Liver Unit, Department of Medicine, Hospital
General Universitari Vall d'Hebron, Barcelona, Spain
Received 26 May 1998/Returned for modification 3 August
1998/Accepted 13 October 1998
We describe a rapid and reproducible method for assessment of the
hepatitis C virus (HCV) load in serum samples. The method combines
Taqman technology (Roche) and the ABI Prism 7700 (Perkin Elmer)
real-time sequence detection system. We have optimized a single-tube
reverse transcription-PCR (RT-PCR) that contains a dual-labeled
fluorogenic probe to quantify the 5' noncoding region (5' NCR) of HCV.
The probe contains a fluorescent reporter at the 5' end and a
fluorescent quencher at the 3' end. The use of such a probe combined
with the 5'-3' nuclease activity of Taq polymerase allows
direct quantitation of the PCR product by the detection of a
fluorescent reporter released in the course of the exponential phase of
the PCR. For accurate quantitation of the number of copies of HCV in
samples containing unknown quantities, we have used serial dilutions of
a synthetic 5' NCR RNA standard of HCV that was previously quantified
with an isotopic tracer. The method has a 5-log dynamic range
(103 to 107). The coefficient of regression of
the standard curve was, on average, 0.98. The intra-assay and the
interassay coefficients of variation of the threshold cycle were 1%
and 6.2%, respectively. Seventy-nine RNA samples from the sera of
infected patients were quantified by this method. Comparison of the
results with those obtained by other quantitation methods (the
Quantiplex 2.0 branched-DNA assay and the Superquant assay from the
National Genetics Institute) revealed a significant correlation with
all of the results. The mean values were also statistically comparable.
In conclusion, the high sensitivity, simplicity, and reproducibility of
the real-time HCV RNA quantitation which allows the screening of large
numbers of samples, combined with its wide dynamic range, make this
method especially suitable for monitoring of the viral load during
therapy and tailoring of treatment schedules.
 |
INTRODUCTION |
Hepatitis C virus (HCV) is a
positive-stranded RNA virus that has been identified as the agent
responsible for the vast majority of cases on transfusion-associated
and community-acquired non-A, non-B hepatitis (8, 20).
Although generally asymptomatic, about 85% of the infections become
chronic. Persistent HCV infection may be associated with a wide
spectrum of outcomes, from mild nonprogressive liver damage to severe
chronic hepatitis that progresses to cirrhosis, end-stage liver
disease, and hepatocellular carcinoma. Several studies have tried to
elucidate the viral characteristics involved in the progression of the
disease; the infecting genotype, the degree of viral diversity, and the
viral load have all been suggested to correlate with disease activity,
degree of liver damage, and response to alpha interferon treatment, but
the results of different studies are confusing and controversial
(3, 15, 19, 23, 25-28). Because it has been established
that viral load is relatively stable in the chronic phase of the
infection, of these parameters, viral load seems to be more useful for
the tailoring of treatment schedules and the monitoring of HCV
replication during therapy. The detection and quantitation of HCV RNA
in serum requires highly specific and sensitive assays because HCV
circulates in the blood at a low copy number and its genome is
extremely heterogeneous (24), even though the virus titer
covers a wide range (from undetectable values to more than
107 copies/ml). Many efforts have been made to precisely
quantify the viral load in HCV-infected patients. To date, methods
involve amplification procedures either based on branched-DNA (bDNA)
methodology, in which a signal previously hybridized with the template
sequence is amplified (1, 33), or based on reverse
transcription-PCR (RT-PCR) methods, which directly amplify viral genome
sequences (10, 12, 13, 31, 34, 35). Quantitative PCR
methods, either competitive or noncompetitive, measure viral load as
the amount of amplified product at the end of the reaction. Results are
subject, as a consequence, to the errors caused by the plateauing effect that occurs when the reagents are used up (29).
Moreover, because target amplification by PCR is exponential in nature, a very small change in the amplification efficiency can produce dramatic differences in the amount of final product. To avoid these
problems, quantitative PCR assays should be designed so that product
quantity is analyzed during the logarithmic phase of the reaction,
before the plateau, and should ideally include internal controls that
coamplify with the same efficiency as the target molecule (9,
11). These requirements imply time-consuming post-PCR
manipulations that can lead to PCR product carryover contamination,
laboratory contamination, high costs for infrastructure, and,
therefore, limitations in the screening of large number of samples.
Here we describe a rapid and reproducible method that allows the
quantitation of HCV RNA copies in serum samples by using the ABI Prism
7700 real-time sequence detection system (14, 16, 21). We
have optimized a single-tube RT-PCR to quantify the 5' noncoding region
(5' NCR) of HCV that contains a dual-labeled fluorogenic probe (2,
22). The use of such a probe combined with the 5'-3' nuclease
activity of Taq polymerase allows direct detection of the
PCR product by detection of a fluorescent reporter released in the
course of the PCR. HCV RNA quantitation by our real-time RT-PCR
protocol determines the initial copy number in samples with unknown
quantities by comparing the results for the samples to those on a curve
generated from a standard with a previously known starting quantity.
 |
MATERIALS AND METHODS |
Clinical specimens.
Blood samples were obtained from 79 anti-HCV-positive patients (Table 1).
Seventy-four patients were HCV RNA positive by a commercial
quantitative HCV RNA test with a detection limit of 102
copies/ml (Amplicor HCV-RNA; Roche Molecular Systems) and five were
negative. Twenty-seven patients had persistently normal alanine aminotransferase values. All blood samples were drawn into VACUTAINER tubes with no additives (especially, no heparin) (Becton & Dickinson, Meylan, France) containing a silicone separator and centrifuged within
2 h of collection to avoid any sign of hemolysis, and the serum
was aliquoted and kept at
80°C until further testing. Viral RNA was
extracted from 140 µl of each serum sample by the QIAamp viral RNA
purification protocol (Qiagen) and was dissolved in 50 µl of
RNase-free water. RNAs were stored at
80°C until use. All samples
were genotyped by the Inno-Lipa HCV II test (Innogenetics, Zwijnaarde,
Belgium) according to the manufacturer's protocol (Table 1). The
branched-DNA (bDNA) assay was performed as recommended by the
manufacturer (Quantiplex; Chiron Corp., Emeryville, Calif.). The design
and principles of the bDNA assay are as follows. In brief, HCV RNA is
captured by a set of specific, synthetic oligonucleotide target probes.
A second set of target probes hybridizes to the viral RNA and bDNA
amplifiers. Multiple copies of an alkaline phosphatase-conjugated probe
are then hybridized to this immobilized complex to amplify the signal.
Detection is achieved by incubating the complex with a chemoluminescent
substrate (33). Samples were also tested by a quantitative
RT-PCR technique (Superquant assay) developed by the National Genetics
Institute (NGI) (Culver City, Calif.), as described elsewhere
(30). In brief, the extracted RNA is converted into cDNA and
is used as a template for four separate PCR amplifications, each of
which is stopped after a different number of cycles to avoid plateauing
effects. A digoxigenin-labeled probe is used to find the target DNA by
agarose gel electrophoresis. The DNA fragments are then vacuum
transferred to Southern blots and are immunostained. Standard curves
are constructed from DNA fragments with known copy numbers.
Real-time quantitative RT-PCR.
A single-tube RT-PCR was
optimized for the quantitation of the 5' NCR of HCV by using the Taqman
technology (Roche Molecular Diagnostics Systems), which exploits the
5'-3' nucleolytic activity of AmpliTaq DNA polymerase first described
by Holland et al. (17). Briefly, the method uses a
dual-labeled fluorogenic hybridization probe that specifically anneals
the template between the PCR primers. The probe contains a fluorescent
reporter (6-carboxyfluorescein [FAM]) at the 5' end and a fluorescent
quencher (6-carboxytetramethylrhodamine [TAMRA]) at the 3' end. When
the probe is intact the emission spectrum of the reporter is suppressed
by the quencher. The nuclease degradation of the hybridization probe
releases the reporter, resulting in an increase in fluorescence
emission. The use of a sequence detector (ABI Prism 7700) allows
measurement of the amplified product in direct proportion to the
increase in fluorescence emission continuously during the PCR
amplification. The amplification plot is examined early in the reaction
(Fig. 1), at a point that represents the
logarithmic phase of product accumulation. The point representing the
detection threshold of the increase in the fluorescent signal
associated with the exponential growth of the PCR product for the
sequence detector is defined as the cycle threshold
(CT). CT values are
predictive of the quantity of input target (16); that is,
when the conditions of the PCR are the same, the larger the starting
concentration of a template, the lower the CT.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Typical amplification plot. The graph of the increment
of fluorescence reporter signal ( Rn) versus cycle number during PCR
shows three stages: baseline, exponential phase, and plateau. The
CT value is calculated by determining the point
at which the fluorescence exceeds an arbitrary threshold limit (usually
10 times the standard deviation of the baseline).
|
|
The reaction mixture for RT-PCR was prepared in a single tube as
follows: 1× buffer A (50 mM KCl, 10 mM Tris-HCl, 0.01 mM EDTA, 60 nM
Passive Reference 1 [pH 8.3]), 5 mM MgCl2, 20 pmol of
primer C-149, 20 pmol of primer C-342, each deoxynucleoside triphosphate (Boehringer) at a concentration of 0.3 mM, 0.4 U of RNase
inhibitor per µl, 0.4 U of Moloney murine leukemia virus reverse
transcriptase per µl, and 0.025 U of Taq Gold Polymerase per µl (the enzymes and the buffer containing passive reference were
from Perkin Elmer). Fluorogenic probe [FT-275
5'-(FAM)CACCCTATCAGGCAGTACCACAAGGCC(TAMRA)-3'] was added to the PCR
mixture to a final concentration of 150 nM. Forty microliters of the
reaction mixture was added to the PCR tubes containing 10 µl of RNA
from serum or RNA from a diluted standard that had previously been
denatured at 90°C for 90 s. HCV RNA was reverse transcribed into
cDNA (30 min at 42°C) and amplified by PCR in a single tube for 40 cycles (15 s at 94°C and 1 min at 60°C) with specific
oligonucleotides (C-149 [sense primer],
5'-TGCGGAACCGGTGAGTACA-3' and C-342 [antisense primer], 5'-CTTAAGGTTTAGGATTCGTGCTCAT-3') (Fig.
2). We used the program PrimerExpress
(Perkin-Elmer) to design the primers and probes, following the
guidelines for the best performance of the PCR. From among all the
possibilities, we have selected the set that fits with the consensus
sequences of published HCV 5' NCR and core sequences (6,
32).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic representation of the transcription fragment
from the 5' NCR of HCV. Oligonucleotide primers C149 and C342 were used
for amplification by RT-PCR. Primers C24 and C339 were hybridized to
the RNA transcript to assess its integrity. FT275 is the dual-labeled
probe. R, reporter; Q, quencher; nt, nucleotides.
|
|
Precautions were undertaken to minimize the risk of PCR contamination:
two separate rooms, one for HCV RNA extraction and PCR mixture setup
and the other for the PCR, were used. Moreover, the amplified product
was never reused, and the tube containing it was never opened and was
immediately thrown away.
Synthesis and quantitation of a standard RNA.
Absolute
precision in the quantification of HCV RNA in samples containing
unknown quantities relies definitely on the accuracy with which the
amount of HCV RNA standard has been measured. An RNA standard
representing the 5' NCR of HCV was synthesized in vitro, and the
purified transcript was quantitated by isotopic tracing
(18). This is a reliable method and has been used to quantify the primary reference standard, but because labeled RNA is
unstable over time, we have used the hot standard as a reference to
quantify a second stable (nonisotopically labeled) reference standard
that can be remade periodically as needed. Four micrograms of a plasmid
containing the first half of the HCV genome (genotype 1b) was
linearized with AatII, and two in vitro transcriptions, one
with [
-32P]GTP and the other with no isotopic label,
were carried out in parallel. The RNA transcripts were subjected to
three successive steps of purification: DNase I degradation, phenol
extraction, and CF11 cellulose chromatography to eliminate DNA and the
unincorporated nucleotides, followed by polyacrylamide gel
electrophoresis to separate the complete RNA transcript from the
unfinished transcription fragments and other minor forms. Both labeled
and unlabeled RNAs were run in parallel, and bands were eluted from the
acrylamide gel. All reactions were done in siliconized-glass tubes with
tRNA as a carrier. The amount of isotopically labeled RNA transcript was measured in a scintillation counter, and the amount of RNA synthesized was calculated from the known incorporation percentage, as
follows: N × counts per minute incorporated/total
counts per minute, where N is the quantity of
deoxynucleoside triphosphates (in micrograms) included in the reaction
mixture. The following assumptions are made in the calculation: the
synthesized RNA contains equimolar amounts of all four ribonucleotides,
the average molecular weight of a nucleotide is 325, and the
contribution of [
-32P]GTP is negligible. Although the
amounts of all four ribonucleotides are not the same, the molecular
weight of the RNA synthesized was only 0.2% lower than the estimated
molecular weight. Serial dilutions (107 to 103)
of the labeled RNA transcript were used as standards to quantify by our
RT-PCR protocol the HCV RNA in two dilutions containing unknown
quantities of the nonlabeled transcript.
The integrity of the synthesized transcripts, both labeled and
nonlabeled, was verified by migration by gel electrophoresis. Two
oligonucleotides (C24 [5'-GGGAGTGATCTATGGTGGAG-3'] and
C339 [5'-GAGGATCCGGTTTAGGATTCGTGCTCATGGT-3']) that are
known to hybridize efficiently and specifically with the flanking
regions of the amplified fragment (23) were labeled at the
5' end with [
-32]ATP and were used to analyze the
unlabeled RNA transcript. After the annealing reactions, hybrids were
subsequently electrophoresed under nondenaturing gel conditions in
parallel with an aliquot of the labeled transcript.
Statistical analysis.
The standard curve was created
automatically by the ABI Prism 7700 detection system by plotting the
CT against each standard dilution of known
concentration. The coefficient of linear regression (R) for
each standard curve was calculated. The intra-assay and interassay
coefficients of variation (CVs) of the technique were calculated for
the CT of each standard within runs and between runs, respectively. The CV was obtained by dividing the standard deviation of each standard CT by its mean and
dividing that result by 100.
Quantitation results obtained by real-time RT-PCR, the bDNA assay, and
the NGI assay were expressed as log10 HCV RNA copies per
milliliter of serum. To compare the results obtained by these methods,
the Kolmogorov-Smirnov normality test, Spearman's correlation, and the
Mann-Whitney test for comparison of means were performed. Significant
differences were considered when the P value was <0.05.
 |
RESULTS |
The concentration of HCV RNA in the first reference standard was
calculated from its specific activity measured on a scintillation counter. The number of RNA molecules synthesized was 109
copies per µl. Then, real-time RT-PCR amplifications were performed with 1:10 serial dilutions (from 107 to 103
copies of RNA per reaction mixture). Two dilutions of the nonlabeled HCV RNA (unknown quantity) were also amplified in parallel reactions. Figure 3 presents the
CT values plotted versus the sample dilution values to produce a standard curve. With the knowledge of the CT values for the samples containing unknown
quantities of HCV RNA, the standard curve is then used to interpolate
the starting RNA concentration. As expected, the number of nonlabeled
RNA molecules that were synthesized was very similar to the number of
labeled RNA molecules that were synthesized, that is, 1.5 × 109 copies per µl. In order to prove that this nonlabeled
HCV RNA had the correct size and showed no degradation, it was
hybridized with two labeled oligonucleotides (C24 and C339 in Fig. 2)
corresponding to the flanking regions of the amplified fragment.
Autoradiography (Fig. 4) shows a unique
band of the same size obtained by hybridization with one
oligonucleotide, the other oligonucleotide, and both oligonucleotides,
and the sizes of the bands coincide with the size of the first labeled
HCV RNA. Moreover, no intermediate bands of degradation products were
detected. Finally, serial 10-fold dilutions of this RNA (from
103 to 107 copies of RNA per reaction mixture)
were used to generate a standard curve to quantify the RNA from serum
samples from HCV-infected patients. The standard curve that was
generated spans 5 logs; it shows linearity over the entire quantitation
range and provides accurate measurements over a very large range of
starting target quantities. No differences in the quantitation results
were obtained for diluted standard RNA that was added to and then
extracted from a non-HCV-infected serum sample.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
Standard curve of the input RNA concentration in serial
dilutions of the first reference standard versus
CT. Each dot represents the result of triplicate
PCR amplifications for each dilution. The stars represent the results
of PCR amplification of samples containing unknown quantities of HCV
RNA tested by this method. R was equal to 0.999, and the
slope was 3.429.
|
|

View larger version (87K):
[in this window]
[in a new window]
|
FIG. 4.
Assay of the quality of the RNA transcripts. Unlabeled
RNA transcript was preheated at 90°C for 1 min, immediately mixed
with oligonucleotides C24 (lane 2), C339 (lane 4), and both C24 and
C339 (lane 6), and slowly cooled to room temperature. Reactions were
conducted in reaction buffer (20 mM HEPES [pH 8], 50 mM KCl, 10 mM
MgCl2, 1 mM dithiothreitol) with 0.6 nM unlabeled
transcript and 20 nM oligonucleotide. The reaction mixtures in lanes 3 and 5 were identical to those described above, but they lacked the RNA
substrate. The arrow indicates a single band corresponding to the
labeled RNA transcript (lane 1). Note that the bands in lanes 2, 4, and
6 are slightly higher than the band in lane 1, resulting from the
increment in the size due to the hybridized oligonucleotides.
Unincorporated oligonucleotides appear at the bottom of the gel in
lanes 2 to 6.
|
|
The reproducibility of the method was established with the
CT values obtained for each dilution
(103 to 107) of the standard curve in different
assays and within an assay: the intra-assay and interassay CVs of the
threshold cycle were 1 and 6.2%, respectively, on average. The average
between-run correlation coefficient of the standard curve was 0.98.
The RT-PCR protocol was then applied to RNA extracted from serum
samples from 79 HCV-positive patients. The HCV RNA titer ranged between
3.3 × 102 and 4 × 107 copies/ml
when the results were compared to those for our HCV RNA standard. We
then compared our results with those obtained by the currently used HCV
quantification methods, the bDNA and NGI assays. The correlations were
statistically significant (Fig. 5). The
best correlation index was that shown with the ABI Prism 7700 and NGI
assays; not only in terms of total numbers of patients but also in
terms of groups of different genotypes (P < 0.001 for
genotypes 1 and 3 and P < 0.05 for genotypes 2 and 4)
(Table 2). When the results obtained for
groups of different genotypes are compared between the ABI Prism 7700 and bDNA assays, there was a significant correlation between genotypes
1 and 3 (P < 0.001 and P < 0.05,
respectively), but the correlation disappeared between genotypes 2 and
4 (Table 2). The mean values of the results obtained with the ABI Prism
7700, Quantiplex, and NGI Superquant assays were statistically
comparable; differences in log10 HCV RNA quantitation in
terms of both total numbers of patients and groups of different genotypes were not significant (Fig. 6A and
B).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
Spearman's correlation plot between quantitation
results determined by our RT-PCR protocol (ABI Prism 7700 assay) and
both the bDNA assay (solid line and squares) and the NGI method (dashed
line and dots) (P < 0.001). There is only no
correlation between the ABI Prism 7700 assay and the bDNA assay and
between the ABI Prism 7700 assay and the NGI method for two and three
samples, respectively, all of which contained genotype 1 virus.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Correlation coefficients for viral loads obtained with
the ABI Prism 7700, NGI, and bDNA quantitation methods according to
infecting genotype
|
|

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Mean values of results (expressed as log10
HCV RNA copies per milliliter of serum) determined by our RT-PCR
protocol (ABI Prism 7700 assay), the bDNA assay and the NGI method are
comparable. (A) Comparison of totals; differences in mean values are
not significant (ns). The percentages of samples positive by each
method are given in the box. (B) Comparison of mean values for groups
of different genotypes; differences are not significant.
|
|
 |
DISCUSSION |
Most commercial or in-house HCV RNA quantitation methods based on
PCR measure the amount of amplified product at the end of the reaction.
At any given cycle within the exponential phase of PCR, the amount of
product is proportional to the initial number of template copies.
However, this correlation tends to be lost as the rate of amplification
approaches a plateau. In contrast, the real-time RT-PCR protocol
proposed in this study for the quantification of HCV RNA from serum
samples provides accurate knowledge of the increment of the
amplification product in every cycle through the increment of released
fluorescence. Analysis is performed in real time during the exponential
phase. This allows many samples to be analyzed simultaneously and
eliminates the need to be concerned that a reaction plateau will be
reached at different cycles.
Methods for HCV RNA quantitation must be specific, sensitive,
reproducible, and accurate, and the analysis of large numbers of
samples requires a rapid and manageable protocol that minimizes as much
as possible post-PCR manipulations.
The analytical sensitivity of our method, i.e., the smallest amount of
HCV RNA tested and reliably quantified, is 1,000 copies/reaction mixture. In practice, however, we have detected up to 3.3 × 102 copies/ml, because the linearity of our standard curve
permits us to interpolate values located below the lower limit of the dynamic range (1 × 103 copies/ml). On the other hand,
the system can quantify the HCV RNA in samples with more than
107 copies/reaction mixture. This degree of sensitivity
along with a considerably wide dynamic range allows the use of a single
method for the detection of the wide range of loads found with HCV.
As far as specificity is concerned, the fluorescence signal due to the
cleavage of the Taqman fluorogenic probe is generated only if the
target sequence for the probe is amplified by the PCR. Therefore, no
signal is generated by nonspecific amplification. On the other hand,
the virtual absence of post-PCR manipulation prevents the carryover of
amplification products that were synthesized during previous PCRs.
The real-time RT-PCR method for the quantification of HCV RNA was
highly reproducible. Triplicate amplifications for each standard
dilution were performed in each assay and were used to calculate the
intra-assay CV of CT. Also, fluorescent
CT values obtained on the different days on
which the assays were performed were used to calculate the CV
interassay CV. Both CVs were especially low, 1% for the intra-assay CV
and 6.2% for the interassay CV. The use of an argon laser as a light
source that excites the fluorogenic dyes that act as direct indicators
of the amplification introduces minimal variation into the quantitative
PCR analysis and contributes to the low degree of variability observed
in the results.
The accuracy of the method is supported by comparison of the results
with those obtained with an HCV RNA standard previously quantified by
isotopic tracing, which is absolute and which is based on physical
properties. Nevertheless, we cannot underestimate the variability
within serum samples and the RNA standard with regard to the efficiency
of amplification. To date, our system does not allow the simultaneous
detection of distinguishable reporter dyes that could be used as
internal controls that coamplify with our target sequence. Use of such
internal controls could allow us to overcome the problem of sample
impurities that affect the efficiency of PCR. In contrast, an advantage
of our detection system is that the amplification plot is examined
early in the reaction (CT). In this sense, we
avoid discrepancies due to inhibition late in the cycle.
Comparison of the results obtained by the ABI PRISM 7700 RT-PCR
protocol with those obtained by other commercially available techniques
(the bDNA and NGI assays) showed a good correlation, although the
RT-PCR protocol tended to underestimate the viral load in samples from
patients infected with genotypes 2 and 4 by a mean of only 0.2 logs
(Table 2). Mutation within the 5' NCR may affect the secondary and
tertiary structures of the RNA and thus the stability and the
accessibility of the 3' primers to the HCV RNA. In fact, internal
ribosome entry site activities have been shown to be different among
distinct genotypes in vitro and in cell culture (7). Also,
differences between the length of the viral RNA compared with that of
the standard transcript may be important because long-distance tertiary
interactions have been described in other RNAs (4, 5).
Our method has several advantages over the other methods: its dynamic
range is much wider than that of Quantiplex 2.0 and it is much less
cumbersome than Superquant. The costs associated with the use of this
system are the cost of the PCR plus the cost of the Taqman probes, but
the high throughput of the system compensates for these costs and
allows processing of multiple samples with minimal labor time and
without a risk of carryover contamination due to post-PCR sample
manipulation. The ABI Prism 7700 quantitation methodology is used in
our laboratory to follow the kinetics of the decrease in viral load in
patients treated with alpha interferon, as well as in comparative
studies of viral load in serial samples from serum and liver.
We acknowledge Cristina Escarmis (Centro de Biología
Molecular, CSIC, Madrid, Spain) for valuable and helpful technical advice.
This investigation was supported in part by grant SAF 97-0148 from the
Comisión Interministerial de Ciencias y Tecnología (CICYT), by grant 97/2039 from the Fondo de Investigación
Sanitaria (FIS), and by the Comisión de Investigación y
Docencia of the Hospital Vall D'Hebrón.
| 1.
|
Alter, H. J.,
R. Sanchez-Pescador,
M. S. Urdea,
J. C. Wilber,
R. J. Lagier,
A. M. Di Bisceglie,
J. W. Shih, and P. D. Neuwald.
1995.
Evaluation of branched DNA signal amplification for the detection of hepatitis C virus RNA.
J. Viral Hepat.
2:121-132[Medline].
|
| 2.
|
Bassler, H. A.,
S. J. Flood,
K. J. Livak,
J. Marmaro,
R. Knorr, and C. A. Batt.
1995.
Use of a fluorogenic probe in a PCR-based assay for the detection of Listeria monocytogenes.
Appl. Environ. Microbiol.
61:724-728.
|
| 3.
|
Benvegnu, L.,
P. Pontisso,
D. Cavalletto,
F. Noventa,
L. Chemello, and A. Alberti.
1997.
Lack of correlation between hepatitis C virus genotypes and clinical course of hepatitis C virus-related cirrhosis.
Hepatology
25:211-215[Medline].
|
| 4.
|
Branch, A. D.,
B. J. Benenfeld, and H. D. Robertson.
1985.
Ultraviolet light- induced crosslink reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA.
Proc. Natl. Acad. Sci. USA
82:6590-6594[Abstract/Free Full Text].
|
| 5.
|
Branch, A. D.,
B. J. Benenfeld,
B. M. Baroudy,
F. V. Wells,
J. L. Guerin, and H. D. Robertson.
1989.
An untraviolet-sensitive RNA structural element in viroid-like domain of hepatitis delta virus.
Science
243:649-652[Abstract/Free Full Text].
|
| 6.
|
Bukh, J.,
R. H. Purcell, and R. H. Miller.
1994.
Sequence analysis of the core gene of 14 hepatitis C virus genotypes.
Proc. Natl. Acad. Sci. USA
91:8239-8243[Abstract/Free Full Text].
|
| 7.
|
Buratti, E.,
M. Gerotto,
P. Pontisso,
A. Alberti,
S. G. Tisminetzky, and F. E. Baralle.
1977.
In vivo translational efficiency of different hepatitis C virus 5'-UTRs.
FEBS Lett.
411:275-280.
|
| 8.
|
Choo, Q. L.,
G. Kuo,
A. J. Weiner,
L. R. Overby,
D. W. Bradley, and M. Houghton.
1989.
Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome.
Science
244:359-362[Abstract/Free Full Text].
|
| 9.
|
Clementi, M.,
S. Menzo,
P. Bagnarelli,
A. Manzin,
A. Valenza, and P. E. Varaldo.
1993.
Quantitative PCR and RT-PCR in virology.
PCR Methods Appl.
2:191-196[Medline].
|
| 10.
|
Farci, P.,
H. J. Alter,
D. Wong,
R. H. Miller,
J. W. Shih,
B. Jett, and R. H. Purcell.
1991.
A long-term study of hepatitis C virus replication in non-A, non-B hepatitis.
N. Engl. J. Med.
325:98-104[Abstract].
|
| 11.
|
Ferre, F.
1992.
Quantitative or semi-quantitative PCR: reality versus myth.
PCR Methods Appl.
2:1-9[Medline].
|
| 12.
|
Fong, T. L.,
M. Shindo,
S. M. Feinstone,
J. H. Hoofnagle, and A. M. Di Bisceglie.
1991.
Detection of replicative intermediates of hepatitis C viral RNA in liver and serum of patients with chronic hepatitis C.
J. Clin. Invest.
88:1058-1060.
|
| 13.
|
Garson, J. A.,
P. W. Tuke,
M. Makris,
M. Briggs,
S. J. Machin,
F. E. Preston, and R. S. Tedder.
1990.
Demonstration of viraemia patterns in haemophiliacs treated with hepatitis-C-virus-contaminated factor VIII concentrates.
Lancet
336:1022-1025[Medline].
|
| 14.
| Gelfand, D. H., P. M. Holland, R. K. Saiki, and R. M. Watson. 1993. U.S. patent 5210015.
|
| 15.
|
Gretch, D.,
L. Corey,
J. Wilson,
C. dela Rosa,
R. Willson,
R. Carithers, Jr.,
M. Busch,
J. Hart,
M. Sayers, and J. Han.
1994.
Assessment of hepatitis C virus RNA levels by quantitative competitive RNA polymerase chain reaction: high-titer viremia correlates with advanced stage of disease.
J. Infect. Dis.
169:1219-1225[Medline].
|
| 16.
|
Heid, C.,
J. Stevens,
K. Livak, and P. M. Williams.
1996.
Real time quantitative PCR.
Genome Res.
6:986-994[Abstract/Free Full Text].
|
| 17.
|
Holland, P. M.,
R. D. Abramson,
R. Watson, and D. H. Gelfand.
1991.
Detection of specific polymerase chain reaction product by utilizing the 5' 3' exonuclease activity of Thermus aquaticus DNA polymerase.
Proc. Natl. Acad. Sci. USA
88:7276-7280[Abstract/Free Full Text].
|
| 18.
|
Kinloch, R. A.,
R. J. Roller, and P. M. Wassarman.
1993.
Quantitative analysis of specific messenger RNAs by ribonuclease protection.
Methods Enzymol.
225:294-303[Medline].
|
| 19.
|
Koizumi, K.,
N. Enomoto,
M. Kurosaki,
T. Murakami,
N. Izumi,
F. Marumo, and C. Sato.
1995.
Diversity of quasispecies in various disease stages of chronic hepatitis C virus infection and its significance in interferon treatment.
Hepatology
22:30-35[Medline].
|
| 20.
|
Kuo, G.,
Q. L. Choo,
H. J. Alter,
G. L. Glitnick,
A. G. Redekerm,
R. H. Purcell,
T. Miyamura,
J. L. Dienstag,
M. J. Alter,
C. E. Stevens,
G. E. Tegtmeier,
F. Bonino,
M. Colombo,
W. S. Lee,
C. Kuo,
K. Berger,
J. R. Shuster,
L. R. Overby,
D. W. Bradley, and M. Houghton.
1989.
An assay for circulating antibodies to a major etiologic agent of human non-A, non-B hepatitis.
Science
244:362-364[Abstract/Free Full Text].
|
| 21.
|
Lawyer, F. C.,
S. Stoffel,
R. K. Saiki,
S. Y. Chang,
P. A. Landre,
R. D. Abramson, and D. H. Gelfand.
1993.
High-level expression, purification, and enzymatic characterization of full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5' to 3' exonuclease activity.
PCR Methods Appl.
2:275-287[Medline].
|
| 22.
|
Livak, K. J.,
S. J. Flood,
J. Marmaro,
W. Giusti, and K. Deetz.
1995.
Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization.
PCR Methods Appl.
4:357-362[Medline].
|
| 23.
| Lyons, A. J., J. R. Lytle, J. Gomez, and
H. D. Robertson. Unpublished data.
|
| 24.
|
Martell, M.,
J. I. Esteban,
J. Quer,
J. Genesca,
A. Weiner,
R. Esteban,
J. Guardia, and J. Gomez.
1992.
Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution.
J. Virol.
66:3225-3229[Abstract/Free Full Text].
|
| 25.
|
Martinot-Peignoux, M.,
P. Marcellin,
M. Pouteau,
C. Castelnau,
N. Boyer,
M. Poliquin,
C. Degott,
I. Descombes,
V. Le Breton,
V. Milotova,
J. P. Benhamou, and S. Erlinger.
1995.
Pretreatment serum hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interferon alfa therapy in chronic hepatitis C.
Hepatology
22:1050-1056[Medline].
|
| 26.
|
McHutchinson, J. G.,
A. Sedghi-Vaziri,
J. Russell,
P. Schmid, and A. Conrad.
1996.
Is there an optimal time to measure quantitative HCV RNA to predict outcome following interferon treatment for chronic HCV infection?
Hepatology
24:356A. (Abstract.)
|
| 27.
|
Naito, M.,
N. Hayashi,
T. Moribe,
H. Hagiwara,
E. Mita,
Y. Kanazawa,
A. Kasahara,
H. Fusamoto, and T. Kamada.
1995.
Hepatitis C viral quasispecies in hepatitis C virus carriers with normal liver enzymes and patients with type C chronic liver disease.
Hepatology
22:407-412[Medline].
|
| 28.
|
Pawlotsky, J. M.,
F. Roudot-Thoraval,
A. Bastie,
F. Darthuy,
J. Remire,
J. M. Metreau,
E. S. Zafrani,
J. Duval, and D. Dhumeaux.
1996.
Factors affecting treatment responses to interferon-alpha in chronic hepatitis C.
J. Infect. Dis.
174:1-7[Medline].
|
| 29.
|
Raeymaekers, L.
1993.
Quantitative PCR: theoretical considerations with practical implications.
Anal. Biochem.
214:582-585[Medline].
|
| 30.
|
Reichard, O.,
G. Norkrans,
A. Fryden,
J. H. Braconier,
A. Sönnerborg, and O. Weiland.
1998.
Randomised, double-blind, placebo-controlled trial of interferon -2b with and without ribavirin for chronic hepatitis C.
Lancet
351:83-87[Medline].
|
| 31.
|
Simmonds, P.,
L. Q. Zhang,
H. G. Watson,
S. Rebus,
E. D. Ferguson,
P. Balfe,
G. H. Leadbetter,
P. L. Yap,
J. F. Peutherer, and C. A. Ludlam.
1990.
Hepatitis C quantification and sequencing in blood products, haemophiliacs, and drug users.
Lancet
336:1469-1472[Medline].
|
| 32.
|
Smith, D. B.,
J. Mellor,
L. M. Jarvis,
F. Davidson,
J. Kolberg,
M. Urdea,
P.-L. Yap,
P. Simmonds, and The International HCV Collaborative Study Group.
1995.
Variation of the hepatitis C virus 5' non-coding region: implications for secondary structure, virus detection and typing.
J. Gen. Virol.
76:1749-1761[Abstract/Free Full Text].
|
| 33.
|
Urdea, M. S.,
T. Horn,
T. J. Fultz,
M. Anderson,
J. A. Running,
S. Hamren,
D. Ahle, and C. A. Chang.
1991.
Branched DNA amplification multimers for the sensitive, direct detection of human hepatitis viruses.
Nucleic Acids Symp. Ser.
24:197-200.
|
| 34.
|
Weiner, A. J.,
G. Kuo,
D. W. Bradley,
F. Bonino,
F. Saracco,
C. Lee,
J. Rosenblatt,
Q. L. Choo, and M. Houghton.
1990.
Detection of hepatitis C viral sequences in non-A, non-B hepatitis.
Lancet
355:1-3.
|
| 35.
|
Young, K. K.,
J. J. Archer,
O. Yokosuka,
M. Omata, and R. M. Resnick.
1995.
Detection of hepatitis C virus RNA by a combined reverse transcription PCR assay: comparison with nested amplification and antibody testing.
J. Clin. Microbiol.
33:654-657[Abstract].
|