Previous Article | Next Article ![]()
Journal of Clinical Microbiology, March 1999, p. 548-552, Vol. 37, No. 3
Division of Vector-Borne Infectious Diseases,
National Center for Infectious Diseases, Centers for Disease Control
and Prevention, Public Health Service, U.S. Department of Health and
Human Services, Fort Collins, Colorado
Received 15 October 1998/Returned for modification 19 November
1998/Accepted 11 December 1998
The 37-kDa protein (P37) of Borrelia burgdorferi is an
antigen that elicits an early immunoglobulin M (IgM) antibody response in Lyme disease patients. The P37 gene was cloned from a
B. burgdorferi genomic library by screening with antibody
from a Lyme disease patient who had developed a prominent humoral
response to the P37 antigen. DNA sequence analysis of this clone
revealed the identity of P37 to be FlaA, an outer sheath protein of the
periplasmic flagella. Recombinant P37 expression was accomplished in
Escherichia coli by using a gene construct with the leader
peptide deleted and fused to a 38-kDa E. coli protein. The
recombinant antigen was reactive in IgM immunoblots using serum samples
from patients clinically diagnosed with early Lyme disease that had
been scored positive for B. burgdorferi anti-P37
reactivity. Lyme disease patient samples serologically negative for the
B. burgdorferi P37 protein did not react with the
recombinant. Recombinant P37 may be a useful component of a set of
defined antigens for the serodiagnosis of early Lyme disease. This
protein can be utilized as a marker in diagnostic immunoblots, aiding
in the standardization of the present generation of IgM serologic tests.
Correct early diagnosis of Lyme
disease, a tick-associated spirochetal illness, is important since
antibiotic therapy is effective (22). Prompt and adequate
treatment can prevent the serious musculoskeletal, cardiac,
dermatologic, and neurologic manifestations of long-term infection
(17, 21). Serology plays a valuable supportive role in the
correct diagnosis of this disease (24).
At present, the most commonly used serologic tests for Lyme disease
employ whole-cell antigens of Borrelia burgdorferi. It has
long been understood that whole-cell preparations contain determinants
that cross-react with antibodies elicited in the course of other
diseases and can lead to false-positive test results (4, 16,
20). Concern about the need to increase test specificity led to
the recommendation by the Centers for Disease Control and Prevention
(CDC) and the Association of State and Territorial Public Health
Laboratory Directors that a two-step approach to testing be used until
simpler tests with better performance characteristics are developed
(2). The second step of this approach is immunoblotting of
samples that are found to be positive or borderline by a sensitive initial test such as an enzyme immunoassay (EIA). The Western blot
assay is more specific than an EIA or dot blot because antigens of
higher individual specificity for the diagnosis of Lyme disease are
physically separated from antigens that are more broadly
cross-reactive. The best choice of separated antigens to be used in
Western blots is the subject of ongoing research. Interim guidelines
recommended by the CDC and the Association of State and Territorial
Public Health Laboratory Directors are that the criteria of Dressler et
al. (5) be used to interpret immunoglobulin G (IgG) blots and the criteria of Engstrom et al. (6) be applied to IgM blots.
The criteria of Engstrom et al. for IgM blot positivity require the
presence of antibody to two of the following three proteins: FlaB
(flagellin; 41 kDa), BmpA (39 kDa), and OspC (variable, about 24 kDa)
(6). Another protein of 37 kDa was recognized as being important in the early IgM response to B. burgdorferi
(6) and could potentially improve test sensitivity. It was
not included in the criteria recommended for IgM blot interpretation,
however, because the protein had not been isolated and no monoclonal
antibodies to it existed for the calibration and standardization of
immunoblots (2).
This report describes the isolation, cloning, and expression of the
P37 gene and demonstrates that the P37 antigen is FlaA, a
putative flagellar outer sheath protein (10). We show that patients with a B. burgdorferi anti-P37 response as
demonstrated by Western blotting also react serologically to the
recombinant P37. Antibody to P37 may now permit accurate calibration of
blots for scoring of reactivity with this antigen, and recombinant P37 may be used as part of a set of defined antigens for immunoassays that
avoid the complexity and expense of Western blot analysis.
Isolation of the P37 gene clone.
A genomic DNA library of
B. burgdorferi B31 (low passage, <10 passages) was
constructed in the phage lambda vector ZapExpress (Stratagene, La
Jolla, Calif.) as follows. Total DNA was purified from cultured
B. burgdorferi cells as previously described
(12). The DNA was subjected to partial Sau3A
restriction enzyme digestion to generate fragments ranging in size from
approximately 1 to 10 kb. The digested DNA fragments were ligated into
BamHI-cut lambda ZapExpress and packaged in accordance with
the manufacturer's directions. The phage library was plated onto
E. coli XL1-Blue MRF' host cells (Stratagene) and amplified,
titers were determined, and the library was stored at 4°C.
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
The Borrelia burgdorferi 37-Kilodalton
Immunoblot Band (P37) Used in Serodiagnosis of Early Lyme Disease Is
the flaA Gene Product
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
-D-thiogalactopyranoside (IPTG) to 0.5 mM.
Cell pellets were harvested and subjected to protein fractionation by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE),
and proteins were electrophoretically transferred to nitrocellulose
(Schleicher & Schuell, Keene, N.H.) or polyvinylidene difluoride
membranes (Schleicher & Schuell) by standard procedures
(23). The transferred proteins from the recombinant E. coli lysate were immunoblotted against the eluted anti-P37 antibody.
Subcloning of P37 constructs. Three constructs of the P37 gene coding sequence were generated by PCR amplification of B. burgdorferi genomic DNA. Construct F1 constituted the entire coding sequence, construct F2 constituted the entire coding sequence minus the leader peptide (the first 22 amino acids), and construct F3 constituted the coding sequence beginning at amino acid 80. Forward primers for each construct were as follows: primer F1, 5' ATGAAAAGGAAAGCTAAAAGT 3'; primer F2, 5' GATGGATTAGCAGAGGGTT 3'; and primer F3, 5' TGGGATAAATAATTGGAGCGT 3'. The reverse primer used for all three constructs, B1, was, from the end of the coding sequence, 5' CTAATTTTTCGGAGATGATTC 3'. PCRs were performed with approximately 1 µg of template DNA, and the parameters were 35 cycles of 94°C for 30 s, 45°C for 30 s, and 72°C for 2 min with a GeneAmp PCR system 9600 (The Perkin-Elmer Corp., Norwalk, Conn.).
The amplified fragments were ligated into the plasmid expression vector pSCREEN-1b or pET29(b), both pET vector derivatives (Novagen, Madison, Wis.), and transformed into E. coli NovaBlue (DE3) (Novagen) cells as described in the manufacturer's directions. The transformation mixture was plated onto Luria-Bertani plates containing 0.25 mg of carbenicillin per ml.Expression of recombinant P37. A primary culture for expression from the pSCREEN-P37 construct was started in Luria-Bertani broth containing 0.25 mg of carbenicillin per ml by inoculation with a colony from a fresh transformant plate as described above. The culture was incubated at 37°C with shaking and observed until growth reached approximately mid-log phase, i.e., when the optical density at 600 nm was ca. 0.6. IPTG was added to 0.5 mM, and the culture was incubated for an additional 2 h. Cells were harvested and assayed for expression by SDS-PAGE and Western blotting by standard procedures. In this expression system, the recombinant gene product was in frame with a vector-encoded E. coli T7 gene 10 product of about 38 kDa, which resulted in a recombinant fusion product. It was essential to start the expression culture with a fresh transformant colony and not with a subculture from an overnight starter culture. Cells propagated from a subculture produced little or no recombinant protein in this expression system.
DNA sequencing. Recombinant plasmid DNA was isolated from E. coli by using a QIAprep-spin plasmid kit (Qiagen, Chatsworth, Calif.) as described in the manufacturer's directions. DNA sequencing was performed with the Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems Inc., Foster City, Calif.) in accordance with the manufacturer's directions. Sequencing reactions were run and analyzed by the automated sequencing apparatus model 373A (Applied Biosystems, Inc.). DNA sequences were analyzed with Lasergene software (DNASTAR, Madison, Wis.).
Serum samples. Lyme disease case serum samples were from patients with erythema migrans (EM) residing in the areas of endemicity of New York, Wisconsin, and New England. All samples were acute-phase specimens obtained on the day that the patient was first seen by a physician, before antibiotic therapy was begun (baseline samples). The clinical diagnosis of EM was supported by cultural isolation of B. burgdorferi from a skin biopsy specimen in 65% of patients; isolation was not attempted in the other cases. All physicians who provided serum samples had extensive experience in the clinical diagnosis of Lyme disease.
Potentially cross-reactive serum samples were from syphilis patients residing in Texas and New York; serum samples with titers of 1:100 from these patients reacted to several bands on Treponema pallidum immunoblots. Some samples from syphilis patients cross-reacted with B. burgdorferi flagellar antigen on immunoblots but were negligible in reactivity to other antigens. Negative control serum samples were from healthy blood donors residing in areas where Lyme disease is nonendemic (Georgia, Colorado, and Ohio).Immunoblotting. Immunoblotting of serum samples against B. burgdorferi antigens was performed at dilutions of 1:100 on blots derived from whole-cell lysates of low-passage strain B31. Antigens were fractionated by SDS-PAGE on 11.75% gels, with subsequent transfer to nitrocellulose by using a Mini Trans-Blot System (Bio-Rad Laboratories, Hercules, Calif.), with transfer buffer conditions being 25 mM Tris-192 mM glycine-20% (vol/vol) methanol (pH 8.3). Immunoblotting of serum samples against recombinant P37 was performed by fractionating and transferring an induced E. coli lysate in the manner described above and then blotting samples at dilutions of 1:100 for 1 h. Following three wash buffer rinses in a total of 15 min, the blots were incubated with an anti-human IgM conjugated with alkaline phosphatase (Kirkegaard & Perry Laboratories, Inc., Gaithersburg, Md.) at 1:2,000 for 30 min. The blots were developed with BCIP-NBT substrate (Kirkegaard & Perry).
| |
RESULTS |
|---|
|
|
|---|
Isolation and identification of a P37 clone. Screening the B. burgdorferi genomic library with P37-monospecific antibody yielded positive clones, which were selected and further analyzed for recombinant protein expression by Western blotting. A truncated recombinant product of about 34 kDa with reactivity to the anti-P37 was observed. Plasmid DNA was isolated from this clone and subjected to DNA sequence analysis. By using pBK-CMV vector-specific primers, sequence data were generated from both ends of the cloned insert. The approximately 450 bp of DNA sequence obtained from one end of the insert was used in a search of the GenBank database with the Basic Local Alignment Search Tool (BLAST) program. The alignment search resulted in an exact match of the query sequence to that of the flaA gene of B. burgdorferi 212 (accession no. U62900). The DNA sequence from the opposite end of the insert showed alignment similarity to the sequence of a chemotaxis gene, cheW, of B. burgdorferi, albeit not an exact match. A motility chemotaxis operon in B. burgdorferi 212, consisting of the flaA gene and five chemotaxis genes, has been described previously (9, 10). The truncated flaA gene sequence of our insert was in frame with the lacZ fusion partner of the pBK-CMV expression vector and inducible by IPTG, therefore suggesting that the identity of the expressed recombinant product was FlaA.
To prove this, the flaA gene was subcloned into an E. coli expression vector, expressed, and tested against the anti-P37 antibody. Primers were generated to amplify the flaA gene from B. burgdorferi B31 genomic DNA by using the flaA DNA sequence from the GenBank database. The resultant amplified products were ligated into the plasmid expression vector and transformed into E. coli, and the expressed gene products were tested for anti-P37 activity by immunoblot. Since periplasmic or outer membrane proteins can sometimes be difficult to express because of toxicity to the E. coli host, three flaA constructs were engineered to attempt to maximize success in generating recombinant protein expression. Construct F1 consisted of the entire flaA coding sequence, including the leader peptide. Construct F2 consisted of the coding sequence minus the leader peptide. Construct F3 consisted of the coding sequence that was seen in the original clone, which expressed the truncated gene product (Fig. 1).
|
|
Reactivity of Lyme disease serum samples to the recombinant P37. A serological survey was done to assess the immunoreactivity of serum from patients with early Lyme disease to the recombinant P37 protein. Samples that had shown apparent immunoreactivity to the B. burgdorferi P37 band when assayed previously by Western blotting were preselected. These samples were immunoblotted against the recombinant P37. Figure 3 shows the reactivity of each sample to B. burgdorferi lysate and the recombinant P37 from the E. coli lysate. Serum samples with a positive reactivity to the B. burgdorferi P37 also reacted with the recombinant P37 (Fig. 3, lanes 1 to 13) (samples in lanes 10 and 12 were reactive to the recombinant P37, but the reaction was weaker and the bands did not reproduce well in Fig. 3). Serum samples from patients with early Lyme disease with no observed immunoreactivity against the B. burgdorferi P37 did not react with the recombinant P37 (Fig. 3, lanes 14 to 19). Therefore, it can be demonstrated that patient serum with a seropositive response to the B. burgdorferi P37 antigen is reactive against the recombinant P37.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
IgM reactivity to P37 is prominent in the evolution of the early
serologic response to B. burgdorferi in patients with EM (5). In a study by Aguero-Rosenfeld et al., the most
frequent IgM immunoblot bands were in response to OspC, FlaB, and P37
(1). In persons with EM of
7 days duration at the time of
venipuncture (n = 17), the frequency of IgM
seroreactivity to P37 was 71%, in contrast to 76% to OspC and 82% to
FlaB. In persons with very early disease (<7 days from onset of EM;
n = 29), this frequency was 14%, in contrast to 48%
to OspC and 31% to FlaB.
In a study from this laboratory, of 70 patients with EM (50 of 70 in whom B. burgdorferi infection was confirmed by culture), 38% of baseline serum specimens had IgM immunoblot reactivity to P37 from strain B31. This frequency increased to 57% in convalescent-phase serum samples collected 2 to 4 weeks after the beginning of antibiotic therapy. The specificity of the IgM response to P37 was 100%, as assessed with serum from healthy blood donors residing in areas where Lyme disease is nonendemic (Ohio and Wyoming) (2, 14).
The studies described above indicate that the P37 antigen can be an important component in the criteria to interpret IgM immunoblots, augmenting OspC, BmpA (P39), and FlaB. The data in the present report demonstrate the good potential of recombinant P37 as a test antigen in immunoassays, since reactivity with the recombinant was correlated with immune responses to the natural product.
Thirteen serum samples that were judged to have seroreactivity against the B. burgdorferi P37 by earlier Western blot assays, and six additional samples without apparent reactivity to P37, were selected to be tested against the recombinant P37. The samples that had anti-P37 activity also reacted to the recombinant P37, while those without anti-P37 activity did not. This result demonstrates the potential utility of the recombinant P37 in immunoblotting assays to test for the P37 band. It should also serve as a marker to discern between other seroreactive antigens in the same molecular weight range. It is possible that weak Western blot signals scored as P37 in some tests may have been due to nonspecific IgM binding, or the band may not have been the P37 antigen, as there may be other comigrating proteins with slight reactivities in the whole-cell lysate blots. For example, in this laboratory, we have observed that BmpD, an antigen with a calculated molecular mass of 37,250 Da (19), migrated slightly faster than P37/FlaA in an SDS-11.75% PAGE system, and recombinant BmpD did not react with P37-positive serum samples (data not shown). Therefore, it seems likely that there may be other antigens in this size range that react weakly in B. burgdorferi whole-cell immunoblots that could be confused with P37/FlaA. More extensive serological studies are being undertaken to rigorously determine sensitivity and specificity of the recombinant P37 in EIA and Western blot formats, after more complete purification procedures to remove contaminating E. coli proteins.
One aspect that will deserve scrutiny is potential cross-reactivity with FlaA proteins from other spirochetal species. FlaA has been described in T. pallidum (13), Spirochaeta aurantia (3), and Serpulina hyodysenteriae (15), with antigenic cross-reactivity between the FlaA proteins of T. pallidum, Treponema denticola, and Treponema phagedenis (10, 18). Cross-reactivity between anti-T. pallidum FlaA and B. burgdorferi FlaA has been demonstrated (10, 11). However, of nine syphilis patient serum samples tested in this study, only one showed a weakly reactive band, indicating that potential cross-reactivity to this antigen will probably not present problems in the serodiagnosis of the two diseases.
The expression of full-length spirochetal FlaA proteins in E. coli has been shown to be difficult due to the apparent toxicity of the gene product to the cells (8, 13). We were able to obtain expression of recombinant P37 in much the same manner as other investigators, i.e., by using a construct of the gene product minus the leader peptide. One study reported a failure to get FlaA expression by using the vector pET-23a (Novagen) with or without the leader peptide (8). However, by using a similar Novagen vector, pSCREEN, a pET derivative, we were successful in expressing large quantities of recombinant P37. This difference may be due to the fact that the F2 construct was expressed as a product fused to a large, 38-kDa E. coli protein (the T7 gene 10 product) located on the amino terminus. This fusion product may have served to stabilize the expression of the FlaA recombinant. Subsequent subcloning of the F2 construct into a pET expression vector without a fusion partner (pET29b) did indeed result in unstable clones which failed to express FlaA (data not shown).
A recent report stated that P37/FlaA is not an immunodominant antigen associated with B. burgdorferi infection and therefore not a good candidate for the serodiagnosis of Lyme disease (8). That conclusion was based on Western blot analyses of 19 human serum samples from Lyme disease patients and also a few samples from infected mice, rabbits, and monkeys. It may have been that these samples were drawn from convalescent-phase Lyme disease patients long after treatment and/or were assayed as IgG immunoblots (the immunoglobulin class was not specified). Anti-P37 IgG does not occur as frequently as IgG antibodies of other specificities in late Lyme disease. Nevertheless, the frequencies of anti-P37 IgG bands in immunoblots for patients with arthritis and late neurologic manifestations have been reported to be 44 and 48%, respectively (5).
With the identification of this 37-kDa protein, described in previously published reports as an antigen relevant in serodiagnostic testing (1, 5, 6), as the product of the flaA gene, P37 can be referred to as FlaA. However, this should not be confused with another B. burgdorferi protein described by others as P37 which is expressed in vivo only (7).
Diagnosis of the acute stage of Lyme disease has been difficult to support serologically because tests are relatively insensitive. This report demonstrates that FlaA has the potential to augment the set of recombinant molecules that are recognized early in the course of disease and to contribute to improving the sensitivity of early testing.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by a cooperative research and development agreement between CDC and bioMerieux Vitek, Inc., of Rockland, Mass., and we acknowledge the contribution of Bernie Rice.
We thank Gary Wormser (Westchester County Medical Center, Valhalla, N.Y.), Kurt Reid and Paul Mitchell (Marshfield Clinic, Marshfield, Wis.), and Allan Steere (New England Medical Center, Boston, Mass.) for serum samples; Ramesh Ramamoorthy and Mario Philipp for providing recombinant BmpD antigen; Katie Davis and Marty Schriefer for immunoblot reagents; Will Probert for the antibody isolation technique; and Steve Sviat and Rich Tsuchiya for their technical support.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: DVBID, Centers for Disease Control and Prevention, P.O. Box 2087, Foothills Campus, Fort Collins, CO 80522. Phone: (970) 221-6405. Fax: (970) 221-6476. E-mail: rbg9{at}cdc.gov.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Aguero-Rosenfeld, M. E., J. Nowakowski, S. Bittker, D. Cooper, R. B. Nadelman, and G. P. Wormser. 1996. Evolution of the serologic response to Borrelia burgdorferi in treated patients with culture-confirmed erythema migrans. J. Clin. Microbiol. 34:1-9[Abstract]. |
| 2. | Association of State and Territorial Public Health Laboratory Directors and the Centers for Disease Control and Prevention. 1995. Recommendations, p. 1-7. In Proceedings of the Second National Conference on Serologic Diagnosis of Lyme disease, Dearborn, Mich. Association of State and Territorial Public Health Laboratory Directors, Washington, D.C. |
| 3. |
Brahamsha, B., and E. P. Greenberg.
1989.
Cloning and sequence analysis of flaA, a gene encoding a Spirochaeta aurantia flagellar filament surface antigen.
J. Bacteriol.
171:1692-1697 |
| 4. | Bruckbauer, H. R., V. Preac-Mursic, R. Fuchs, and B. Wilske. 1992. Cross-reactive proteins of Borrelia burgdorferi. Eur. J. Clin. Microbiol. Infect. Dis. 11:224-232[Medline]. |
| 5. | Dressler, F., J. A. Whalen, B. N. Reinhardt, and A. C. Steere. 1993. Western blotting in the serodiagnosis of Lyme disease. J. Infect. Dis. 167:392-400[Medline]. |
| 6. | Engstrom, S. M., E. Shoop, and R. C. Johnson. 1995. Immunoblot interpretation criteria for serodiagnosis of early Lyme disease. J. Clin. Microbiol. 33:419-427[Abstract]. |
| 7. | Fikrig, E., S. W. Barthold, W. Sun, W. Feng, S. R. Telford III, and R. A. Flavell. 1997. Borrelia burgdorferi P35 and P37 proteins, expressed in vivo, elicit protective immunity. Immunity 6:531-539[Medline]. |
| 8. | Ge, Y., and N. W. Charon. 1997. FlaA, a putative flagellar outer sheath protein, is not an immunodominant antigen associated with Lyme disease. Infect. Immun. 65:2992-2995[Abstract]. |
| 9. | Ge, Y., and N. W. Charon. 1997. Molecular characterization of a flagellar/chemotaxis operon in the spirochete Borrelia burgdorferi. FEMS Microbiol. Lett. 153:425-431[Medline]. |
| 10. |
Ge, Y., and N. W. Charon.
1997.
An unexpected flaA homolog is present and expressed in Borrelia burgdorferi.
J. Bacteriol.
179:552-556 |
| 11. |
Ge, Y.,
C. Li,
L. Corum,
C. A. Slaughter, and N. W. Charon.
1998.
Structure and expression of the FlaA periplasmic flagellar protein of Borrelia burgdorferi.
J. Bacteriol.
180:2418-2425 |
| 12. | Gilmore, R. D., Jr., K. J. Kappel, M. C. Dolan, T. R. Burkot, and B. J. Johnson. 1996. Outer surface protein C (OspC), but not P39, is a protective immunogen against a tick-transmitted Borrelia burgdorferi challenge: evidence for a conformational protective epitope in OspC. Infect. Immun. 64:2234-2239[Abstract]. |
| 13. |
Isaacs, R. D., and J. D. Radolf.
1990.
Expression in Escherichia coli of the 37-kilodalton endoflagellar sheath protein of Treponema pallidum by use of the polymerase chain reaction and a T7 expression system.
Infect. Immun.
58:2025-2034 |
| 14. | Johnson, B. J. B. Unpublished data. |
| 15. |
Koopman, M. B. H.,
O. S. de Leeuw,
B. A. M. van der Zeijst, and J. G. Kusters.
1992.
Cloning and DNA sequence analysis of a Serpulina (Treponema) hyodysenteriae gene encoding a periplasmic flagellar sheath protein.
Infect. Immun.
60:2920-2925 |
| 16. | Magnarelli, L. A., J. F. Anderson, and R. C. Johnson. 1987. Cross-reactivity in serological tests for Lyme disease and other spirochetal infections. J. Infect. Dis. 156:183-188[Medline]. |
| 17. | Nadelman, R. B., and G. P. Wormser. 1995. Erythema migrans and early Lyme disease. Am. J. Med. 98:15S-24S[Medline]. |
| 18. |
Norris, S. J.,
N. W. Charon,
R. G. Cook,
M. D. Fuentes, and R. J. Limberger.
1988.
Antigenic relatedness and N-terminal sequence homology define two classes of major periplasmic flagellar proteins of Treponema pallidum subsp. pallidum and Treponema phagedenis.
J. Bacteriol.
170:4072-4082 |
| 19. | Ramamoorthy, R., L. Povinelli, and M. T. Philipp. 1996. Molecular characterization, genomic arrangement, and expression of bmpD, a new member of the bmp class of genes encoding membrane proteins of Borrelia burgdorferi. Infect. Immun. 64:1259-1264[Abstract]. |
| 20. |
Raoult, D.,
K. E. Hechemy, and G. Baranton.
1989.
Cross-reaction with Borrelia burgdorferi antigen of sera from patients with human immunodeficiency virus infection, syphilis, and leptospirosis.
J. Clin. Microbiol.
27:2152-2155 |
| 21. | Steere, A. C. 1989. Lyme disease. N. Engl. J. Med. 321:586-596[Abstract]. |
| 22. | Steere, A. C., S. E. Malawista, J. H. Newman, P. N. Spieler, and N. H. Bartenhagen. 1980. Antibiotic therapy in Lyme disease. Ann. Intern. Med. 93:1-8. |
| 23. |
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354 |
| 24. |
Tugwell, P.,
D. T. Dennis,
A. Weinstein,
G. Wells,
B. Shea,
G. Nichol,
R. Hayward,
R. Lightfoot,
P. Baker, and A. C. Steere.
1997.
Laboratory evaluation in the diagnosis of Lyme disease.
Ann. Intern. Med.
127:1109-1123 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»