished by neutralization tests with specific
polyclonal antisera, which can take 1 to 4 weeks, or by enzyme
immunoassays with monoclonal antibodies or polyclonal antisera (1,
5). However, individual PCR assays for detecting and identifying
these fish viruses have been developed (2-4, 6, 8, 9, 15,
21-23). Increasingly, PCR assays are becoming incorporated into
fish health management programs. However, the need to perform separate,
individual PCR assays for each virus complicates the diagnostic process
and increases the costs. McAllister et al. (17) demonstrated
the potential of using a single PCR assay for the simultaneous
identification of several fish viruses in a single PCR assay.
Subsequently, however, it was shown that the IPNV-specific primers used
in their investigation failed to identify all aquatic birnavirus
serotypes (3).
In this investigation, we developed a multiplex PCR assay for the
simultaneous detection of three fish viruses in a single assay: all
serotypes of aquatic birnavirus serogroup A, IHNV, and VHSV. Routine
testing for all three viruses is required in many fish health
management programs worldwide.
Viruses and cell cultures.
IPNV (West Buxton strain) and IHNV
(unknown electropherotype) were propagated in Chinook salmon embryo 214 (13) cell cultures, and VHSV (Spain strain; provided by Paul
Reno, Oregon State University, Newport) was propagated in epithelioma
papulosum cyprini (10) cell cultures at 15 to 16°C in
Eagle's minimum essential medium with L-glutamine and
Earle's balanced salts solution (Sigma Chemical Co., St. Louis, Mo.)
supplemented with 0.2% sodium bicarbonate (Sigma Chemical Co.) and
10% fetal bovine serum (Atlanta Biologicals, Norcross, Ga.).
RNA extraction and reverse transcription.
Total RNA was
extracted from 90 to 300 µl of infected cell culture supernatant with
TriReagent LS (Sigma Chemical Co.) by the protocol supplied by the
manufacturer. Viral cDNA was obtained by reverse transcription by
incubating 4 µl of viral RNA preparation with 1 µl of random
hexamer primers (1.25 mM random primer; Promega) and 2.2 µl of
nuclease-free water (Promega) at 80°C for 5 min, followed by cooling
to 37°C for 5 min. The sample was brought to a final volume of 20 µl with a reverse transcription mixture consisting of 4 µl of 5×
reverse transcriptase (RT) buffer (250 mM Tris-HCl, 375 mM KCl, 15 mM
MgCl2, 50 mM dithiothreitol [pH 8.3]; Promega), 200 U of
Moloney murine leukemia virus RT (Promega), 20 U of RNasin
(Promega), and 200 µM each dNTP. The cDNA was synthesized at 37°C
for 1 h, and the reaction was terminated by heating to 95°C for
5 min.
Primers.
The aquatic birnavirus-specific primers WB1 and
WB2 (WB1, CCGCAACTTACTTGAGATCCATTATGC; WB2,
CGTCTGGTTCAGATTCCACCTGTAGTG) and the IHNV-specific primers
IHN3 and IHN4 (IHN3, GTTCAACTTCAACGCCAACAGG; IHN4,
TGAAGTACCCCACCCCGAGCATCC) had been developed previously in
our laboratory (22). Primers WB1 and WB2 (which recognize a
206-bp cDNA fragment within the VP2 gene of aquatic birnaviruses) previously had been shown to identify representative isolates of all
nine serotypes of aquatic birnavirus serogroup A (23). Primers IHN3 and IHN4 recognize a 371-bp cDNA fragment within the N
gene of IHNV.
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Multiplex Reverse Transcriptase PCR Assay for
Simultaneous Detection of Three Fish Viruses

![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References
Multiplex PCR.
For multiplex RT-PCR, IPNV, IHNV, and VHSV
viral RNA templates were reverse transcribed simultaneously, and PCR
was performed with different combinations of multiple primer pairs for
each virus. Various thermal cycler programs were evaluated to optimize the reaction conditions. In the optimal procedure, PCR was performed with 10 µl of reverse transcribed cDNA in a 50-µl reaction mixture consisting of 4 µl of 10× PCR buffer (500 mM KCl, 100 mM Tris-HCl [pH 9.0], 1.0% Triton X-100; Promega), 1.5 mM MgCl2, 0.5 to 0.6 µM each primer, and 5 U of AmpliTaq DNA polymerase
(Perkin-Elmer Co.). Amplification (40 cycles) was performed in an MJ
Research (PTC-100) programmable thermal cycler by the following
protocol: initial denaturation at 94°C for 4 min, denaturation at
94°C for 30 s, annealing at 60°C for 30 s, extension at
72°C for 1 min 30 s, and final extension at 72°C for 10 min.
Agarose gel electrophoresis was used to separate the PCR products.
Agarose gels (2% agarose; SeaKem LE; FMC, Rockland, Maine) containing
0.5 µg of ethidium bromide per ml in 1× TAE electrophoresis buffer
(40 mM Tris, 20 mM acetate, 2 mM EDTA) were loaded with 12 µl of PCR
sample and electrophoresed at 65 V for 2 h or 100 V for 1 h.
Either PCR Markers (50 to 1,000 bp), 100-bp DNA ladder (100 to 2,072 bp), or an HaeIII-digested
X174 DNA (118 to 1,353 bp)
molecular weight standard was also electrophoresed on each gel. A UV
transilluminator was used to visualize the bands, and results were
recorded by photography.
|
Sensitivity of multiplex PCR assay. The sensitivity of the PCR assay was determined with 10-fold serial dilutions of each virus. RNA was extracted from 90 µl of each sample. RT-PCR was performed as previously described. The sensitivity was determined from the highest dilution of the sample exhibiting a positive PCR result. The sensitivity levels of the multiplex RT-PCR assay were 100, 1, and 32 50% tissue culture infective doses [TCID50]/ml by the method of Reed and Muench [20]) for IPNV, IHNV, and VHSV, respectively (Fig. 2). These levels of sensitivity are comparable to those of direct isolation of virus in cell culture with dilutions of fish tissue homogenates.
|
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the NOAA Sea Grant (R/FMD-217 and R/FMD-235), the NSF EPSCoR Program (EHR 91-08766), and the Maine Agricultural and Forest Experiment Station.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Biochemistry, Microbiology and Molecular Biology, University of Maine, Orono, ME 04469. Phone: (207) 581-2800. Fax: (207) 581-2801. E-mail: brucen{at}maine.maine.edu.
Maine Agricultural and Forest Experiment Station publication no. 2369.
Present address: DNA Sequencing Facility, University of Maine,
Orono, ME 04469-5735.
§ Present address: Department of Dermatology, University of North Carolina, Chapel Hill, NC 27599.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Amos, K. H., K. A. Hopper, and L. LeVander. 1989. Absence of infectious hematopoietic necrosis virus in adult sockeye salmon. J. Aquat. Anim. Health 1:281-283. |
| 2. | Arakawa, C. K., R. E. Deering, K. H. Higman, K. H. Oshima, P. J. O'Hara, and J. R. Winton. 1990. Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus. Dis. Aquat. Org. 8:165-170. |
| 3. | Blake, S. L., W. B. Schill, P. E. McAllister, M. K. Lee, J. T. Singer, and B. L. Nicholson. 1995. Detection and identification of aquatic birnaviruses by PCR assay. J. Clin. Microbiol. 33:835-839[Abstract]. |
| 4. | Bruchhof, B., O. Marquardt, and P.-J. Enzmann. 1995. Differential diagnosis of fish pathogenic rhabdoviruses by reverse transcriptase-dependent polymerase chain reaction. J. Virol. Methods 55:111-119[Medline]. |
| 5. |
Caswell-Reno, P.,
V. Lipipun,
P. W. Reno, and B. L. Nicholson.
1989.
Use of a group-reactive and other monoclonal antibodies in an enzyme immunodot assay for identification and presumptive serotyping of aquatic birnaviruses.
J. Clin. Microbiol.
27:1924-1929 |
| 6. | Chiou, P. P., B. S. Drolet, and J. C. Leong. 1995. Polymerase chain amplification of infectious hematopoietic necrosis virus RNA extracted from fixed and embedded fish tissue. J. Aquat. Anim. Health 7:9-15. |
| 7. |
Dobos, P.,
B. J. Hill,
R. Hallett,
D. T. C. Kells,
H. Becht, and D. Teninges.
1979.
Biophysical and biochemical characterization of five animal viruses with bisegmented double-stranded RNA genomes.
J. Virol.
32:593-605 |
| 8. | Einer-Jensen, K., N. J. Olesen, N. Lorenzen, and P. E. V. Jorgensen. 1995. Use of the polymerase chain reaction (PCR) to differentiate serologically similar viral haemorrhagic septicemia (VHS) virus isolates from Europe and America. Vet. Res. 26:464-469[Medline]. |
| 9. | Estepa, A., C. De Blas, F. Ponz, and J. M. Coll. 1995. Detection of trout haemorrhagic septicaemia rhabdovirus by capture with monoclonal antibodies and amplification with PCR. Vet. Res. 26:530-532[Medline]. |
| 10. | Fijan, N., D. Sulimanovic, M. Bearzotti, D. Muzinic, L. O. Zwillenberg, S. Chilmonoczyk, J. F. Vautherot, and P. De Kinkelin. 1983. Some properties of Epithelioma papulosum cyprini (EPC) cell line from carp Cyprinus carpio. Ann. Virol. (Paris) 134:207-220. |
| 11. |
Hill, B. J.
1975.
Physico-chemical and serological characterization of five rhabdoviruses infecting fish.
J. Gen. Virol.
27:369-378 |
| 12. | Hill, B. J., and K. Way. 1983. Serological classification of fish and shellfish birnaviruses, Abstracts of the First International Conference of the European Association for Fish Pathology. European Association of Fish Pathologists, Plymouth, England, p. 10. . |
| 13. | Lannan, C. N., J. R. Winton, and J. L. Fryer. 1984. Fish cell lines: establishment and characterization of nine cell lines from salmonids. In Vitro 20:107-144. |
| 14. | Levy, J. A., H. Fraenkel-Conrat, and R. A. Owens. 1994. Virology, p. 77-84. Prentice Hall, Inc., Englewood Cliffs, N.J. |
| 15. | Lopez-Lastra, M., M. Gonzalez, M. Jashes, and A. M. Sandino. 1994. A detection method for infectious pancreatic necrosis virus (IPNV) based on reverse transcription (RT)-polymerase chain reaction (PCR). J. Fish Dis. 17:269-282. |
| 16. | Manning, D. S., and J. C. Leong. 1990. Expression in Escherichia coli of the large genomic segment of infectious pancreatic necrosis virus. Virology 179:16-25[Medline]. |
| 17. | McAllister, P. E., W. B. Schill, W. J. Owens, and D. L. Hodge. 1991. Infectious pancreatic necrosis virus: a comparison of methods used to detect and identify virus in fluids and tissues of fish, p. 191-201. In J. L. Fryer (ed.), Proceedings of the Second International Symposium of Viruses of Lower Vertebrates. Oregon State University, Corvallis, Oreg. |
| 18. | Morzunov, S. P., J. R. Winton, and S. T. Nichol. 1995. The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus. Virus Res. 38:175-192[Medline]. |
| 19. | Nicholson, B. L. 1993. Use of monoclonal antibodies in fish disease research. Annu. Rev. Fish Dis. 1993:241-257. |
| 20. | Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty percent end points. Am. J. Hyg. 27:493-497. |
| 21. | Rodriguez, S., M. P. Vilas, M. Alonso, and S. L. Perez. 1995. Study of a viral-dual infection in rainbow trout (Oncorhynchus mykiss) by seroneutralization, Western blot, and polymerase chain reaction assays. Microbiol. Semin. 11:461-470. |
| 22. | Sweeney, A. 1996. Multiplex PCR assay for the simultaneous detection of IPNV and IHNV. M.S. thesis. University of Maine, Orono, Maine. |
| 23. | Sweeney, A., S. Blake, J. T. Singer, and B. L. Nicholson. 1997. Detection and identification of infectious pancreatic necrosis virus (IPNV) and infectious hematopoietic necrosis virus (IHNV) by polymerase chain reaction (PCR), p. 42-47. In Y. Inui, and J. Winton (ed.), New approaches to viral disease of aquatic animals. National Research Institute of Aquaculture, Nansei, Japan. |
| 24. | Wolf, K. 1988. Fish viruses and fish viral diseases, Cornell University Press, Ithaca, N.Y., p. 83-158. , 217-249. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»