Previous Article | Next Article 
Journal of Clinical Microbiology, March 1999, p. 653-663, Vol. 37, No. 3
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Phylogenetic Relationships of Varieties and Geographical
Groups of the Human Pathogenic Fungus Histoplasma
capsulatum Darling
Takao
Kasuga,1,*
John W.
Taylor,2 and
Thomas J.
White1
Roche Molecular Systems, Alameda, California
94501,1 and
Department of Plant
Biology, University of California, Berkeley, Berkeley, California
947202
Received 22 June 1998/Returned for modification 25 September
1998/Accepted 11 December 1998
 |
ABSTRACT |
The phylogeny of 46 geographically diverse Histoplasma
capsulatum isolates representing the three varieties
capsulatum, duboisii, and
farciminosum was evaluated using partial DNA sequences of four protein coding genes. Parsimony and distance analysis of the
separate genes were generally congruent and analysis of the combined data identified six clades: (i) class 1 North American H. capsulatum var. capsulatum, (ii) class
2 North American H. capsulatum var.
capsulatum, (iii) Central American H. capsulatum var. capsulatum, (iv) South
American H. capsulatum var.
capsulatum group A, (v) South American H. capsulatum var. capsulatum group B, and (vi)
H. capsulatum var. duboisii. Although the
clades were generally well supported, the relationships among them were
not resolved and the nearest outgroups (Blastomyces and
Paracoccidioides) were too distant to unequivocally
root the H. capsulatum tree. H. capsulatum var. farciminosum was found within the
South American H. capsulatum var.
capsulatum group A clade. With the exception of the South
American H. capsulatum var. capsulatum
group A clade, genetic distances within clades were an order of
magnitude lower than those between clades, and each clade was supported
by a number of shared derived nucleotide substitutions, leading to the
conclusion that each clade was genetically isolated from the others.
Under a phylogenetic species concept based on possession of
multiple shared derived characters, as well as concordance of four gene genealogies, H. capsulatum could be considered to
harbor six species instead of three varieties.
| |
INTRODUCTION |
The pathogenic ascomycete species
Histoplasma capsulatum Darling [teleomorph,
Ajellomyces capsulatus (Kwon-Chung) McGinnis et Katz]
occurs throughout the world and causes histoplasmosis in various
mammalian species, including humans (46, 61). The fungus
grows as a saprobe in nature and is acquired by the inhalation of
airborne microconidia or hyphal fragments. Once inhaled, the fungus
transforms from a mycelium to a pathogenic yeast form. Histoplasmosis
primarily affects the host's lungs, and its symptoms vary greatly. The
vast majority of infected people are asymptomatic; however, the
fungus can cause disseminated histoplasmosis in otherwise healthy
people, and especially in immunocompromised individuals and AIDS
patients (46).
Distinct genotypes and varieties of H. capsulatum
which show different clinical manifestations and geographical
distributions are known. Cases of histoplasmosis due to H. capsulatum var. capsulatum have been reported in at
least 60 countries on all continents (1), but they are
especially prevalent in the eastern half of the United States and
most of Latin America (46). In North America, two
prevalent groups (class 1 and class 2) of H. capsulatum isolates which showed differences in growth phenotype
(53) and restriction fragment length polymorphisms in
mitochondrial and genomic DNA have been identified (63, 68).
The North American class 1 strains (NAm Hcc1; see Table
1 for this and other abbreviations) have
been isolated mainly from patients with AIDS, whereas the North
American class 2 strains (NAm Hcc2) have been isolated from patients both with and without AIDS (64). H. capsulatum var. duboisii Ciferri (1960) is the causal
agent of African histoplasmosis and is endemic in the tropical areas of
Africa (61). African histoplasmosis is characterized by the
presence of lesions, primarily in cutaneous, subcutaneous, and osseous
tissues, and by the larger size of the yeast cells. H. capsulatum var. farciminosum (Rivolta) Weeks et al.
causes subcutaneous and ulcerated lesions of the skin in horses and
mules (46). The disease is widespread throughout Europe,
North Africa, India, and South Asia. The morphology of the yeast cell
of H. capsulatum var. farciminosum resembles
that of H. capsulatum var. capsulatum
(59).
Despite the clinical importance of the organism, the
phylogenetic relationships among the varieties and
geographical groups of H. capsulatum are presently
unresolved. Leclerc et al. (49) and Guého et
al. (37) have included representatives of the three H. capsulatum varieties in their phylogenetical
studies of onygenalean fungi. However, the phylogeny of H. capsulatum varieties was not clearly resolved because there was
not sufficient variation in the conserved rRNA gene sequences. In this
research, we used 46 isolates comprising the three varieties and
DNA sequences of four protein coding genes to analyze the evolutionary
relationships of H. capsulatum varieties. In the
process we also examined the mode of reproduction in isolates of one
clade of H. capsulatum var. capsulatum.
| |
MATERIALS AND METHODS |
Fungal isolates, culture, and DNA isolation.
Table
2 lists the isolates used in the study.
H82 and H83 were isolated from a single patient who lived in Panama
(9). H87 and H91 were also isolated from a single patient,
who was infected at the Guinea-Liberia border (23). Each of
the remaining clinical and veterinary isolates was derived from
different individuals. Living isolates were manipulated and cultivated
under biohazzard level 3 containment. Mycelium was grown in liquid
medium and heat killed for safety, and DNA was extracted as previously
reported (14, 17).
Design of PCR primers.
The DNA sequences of four nuclear
genes of H. capsulatum available from GenBank were used
to design PCR primers (Table 3). Internal
transcribed spacer (ITS) primers were derived from White et al.
(70). The primers (sequences) were as follows (5' to 3'):
arf1 (agaatatggggcaaaaagga) and arf2
(cgcaattcatcttcgttgag) (ADP-ribosylation factors); H-anti3
(cgcagtcacctccatactatc) and H-anti4
(gcgccgacattaaccc) (H antigen precursors); ole3
(tttaaacgaagcccccacgg) and ole4
(caccacctccaacagcagca) (delta-9 fatty acid
desaturases); tub1 (ggtggccaaatcgcaaactc) and tub2
(ggcagctttccgttcctcagt) (alpha-tubulins); ITS4
(tcctccgcttattgatatgc) and ITS5
(ggaagtaaaagtcgtaacaagg) (internal transcribed
spacers plus rRNA genes). PCRs were performed with 2 µl of
diluted genomic DNA template in 50-µl reactions. Reactions consisted
of 0.45 µM of each primer, 1.0 U of AmpliTaq DNA
polymerase (Perkin-Elmer), 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 50 mM KCl, and 0.2 mM deoxynucleotide triphosphates
with the following temperature profile: a 15-s DNA denaturation step at
94°C, a 30-s annealing step (see below), and a 1-min extension step
at 72°C for 32 cycles, followed by a 5-min final extension step at
72°C. The annealing temperature in the first cycle was 65°C. This
annealing temperature was subsequently reduced by 0.7°C/cycle for the
next 12 cycles, and thereafter, the PCR was continued at an annealing
temperature of 56°C for the remaining 20 cycles (Touchdown PCR
[24]).
Sequencing.
Automated sequencing was done with an ABI dye
terminator cycle sequencing ready reaction kit and PCR primers in
accordance with the recommendations of the manufacturer (Applied
Biosystems Division, Perkin-Elmer, Foster City, Calif.). Sequences were
generated from both strands and were edited and initially aligned with
the SEQUENCE NAVIGATOR (v1.01; Applied Biosystems) software package, and the alignments were then optimized visually.
Data analysis.
Phylogenetic analyses (both parsimony and
neighbor joining) were performed by using PAUP* 4.0.0d62, a prerelease
version generously provided by D. Swofford, Smithsonian Institute of
Natural History. Most-parsimonious (MP) trees were generated by the
heuristic search procedure using 1,000 replications of the random
addition sequence option. Nucleotide sites were equally weighted, with
character state transformations treated as unordered and of equal cost. Insertions and deletions were excluded from the data set. Indices of
support (bootstrap values) for internal branches were generated by 500 replications of the bootstrap procedure (29).
Neighbor-joining (NJ) trees were generated by using a
maximum-likelihood correction for multiple hits with a
transition/transversion ratio of 2 (40). Base deletions were
treated as missing data. The Kimura two-parameter distance option gave
the same topology as the maximum-likelihood option. The maximum
sequence divergence value of each locus (Table 3) and the average and
maximum sequence divergence values of combined loci (Table
4) correspond to the maximum and average values in the matrices of pairwise mean distances (nucleotide substitutions per nucleotide) of all isolates in Table 2.
View this table:
[in this window]
[in a new window]
|
TABLE 4.
Within- and between-population sequence divergence values
from combined data of arf, H-anti, ole,
and tub1a
|
|
| |
RESULTS |
Amplification and DNA sequence analysis of nuclear gene loci.
Forty-six isolates of H. capsulatum representing the
three varieties taken from clinical and environmental sources of
diverse geographical origin were used in this study (Table 2). DNA
sequences of published protein coding genes of H. capsulatum were used to design PCR primers. Primers were located
in exons to amplify exons as well as flanking introns. The ITS region
in the rRNA array was also examined. To select genes with sufficient
variation to address questions of Histoplasma evolution
with statistical confidence, a representative isolate of each variety
and geographical group was chosen for testing. Each candidate gene was
PCR amplified from the tester isolates. DNA sequences of successfully
amplified products were then determined. DNA sequence divergence values are shown in Table 3. Genes for proteins arf (50), H-anti
(22), ole (32), and tub1 (39)
contained moderate levels (3.0 to 7.0% substitution per nucleotide at
maximum) of DNA polymorphisms, which were useful for phylogenetic
analysis of H. capsulatum varieties. The ITS region in
the rRNA gene array is widely used for taxonomic and phylogenetic
studies of fungi at subgenus or subspecies level (8, 70).
However, DNA polymorphism in the ITS region was not prevalent enough to
resolve the varieties of H. capsulatum. The four
protein genes were examined further for phylogenetic study by
obtaining sequences for each gene from all 46 isolates (Table 2).
Combining DNA sequence data for the four loci gave us 1,577 aligned
sites, of which 208 were variable (Fig.
1). Introns were more
variable than exons in all genes examined (Table 3). The 46 H. capsulatum isolates fell into 33 unique
multilocus genotypes. Isolates with identical genotypes were found for
NAm Hcc1 (four of five isolates), Panama Hcc (all
three isolates), and H. capsulatum var.
farciminosum (all three isolates). Among 13 isolates of NAm Hcc2, 10 genotypes were found, which were very homogeneous
with a maximum diversity of 0.38% nucleotide substitutions per
nucleotide (Table 4). Isolate H79, taken from a striped skunk in the
1940s (27), grouped with the four NAm Hcc1
isolates, from which it differed by a single T-C transition in 1,577 bp
of sequence. H79 is therefore the first nonhuman NAm
Hcc1 isolate and predates by 20 years what had been thought
to be the initial class 1 isolate, the Downs strain (33).
Among the four H. capsulatum var.
duboisii isolates, three genotypes with a maximum
divergence of 1.02% were found. The SAm Hcc isolates were
the most variable. Of 18 isolates examined, 16 unique genotypes were
identified, and the maximum sequence divergence among the group is
2.81%.
View larger version (37K):
[in this window]
[in a new window]
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Polymorphic sites in combined data of arf (A), H-anti
(B), ole (C), and tub1 (D) loci of H. capsulatum. The
second column of each panel shows the name of the multilocus genotype,
which was named after the isolate. When more than one isolate had same
genotype, the isolate name with the smallest number was used for the
genotype. The sequence of H88 is used as the master sequence and only
nucleotides that differ from H88 sequence are shown; otherwise,
nucleotides are shown as dots. A hyphen (-) denotes a gap. The shaded
bars represent the locations of exons.
|
|
Phylogenetic analyses of protein coding genes.
From 208 variable sites in the aligned 1,577 bp DNA, all gaps, of which there
were 36, and all uninformative sites, of which there were 58, were
excluded. The total of 114 informative sites were distributed
among the protein coding genes as follows: 23 positions in arf, 27 in
H-anti, 33 in ole, and 31 in tub1. The data for each gene were used
with a parsimony analysis to analyze the phylogenetic relationships of
the 33 genotypes (Fig. 2a through d).
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 2.
A single MP tree resulting from analysis of DNA
sequences of the 33 multilocus genotypes from each of the four gene
regions sequenced. Isolates with an identical genotype are shown
together with the representative isolate for each of the 33 genotypes.
CI, consistency index; RI, retention index; RC, rescaled consistency
index. Numbers below branches represent indices of support based on 500 bootstrap replications of the parsimony procedure. Only values  70%
are shown. Branch lengths are proportional to the numbers of changes in
informative characters between nodes (scale at the lower left). SAm
Hcc A, South American H. capsulatum group A;
SAm Hcc B, South American H. capsulatum
group B; Hc farcimi., H. capsulatum
farciminosum. Abbreviations of other groups are listed in Table
1.
|
|
Parsimony analysis showed that isolates in the groups NAm
Hcc1, NAm
Hcc2, Panama
Hcc, and
H. capsulatum var.
duboisii formed
clades with all loci, with the exception of the location of genotypes
H81 and H88 (Fig.
2a to d). On the other hand, SAm
Hcc
genotypes
did not form such distinct clades. The majority of the
Colombian
H. capsulatum var.
capsulatum
genotypes (H60 to -64, -67, -71,
-73, -74, and -76) formed a cluster
(SAm
Hcc group A), and Colombian
H. capsulatum var.
capsulatum genotypes H59, H68, and the
Argentine
genotype H85 formed the other cluster (SAm
Hcc
group B). Surprisingly,
the horse pathogen
H. capsulatum var.
farciminosum was a member
of SAm
Hcc group A. South American
H. capsulatum
var.
capsulatum isolates H66, H69, and H140 were distant
from the two major SAm
Hcc groups.
We attempted to root these parsimony trees with the fungal
species thought to be the closest relatives of
H. capsulatum,
Blastomyces dermatitidis and
Paracoccidioides brasiliensis (
11,
37). Of
the
four protein genes, arf and tub1 genes from
B. dermatitidis and
P. brasiliensis were successfully
amplified with primers designed
based on
H. capsulatum
sequences. However, DNA sequences of both
B. dermatitidis and
P. brasiliensis appeared to be very
distant
from
H. capsulatum (Table
3). We were unable to
align the DNA
sequences of
B. dermatitidis and
P. brasiliensis with those of
H. capsulatum without
significant ambiguity. Therefore, we could
not use these sequences
to locate the root on the tree of
H. capsulatum varieties and populations. Nonetheless, it is noteworthy that
no matter
where the tree is rooted,
H. capsulatum var.
capsulatum cannot form a monophyletic group; that is, no
clade can be found
that contains all
H. capsulatum var.
capsulatum isolates, and
only
H. capsulatum
var.
capsulatum isolates.
We then examined the possibility of combining the data for the
four protein coding genes into one phylogenetic analysis to
improve the
resolution. It is useful in phylogenetic analysis
to test the
congruence of separate data sets before combining
them because
incongruence of gene phylogenies may indicate problematic
data sets
(
41,
58). However, when multiple individuals of
a species
are included in a phylogenetic analysis, incongruence
among gene
genealogies may be expected due to recombination (
3).
With
this caveat in mind, we investigated congruence by two related
methods,
incongruence length difference (
28,
54) and the partition
homogeneity test (
34,
41).
Incongruence length difference (
I) was calculated as
where
Lc = the tree length of the
summed data and
Li = the tree length for the
ith gene data set.
I varies from 0 when all
gene
phylogenies are congruent to large values when they are incongruent.
For the 33 genotypes given in Table
5,
I = 35, a much
larger
value than the sum of homoplasy for the four gene phylogenies
(
12) and one that is indicative of incongruence.
The partition homogeneity test compares the sum of lengths of the gene
phylogenies to the distribution of such sums for 500
data sets where
the variable positions for all the genes have
been resampled without
replacement to shuffle the sites among
the genes while keeping the
number of variable sites per gene
constant. The null hypothesis is that
all gene genealogies are
congruent, and swapping sites among the gene
data sets will not
introduce homoplasy nor lead to longer trees. With
Histoplasma,
the sum of tree lengths for observed gene
phylogenies (135) was
significantly smaller than the sum for any of 500 shuffled data
sets (range, 151 to 163; mode, 158;
P < 0.002), demonstrating
incongruence among the gene phylogenies
(Fig.
3).
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 3.
Partition homogeneity test in the total data set
comparing the observed summed tree lengths with the distribution of
summed tree lengths calculated for 500 randomized data sets.
|
|
Given that
H. capsulatum has been shown to recombine in
nature (
17), incongruence at the species level was to be
expected.
The next step was to determine if the incongruence lay above
or
at the species level. A neighbor-joining and a parsimony tree
were
constructed using the combined data set (Fig.
4a and
b).
As has been seen for the individual
gene trees, the six clades,
NAm
Hcc 1, NAm
Hcc 2,
H. capsulatum var.
duboisii, Panama
Hcc,
SAm
Hcc group A, and SAm
Hcc
group B are distinct and are supported
by high bootstrap values ranging
from 97 to 100%. Because the
locations of H66, H69, and H140 were
inconsistent in individual
protein gene trees, they were unresolved in
the strict consensus
tree of the combined data set. In the SAm
Hcc group A clade, some
of the internal branches were
collapsed, and only two of the branches
are supported by bootstrap
values above 70%. Therefore, we conclude
that the deep and
well-supported branches are congruent among
the gene trees and lead to
the species, whereas the shallow and
poorly supported branches are
incongruent and lie within the species.
Under this interpretation, all
isolates are accommodated in the
six clades, except H66, H69, and H140,
which we provisionally
have attached to the South American
H. capsulatum var.
capsulatum group B (Fig.
4).
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 4.
(a) NJ tree from analysis of combined data of the four
loci. Branch lengths are proportional to distance. (b) Strict consensus
of 160 MP trees derived from analysis the same data of the four loci.
Numbers below branches represent indices of support based on 500 bootstrap replications of the parsimony procedure; only values 70%
are shown. Trees were rooted using H. capsulatum var.
duboisii as the outgroup taxon based on the morphology of
pathogenic yeasts.
|
|
SAm Hcc group A has a recombining population
structure.
The observed poor resolution in the combined gene tree
indicates genetic recombination in the SAm Hcc group A
clade. Let us examine, for example, isolates H60, H71, and H73. In the
arf and H-anti trees, these three isolates share an identical set of
parsimony informative sites (Fig. 2). In the ole tree, H60 and H73
share identical sites and are one step distant from H71. In contrast, in the tub1 tree, H71 and H73 are identical and seven steps away from
H60. All genotypes in the SAm Hcc group A were subjected to
parsimony analysis, and the values obtained for
Lc, Li, and I are listed in Table 6, which
gives an I value of 6. The large I value is an
indication of sexual recombination in the SAm Hcc group A
population. The partition homogeneity test was also carried out by
reconstructing 4,000 randomized data sets (Fig.
5). The observed sum of gene genealogy
(tree) lengths of 24 was significantly smaller than those calculated
from randomized data (range, 24 to 30; mean and mode, 28; P < 0.0005). This feature further corroborates the occurrence of
genetic recombination in SAm Hcc group A. Note that this
result does not address recombination in any of the other clades, where
there are too few data (due to too few isolates or too little
variation) to obtain a significant result. Of course, previous research
on NAm Hcc2 using arbitrary loci has supported recombination
in this group (17).
View this table:
[in this window]
[in a new window]
|
TABLE 6.
Observed and minimum MP tree lengths for each of four
loci among South American H. capsulatum var.
capsulatum group A
|
|
View larger version (31K):
[in this window]
[in a new window]
|
FIG. 5.
Partition homogeneity test in the South American
H. capsulatum var. capsulatum group A
comparing the observed summed tree lengths with the distribution of
summed tree lengths calculated for 4,000 randomized data sets.
|
|
| |
DISCUSSION |
Speciation in H. capsulatum.
Phylogenetic analysis
revealed that H. capsulatum var. capsulatum
was not monophyletic. In each of the four protein gene trees, there
were at least six distinct clades in the H. capsulatum
isolates we examined: NAm Hcc1, NAm Hcc2,
H. capsulatum var. duboisii, Panama
Hcc, SAm Hcc group A, and SAm Hcc
group B. No clear association between geographical groups of
H. capsulatum var. capsulatum was observed.
In the combined gene tree, each clade had a deep branch that was
supported by a high bootstrap value (97 to 100%). The concordance
between the four gene genealogies at the deep branches and their
lengths suggests that these six groups have been isolated reproductively from each other for a long time. Hence, each of the six
groups corresponds to a phylogenetic species. Phylogenetic species have
been defined as the smallest clade grouping populations or lineages
diagnosable by a unique combination of character states, in this case,
shared, derived nucleotide substitutions (57). However, this
definition could be too narrow if the gene upon which the species
concept was based proved to be polymorphic in a randomly mating
population, because individuals would be grouped by alleles. Our use of
four different gene fragments guards against this possibility by using
branches that are congruent in the four gene trees to group individuals
into species and by recognizing that conflict among gene genealogies
would be expected to occur within recombining species (4,
6).
The North American H. capsulatum populations.
It was found that the genetic distance between the NAm
Hcc1 and NAm Hcc2 is comparable to or larger than
that of any other pair of groups, e.g., NAm Hcc2 versus
H. capsulatum var. duboisii or NAm
Hcc2 versus H. capsulatum var.
farciminosum (Table 4). The two groups showed no close
relationship in any of the four loci examined. This implies that the
NAm Hcc1 and NAm Hcc2 are not historically
closely related and that there is no genetic exchange between the
groups. By comparison with Coccidioides immitis (43,
56), it seems certain that NAm Hcc1 and NAm
Hcc2 have been genetically isolated for at least several
million years (20 million years, assuming a substitution rate of
third-base positions of µ = 10
9 bp/yr), far older than
the date when humans first encountered H. capsulatum in
the New World (no earlier than 65,000 years ago, and usually estimated
to be about 12,000 years before the present) (16, 35, 36).
In the laboratory however, H9 (NAm Hcc1) and H139 (NAm
Hcc2) have been mated, and gymnothecia were observed (45, 48). The gymnothecia contained ascospores, but the
ascospores did not look healthy and their viability was not determined
(45). Carter et al. (17) showed that clinical
isolates of NAm Hcc2 from Indianapolis formed a recombining
population structure. Since NAm Hcc1 and Hcc2
have overlapping distributions and are sexually compatible, observation
of hybrid genotypes in nature could be expected. However, there is no
sign of hybridization in four isolates of NAm Hcc1 and two
isolates of NAm Hcc2, all from St. Louis, Mo. It may be that
interspecific mating does not occur in nature, or it may be
that hybrid progeny are less fit than those from either species alone
(12). Examining many more isolates may shed light on this problem.
Genetic diversities within both populations of NAm
Hcc1 and
Hcc2 were much smaller than that of SAm
Hcc or
H. capsulatum var.
duboisii. This implies
that each North American group has recently
emerged from a small
evolutionary bottleneck, in which alleles
became fixed or nearly fixed
in all loci. Rippon (
61) suggested
an association
between starlings and the spread of
H. capsulatum in North America. The saprobic phase of
H. capsulatum
lives on
guano of bat and bird species. However, not all guano serves
equally
well as a substrate, and the guano of starlings (
Sturnus
vulgaris)
is one of the infested sources of
H. capsulatum. In North America,
the areas in which
H. capsulatum is most highly endemic are also
the areas with the
greatest concentrations of starlings (
61).
Starlings were
introduced into New York from Europe in 1890 and
spread westward
(
7,
20). The low genetic diversity of
H. capsulatum in North America might be explained by the recent
spread
via starlings of
H. capsulatum already in North
America. Of course,
the long branches separating North American and
South American
H. capsulatum var.
capsulatum
make it certain that these two groups
were genetically isolated long
before the introduction of starlings
into North
America.
The low-virulence race, NAm
Hcc1, became conspicuous after
the AIDS pandemic. So far, NAm
Hcc1 has been isolated
only from
AIDS patients (
64) and an 86-year-old
woman (Downs isolate)
(
33). We have identified one
additional strain, obtained from
a striped skunk in the 1940s in
Georgia, belonging to the NAm
Hcc1, which suggests NAm
Hcc1 existed in nature long before the
AIDS pandemic, as had
been suggested by Spitzer et al. (
64).
The absence of NAm
Hcc1 isolates in collections of clinical isolates
taken from
patients with disseminated disease prior to the AIDS
pandemic
(
68) suggests that these isolates seldom cause disease
in
otherwise healthy humans. As with NAm
Hcc2, the genetic
distance
from NAm
Hcc1 to isolates in any other clade is
large.
H. capsulatum var. duboisii.
H.
capsulatum var. duboisii is distinct from H. capsulatum var. capsulatum not only in epidemiology and
medical manifestations but also in the morphology of the yeast
phase (1). H. capsulatum var.
duboisii was described originally as the species
H. duboisii (26) but was redefined as
a variety because the morphological and immunological differences
between the two fungi were insufficient (18, 25). As with
H. capsulatum var. capsulatum, H. capsulatum var. duboisii is also associated with bat
guano (38). Kwon-Chung (44) demonstrated
that the sexual state of H. capsulatum var. duboisii was identical to that of H. capsulatum var. capsulatum. Furthermore, she
successfully obtained sexual crosses between isolates of H. capsulatum var. duboisii and the reciprocal mating types of NAm Hcc2 (H138 and H139). On agar media, the
ascospores produced by the intervariety cross failed to germinate, but
when the ascospore suspension was injected into mice,
Histoplasma colonies were subsequently recovered from livers
and spleens (47). Thus, H. capsulatum var.
capsulatum and H. capsulatum var.
duboisii were claimed to belong to a single biological
species, in which the two varieties share a specific mate
recognition system. However, Kwon-Chung (47) discussed
the possibility that the progeny of the cross was an interspecies
hybrid. In fact, the progeny isolates were sterile when
backcrossed with the parents, suggesting that the hybrids
had lost their sexual ability. As in other cases, the biological
species concept is difficult to apply to allopatric populations
(71), which would be the case when crossing NAm Hcc2 and H. capsulatum var.
duboisii. Unlike sympatric species, allopatric species tend
to lack mating suppression mechanisms and therefore are sexually
compatible. Uniting taxa because they hybridize can lead to
nonhistorical groups, which are problematic in speciation analysis
(13, 71). Our data support Vanbreuseghem's view (see
reference 47) that H. capsulatum
var. duboisii and H. capsulatum should be
recognized as two independent species.
The South American H. capsulatum populations.
Isolates of SAm Hcc were extremely rich in polymorphisms,
and most isolates fell into two well-supported clades. No significant differences in clinical manifestations of members of either group have
been noted (52). The population genetic analysis revealed recombination in the SAm Hcc group A population. However, no
recombinant between the SAm Hcc group A and B has yet been
identified. As the Panama Hcc was very distant from the SAm
Hcc population, there may be more clades or phylogenetic
species existing in Central and South America.
DNA of H140 was isolated directly from the liver of an owl monkey that
lived in a research facility in Maryland. The monkey
was caught in the
wild and was of Peruvian origin. An autopsy
revealed massive numbers of
budding yeast in the liver, but the
yeast was unculturable. Several
efforts to identify the yeast
have been made by others (
55).
The morphology of the yeast resembled
H. capsulatum
var.
duboisii and
Loboa loboi. An
immunohistochemistry
assay was conducted, but the results were
inconclusive. Our phylogenetic
analysis, however, conclusively
identified the yeast as
H. capsulatum and furthermore
demonstrated a close relationship of H140 to Colombian
H. capsulatum. This result was consistent with the Peruvian origin
of
the monkey and provided evidence that the infection was not
acquired in
Maryland. Our PCR-based approach does not require
a pure culture of the
pathogen, but only a small amount of infected
tissue, and it
demonstrates how the phylogenetic approach can
help us to understand
epidemiology.
H. capsulatum var. farciminosum.
The
most striking finding of this study is the phylogenetic position of
H. capsulatum var. farciminosum. H. capsulatum var. farciminosum is deeply buried in the
branch of SAm Hcc group A, both in the parsimony and NJ
trees, looking as if it were an isolate of South American H. capsulatum var. capsulatum. H. capsulatum var.
farciminosum is pathologically distinct; it infects horses and other Equidae and generally causes subcutaneous and ulcerated lesions of the skin. Primary infectious sites are thought to be skin
injuries from harnesses, and infection through the pulmonary system is
rare (46). H. capsulatum var.
farciminosum was formerly described as an independent
species but this assessment was changed to a variety of H. capsulatum due to the close morphological similarities of the
mycelial and yeast forms (69). Antigenically, H. capsulatum var. farciminosum and H. capsulatum var. capsulatum are indistinguishable (65). We suggest that H. capsulatum var.
farciminosum is not a separate taxon long adapted to Equidae
but represents a recent infection of these animals caused by
H. capsulatum var. capsulatum, presumably
acquired in South America, transported to the Old World on an infected
animal, and spread in the Old World from animal to animal via skin
contact. Several observations pertain to this hypothesis. H. capsulatum var. farciminosum is prevalent in northern Egypt, where cases of histoplasmosis in humans are rare but do exist.
Histoplasmin surveys showed that in Egypt and Israel, positive reaction
of the skin test was infrequent or absent (2). However, Ajello et al. (2) successfully isolated H. capsulatum from soil samples from a bat-infested cave in Israel.
These authors suggested the possibility that in these areas climatic
conditions were not suitable for the proliferation and survival of
H. capsulatum in the soil. The proposed scenario would
explain why H. capsulatum var. farciminosum
isolates from Egypt and India are genetically identical at the four
gene sequences and more closely related to some South American isolates
than to others. It would also explain why animals kept in crowded
conditions, such as those at racehorse maintenance facilities, are
likely to become infected (31). It would be valuable to
challenge this scenario by including clinical and soil isolates from
Egypt or Israel in future investigations.
Phylogeny for epidemiological studies.
The data presented here
document the genetic differentiation of the different geographical and
clinical groups of H. capsulatum. Each clade has many
nucleotide positions that are unique shared characters in the language
of phylogenetics, or fixed alleles in that of population genetics. This
genetic differentiation indicates that the clades are phylogenetic
species (5) and have the genetic differentiation expected of
biological species (4). With the exception of the clade for
H. capsulatum var. duboisii, members of the
different clades do not show morphological differences. However,
differences in pathogenicity in the case of members of the NAm
Hcc1 clade indicate that phenotypic differentiation is following the genetic differentiation and we might expect that further
differences will be found. The emergence of hosts with different
susceptibilities due to the human immunodeficiency virus pandemic and
voluntary immunosuppression and to the progressive intensification of
international travel and immigration has increased the number of cases
of histoplasmosis acquired in areas in which H. capsulatum is endemic by hosts not expected to contract this disease (51). From the clinical point of view, it may
become increasingly important to identify pathogens to their genetical background and geographic origin. PCR-based phylogenetic analyses based on the genetic variation demonstrated in studies like ours can provide this identification. However, such identification and
typing methods are only as good as the sampling of individual fungi and
genes used to discover the genetically isolated groups or species
(66). Acquisition of additional isolates in poorly sampled
geographic locations will improve our ability to identify and type, as
well as our knowledge of the world distribution of H. capsulatum.
In addition to
H. capsulatum, several other fungal
pathogens, such as
Candida albicans,
Cryptococcus neoformans,
Aspergillus fumigatus,
and
Coccidioides immitis have become expanding threats
due
to immunosuppressive therapy and the AIDS pandemic. Genetic
differentiation that correlates with geographic origin as well
as
allopatric species have been detected among populations of
Coccidioides immitis (
15,
43),
H. capsulatum (
42), and
Cryptococcus neoformans
var.
gattii (
10,
62). Conversely, genetic
differentiation
without geographic correlation has been seen in
A. fumigatus (
21,
60),
Candida
albicans (
19,
67), and
Cryptococcus
neoformans var.
neoformans (
10,
30).
| |
ACKNOWLEDGMENTS |
We thank E. Keath, G. Kobayashi, J. McEwen, A. Restrepo, L. Wheat, P. Connolly, S. Moser, B. Hines, W. Dismukes, G. Miller, E. Bagagli, Z. Pires de Camargo, and K. Orle for supplying the isolates,
DNA and associated clinical information; G. Koenig for technical
assistance with fungal culture and DNA isolation; D. Geiser, S. Mack,
and F. Harbinski for phylogenetic analysis; and J. Kwon-Chung for
providing unpublished mating results.
Financial support for this work was provided by the National Institutes
of Health (grant HL55953 to J.W.T.).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Roche Molecular
Systems, 1145 Atlantic Ave., Alameda, CA 94501. Phone: (510) 814-2947. Fax: (510) 522-1285. E-mail: takao.kasuga{at}roche.com.
| |
REFERENCES |
| 1.
|
Ajello, L.
1983.
Histoplasmosis a dual entity: histoplasmosis capsulati and histoplasmosis duboisii.
Ig. Mod.
79:3-30.
|
| 2.
|
Ajello, L.,
E. S. Kuttin,
A. M. Beemer,
W. Kaplan, and A. Padhye.
1977.
Occurrence of Histoplasma capsulatum Darling, 1906 in Israel, with a review of the current status of histoplasmosis in the Middle East.
Am. J. Trop. Med. Hyg.
26:140-147.
|
| 3.
|
Avise, J. C., and R. M. Ball, Jr.
1990.
Principles of genealogical concordance in species concepts and biological taxonomy.
Oxf. Surv. Evol. Biol.
7:45-67.
|
| 4.
|
Avise, J. C., and K. Wollenberg.
1997.
Phylogenetics and the origin of species.
Proc. Natl. Acad. Sci. USA
94:7748-7755[Abstract/Free Full Text].
|
| 5.
|
Baum, D. A., and M. J. Donoghue.
1995.
Choosing among alternative "phylogenetic" species concepts.
Syst. Bot.
20:560-573.
|
| 6.
|
Baum, D. A., and K. L. Shaw.
1995.
Genealogical perspectives on the species problem, p. 289-303.
In
P. C. Hoch, and A. G. Stephenson (ed.), Experimental and molecular approaches to plant biosystematics. Missouri Botanical Garden, St. Louis, Mo.
|
| 7.
|
Bent, A. C.
1950.
Life histories of North American wagtails, shrikes, vireos and their allies, order Passeriformes. U.S. National Museum bulletin 197. U.S.
Government Printing Office, Washington, D.C.
|
| 8.
|
Berbee, M. L.,
A. Yoshimura,
J. Sugiyama, and J. W. Taylor.
1995.
Is Penicillium monophyletic? An evaluation of phylogeny in the family Trichocomaceae from 18S, 5.8S and ITS ribosomal DNA sequence data.
Mycologia
87:210-222.
|
| 9.
|
Berliner, M. D.
1968.
Primary subcultures of Histoplasma capsulatum. I. Macro and micro-morphology of the mycelial phase.
Sabouraudia
6:111-118[Medline].
|
| 10.
|
Boekhout, T.,
A. van Belkum,
A. C. A. P. Leenders,
H. A. Verbrugh,
P. Mukamurangwa,
D. Swinne, and W. A. Scheffers.
1997.
Molecular typing of Cryptococcus neoformans: taxonomic and epidemiological aspects.
Int. J. Syst. Bacteriol.
47:432-442[Abstract/Free Full Text].
|
| 11.
|
Bowman, B. H.,
T. J. White, and J. W. Taylor.
1996.
Human pathogenic fungi and their close nonpathogenic relatives.
Mol. Phylogenet. Evol.
6:89-96[Medline].
|
| 12.
|
Brasier, C. M.
1987.
The dynamics of fungal speciation, p. 83-95.
In
A. D. M. Rayner, C. M. Brasier, and D. Moore (ed.), Evolutionary biology of the fungi. Cambridge University Press, Cambridge, United Kingdom.
|
| 13.
|
Brooks, D. R., and D. A. McLennan.
1991.
Phylogeny, ecology and behavior: a research program in comparative biology.
University of Chicago Press, Chicago, Ill.
|
| 14.
|
Burt, A.,
D. A. Carter,
G. L. Carter,
T. J. White, and J. W. Taylor.
1995.
A safe method of extracting DNA from Coccidioides immitis.
Fungal Genet. Newsl.
42:23.
|
| 15.
|
Burt, A.,
B. M. Dechairo,
G. L. Koenig,
D. A. Carter,
T. J. White, and J. W. Taylor.
1997.
Molecular markers reveal differentiation among isolates of Coccidioides immitis from California, Arizona and Texas.
Mol. Ecol.
6:781-786[Medline].
|
| 16.
|
Cann, R. L.
1994.
mtDNA and Native Americans: a southern perspective.
Am. J. Hum. Genet.
55:7-11[Medline].
|
| 17.
|
Carter, D. A.,
A. Burt,
J. W. Taylor,
G. L. Koenig, and T. J. White.
1996.
Clinical isolates of Histoplasma capsulatum from Indianapolis, Indiana, have a recombining population structure.
J. Clin. Microbiol.
34:2577-2584[Abstract].
|
| 18.
|
Ciferri, R.
1960.
Manuale di micologia media, Parte speciale, vol. 2.
Casa Editrice Renzo Cortina, Pavia, Italy.
|
| 19.
|
Clemons, K. V.,
F. Feroze,
K. Holmberg, and D. A. Stevens.
1997.
Comparative analysis of genetic variability among Candida albicans isolates from different geographic locales by three genotypic methods.
J. Clin. Microbiol.
35:1332-1336[Abstract].
|
| 20.
|
Cooke, N. T.
1928.
The spread of the European starling in North America. U.S.
Department of Agriculture, Washington, D.C.
|
| 21.
|
Debeaupuis, J. P.,
J. Sarfati,
V. Chazalet, and J. P. Latge.
1997.
Genetic diversity among clinical and environmental isolates of Aspergillus fumigatus.
Infect. Immun.
65:3080-3085[Abstract].
|
| 22.
|
Deepe, G. S., Jr., and G. G. Durose.
1995.
Immunobiological activity of recombinant H antigen from Histoplasma capsulatum.
Infect. Immun.
63:3151-3157[Abstract].
|
| 23.
|
Delacretaz, J., and D. Grigoriu.
1972.
Histoplasmose Africaine developpee sur une piqure d'insecte.
Sabouraudia
10:24-25[Medline].
|
| 24.
|
Don, R. H.,
P. T. Cox,
B. J. Wainwright,
K. Baker, and J. S. Mattick.
1991.
`Touchdown' PCR to circumvent spurious priming during gene amplification.
Nucleic Acids Res.
19:4008[Free Full Text].
|
| 25.
|
Drouhet, E.
1957.
Quelques aspect biologiques et mycologiques de l'histoplasmose.
Pathol. Biol. (Paris)
33:439-461.
|
| 26.
|
Dubois, A.,
P. G. Janssens, and P. Brutsaert.
1952.
Un cas d'histoplasmose africaine avec une note mycologique sur Histoplasma duboisii n. sp., par R.
Vanbreuseghem. Ann. Soc. Belge Med. Trop.
32:569-584.
|
| 27.
|
Emmons, C. W.,
H. B. Morlan, and E. L. Hill.
1949.
Histoplasmosis in rats and skunks in Georgia.
Public Health Rep.
64:1423-1430[Medline].
|
| 28.
|
Farris, J. S.,
M. Kallersjo,
A. G. Kluge, and C. Bult.
1995.
Testing significance of incongruence.
Cladistics
10:315-319.
|
| 29.
|
Felsenstein, J.
1985.
Confidence limits on phylogenies: an approach to using the bootstrap.
Evolution
39:783-791.
|
| 30.
|
Franzot, S. P.,
J. S. Hamdan,
B. P. Currie, and A. Casadevall.
1997.
Molecular epidemiology of Cryptococcus neoformans in Brazil and the United States: evidence for both local genetic differences and a global clonal population structure.
J. Clin. Microbiol.
35:2243-2251[Abstract].
|
| 31.
|
Gabal, M. A.,
F. K. Hassan,
A. A. Siad, and K. A. Karim.
1983.
Study of equine histoplasmosis farciminosi and characterization of Histoplasma farciminosum.
Sabouraudia
21:121-127[Medline].
|
| 32.
|
Gargano, S.,
G. Di Lallo,
G. S. Kobayashi, and B. Maresca.
1995.
A temperature-sensitive strain of Histoplasma capsulatum has an altered delta 9-fatty acid desaturase gene.
Lipids
30:899-906[Medline].
|
| 33.
|
Gass, M., and G. S. Kobayashi.
1969.
Histoplasmosis: an illustrative case with unusual vaginal and joint involvement.
Arch. Dermatol.
100:724-727[Abstract/Free Full Text].
|
| 34.
|
Geiser, D. M.,
J. I. Pitt, and J. W. Taylor.
1998.
Cryptic speciation and recombination in the aflatoxin-producing fungus Aspergillus flavus.
Proc. Natl. Acad. Sci. USA
95:388-393[Abstract/Free Full Text].
|
| 35.
|
Gibbons, A.
1996.
The peopling of the Americas.
Science
274:31-33[Medline].
|
| 36.
|
Greenberg, J. H.,
C. G. Turner, and S. L. Zegura.
1986.
The settlement of the Americas: a comparison of the linguistic, dental and genetic evidence.
Curr. Anthropol.
27:483-496.
|
| 37.
|
Guého, E.,
M. C. Leclerc,
G. S. de Hoog, and B. Dupont.
1997.
Molecular taxonomy and epidemiology of Blastomyces and Histoplasma species.
Mycoses
40:69-81[Medline].
|
| 38.
|
Gugnani, H. C.,
F. A. Muotoe-Okafor,
L. Kaufman, and B. Dupont.
1994.
A natural focus of Histoplasma capsulatum var. duboisii is a bat cave.
Mycopathologia
127:151-157[Medline].
|
| 39.
|
Harris, G. S.,
E. J. Keath, and J. Medoff.
1989.
Characterization of alpha and beta tubulin genes in the dimorphic fungus Histoplasma capsulatum.
J. Gen. Microbiol.
135:1817-1832[Medline].
|
| 40.
|
Hasegawa, M.,
H. Kishino, and T. Yano.
1985.
Dating of the human-ape splitting by a molecular clock of mitochondrial DNA.
J. Mol. Evol.
22:160-174[Medline].
|
| 41.
|
Huelsenbeck, J. P.,
J. J. Bull, and C. W. Cunningham.
1996.
Combining data in phylogenetic analysis.
Trends Ecol. Evol.
11:152-158.
|
| 42.
|
Keath, E. J.,
G. S. Kobayashi, and G. Medoff.
1992.
Typing of Histoplasma capsulatum by restriction fragment length polymorphisms in a nuclear gene.
J. Clin. Microbiol.
30:2104-2107[Abstract/Free Full Text].
|
| 43.
|
Koufopanou, V.,
A. Burt, and J. W. Taylor.
1997.
Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccidioides immitis.
Proc. Natl. Acad. Sci. USA
94:5478-5482[Abstract/Free Full Text].
|
| 44.
|
Kwon-Chung, K. J.
1975.
Perfect state (Emmonsiella capsulata) of the fungus causing large-form African histoplasmosis.
Mycologia
67:980-990.
|
| 45.
| Kwon-Chung, K. J. 1998. Personal
communication.
|
| 46.
|
Kwon-Chung, K. J., and J. E. Bennett.
1992.
Medical mycology.
Lea & Febiger, Malvern, Pa.
|
| 47.
|
Kwon-Chung, K. J., and W. B. Hill.
1981.
Virulence of the two mating types of Emmonsiella capsulata and the mating experiments with Emmonsiella capsulata and Emmonsiella capsulata var. duboisii, p. 48-56.
In
R. Vanbreuseghem, and C. D. Vroey (ed.), Sexuality and pathogenicity of fungi. Masson, New York, N.Y.
|
| 48.
|
Kwon-Chung, K. J.,
R. J. Weeks, and H. W. Larsh.
1974.
Studies on Emmonsiella capsulata (Histoplasma capsulatum). II. Distribution of the two mating types in 13 endemic states of the United States.
Am. J. Epidemiol.
99:44-49[Abstract/Free Full Text].
|
| 49.
|
Leclerc, M. C.,
H. Philippe, and E. Guého.
1994.
Phylogeny of dermatophytes and dimorphic fungi based on large subunit ribosomal RNA sequence comparisons.
J. Med. Vet. Mycol.
32:331-341[Medline].
|
| 50.
|
Lodge, J. K.,
R. L. Johnson,
R. A. Weinberg, and J. I. Gordon.
1994.
Comparison of myristoyl-CoA:protein N-myristoyltransferases from three pathogenic fungi: Cryptococcus neoformans, Histoplasma capsulatum, and Candida albicans.
J. Biol. Chem.
269:2996-3009[Abstract/Free Full Text].
|
| 51.
|
Manfredi, R.,
A. Mazzoni,
A. Nanetti, and F. Chiodo.
1994.
Histoplasmosis capsulati and duboisii in Europe: the impact of the HIV pandemic, travel and immigration.
Eur. J. Epidemiol.
10:675-681[Medline].
|
| 52.
| McEwen, J., and A. Restrepo. 1998. Personal
communication.
|
| 53.
|
Medoff, G.,
B. Maresca,
A. M. Lambowitz,
G. Kobayashi,
A. Painter,
M. Sacco, and L. Carratu.
1986.
Correlation between pathogenicity and temperature sensitivity in different strains of Histoplasma capsulatum.
J. Clin. Investig.
78:1638-1647.
|
| 54.
|
Mickevich, M. F., and J. S. Farris.
1981.
The implications of congruence in Menidia.
Syst. Zool.
30:351-370.
|
| 55.
| Miller, G. 1998. Personal communication.
|
| 56.
|
Nei, M.
1987.
Molecular evolutionary genetics.
Columbia University Press, New York, N.Y.
|
| 57.
|
Nixon, K. C., and Q. D. Wheeler.
1990.
An amplification of the phylogenetic species concept.
Cladistics
6:211-223.
|
| 58.
|
O'Donnell, K., and E. Cigelnik.
1997.
Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous.
Mol. Phylogenet. Evol.
7:103-116[Medline].
|
| 59.
|
Panciera, R. J.
1969.
Histoplasmic (Histoplasma capsulatum) infection in a horse.
Cornell Vet.
59:306-312[Medline].
|
| 60.
|
Rinyu, E.,
J. Varga, and L. Ferenczy.
1995.
Phenotypic and genotypic analysis of variability in Aspergillus fumigatus.
J. Clin. Microbiol.
33:2567-2575[Abstract].
|
| 61.
|
Rippon, J. W.
1988.
Medical mycology. W. B.
Saunders Company, Philadelphia, Pa.
|
| 62.
|
Sorrell, T. C.,
S. C. A. Chen,
P. Ruma,
W. Meyer,
T. J. Pfeiffer,
D. H. Ellis, and A. G. Brownlee.
1996.
Concordance of clinical and environmental isolates of Cryptococcus neoformans var. gattii by random amplification of polymorphic DNA analysis and PCR fingerprinting.
J. Clin. Microbiol.
34:1253-1260[Abstract].
|
| 63.
|
Spitzer, E. D.,
B. A. Lasker,
S. J. Travis,
G. S. Kobayashi, and G. Medoff.
1989.
Use of mitochondrial and ribosomal DNA polymorphisms to classify clinical and soil isolates of Histoplasma capsulatum.
Infect. Immun.
57:1409-1412[Abstract/Free Full Text].
|
| 64.
|
Spitzer, E. D.,
E. J. Keath,
S. J. Travis,
A. A. Painter,
G. S. Kobayashi, and G. Medoff.
1990.
Temperature-sensitive variants of Histoplasma capsulatum isolated from patients with acquired immunodeficiency syndrome.
J. Infect. Dis.
162:258-261[Medline].
|
| 65.
|
Standard, P. G., and L. Kaufman.
1976.
Specific immunological test for the rapid identification of members of the genus Histoplasma.
J. Clin. Microbiol.
3:191-199[Abstract/Free Full Text].
|
| 66.
|
Taylor, J. W.,
D. M. Geiser,
A. Burt, and V. Koufopanou.
1999.
The evolutionary biology and population genetics underlying fungal strain typing.
Clin. Microbiol. Rev.
12:126-146[Abstract/Free Full Text].
|
| 67.
|
Tsang, P. C.,
L. P. Samaranayake,
H. P. Philipsen,
M. McCulloug,
P. A. Reichart,
A. Schmidt-Westhausen,
C. Scully, and S. R. Porter.
1995.
Biotypes of oral Candida albicans isolates in human immunodeficiency virus-infected patients from diverse geographic locations.
J. Oral Pathol. Med.
24:32-36[Medline].
|
| 68.
|
Vincent, R. D.,
R. Goewert,
W. E. Goldman,
G. S. Kobayashi,
A. M. Lambowitz, and G. Medoff.
1986.
Classification of Histoplasma capsulatum isolates by restriction fragment polymorphisms.
J. Bacteriol.
165:813-818[Abstract/Free Full Text].
|
| 69.
|
Weeks, R. J.,
A. A. Padhye, and L. Ajello.
1985.
Histoplasma capsulatum variety farciminosum: a new combination for Histoplasma farciminosum.
Mycologia
77:964-970.
|
| 70.
|
White, T. J.,
T. Bruns,
S. Lee, and J. Taylor.
1990.
Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322.
In
M. H. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications. Academic Press, San Diego, Calif.
|
| 71.
|
Zink, R. M., and M. C. McKitrick.
1995.
The debate over species concepts and its implications for ornithology.
Auk
112:701-719.
|
Journal of Clinical Microbiology, March 1999, p. 653-663, Vol. 37, No. 3
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Woo, P. C. Y., Lau, C. C. Y., Chong, K. T. K., Tse, H., Tsang, D. N. C., Lee, R. A., Tse, C. W. S., Que, T.-l., Chung, L. M. W., Ngan, A. H. Y., Hui, W.-t., Wong, S. S. Y., Lau, S. K. P., Yuen, K.-y.
(2007). MP1 Homologue-Based Multilocus Sequence System for Typing the Pathogenic Fungus Penicillium marneffei: a Novel Approach Using Lineage-Specific Genes. J. Clin. Microbiol.
45: 3647-3654
[Abstract]
[Full Text]
-
Zarnowski, R., Miyazaki, M., Dobrzyn, A., Ntambi, J. M., Woods, J. P.
(2007). Typing of Histoplasma capsulatum strains by fatty acid profile analysis. J Med Microbiol
56: 788-797
[Abstract]
[Full Text]
-
Bain, J. M., Tavanti, A., Davidson, A. D., Jacobsen, M. D., Shaw, D., Gow, N. A. R., Odds, F. C.
(2007). Multilocus Sequence Typing of the Pathogenic Fungus Aspergillus fumigatus. J. Clin. Microbiol.
45: 1469-1477
[Abstract]
[Full Text]
-
Bubnick, M., Smulian, A. G.
(2007). The MAT1 Locus of Histoplasma capsulatum Is Responsive in a Mating Type-Specific Manner. Eukaryot Cell
6: 616-621
[Abstract]
[Full Text]
-
Bohse, M. L., Woods, J. P.
(2007). Expression and Interstrain Variability of the YPS3 Gene of Histoplasma capsulatum. Eukaryot Cell
6: 609-615
[Abstract]
[Full Text]
-
Fraser, J. A., Stajich, J. E., Tarcha, E. J., Cole, G. T., Inglis, D. O., Sil, A., Heitman, J.
(2007). Evolution of the Mating Type Locus: Insights Gained from the Dimorphic Primary Fungal Pathogens Histoplasma capsulatum, Coccidioides immitis, and Coccidioides posadasii. Eukaryot Cell
6: 622-629
[Abstract]
[Full Text]
-
Rokas, A., Payne, G., Fedorova, N.D., Baker, S.E., Machida, M., Yu, J., Georgianna, D. R., Dean, R. A., Bhatnagar, D., Cleveland, T.E., Wortman, J.R., Maiti, R., Joardar, V., Amedeo, P., Denning, D.W., Nierman, W.C.
(2007). What can comparative genomics tell us about species concepts in the genus Aspergillus?. SIM
59: 11-17
[Abstract]
[Full Text]
-
Balajee, S. A., Nickle, D., Varga, J., Marr, K. A.
(2006). Molecular Studies Reveal Frequent Misidentification of Aspergillus fumigatus by Morphotyping.. Eukaryot Cell
5: 1705-1712
[Abstract]
[Full Text]
-
Lasker, B. A.
(2006). Nucleotide Sequence-Based Analysis for Determining the Molecular Epidemiology of Penicillium marneffei.. J. Clin. Microbiol.
44: 3145-3153
[Abstract]
[Full Text]
-
Magrini, V., Warren, W. C., Wallis, J., Goldman, W. E., Xu, J., Mardis, E. R., McPherson, J. D.
(2004). Fosmid-Based Physical Mapping of the Histoplasma capsulatum Genome. Genome Res
14: 1603-1609
[Abstract]
[Full Text]
-
Hebeler-Barbosa, F., Morais, F. V., Montenegro, M. R., Kuramae, E. E., Montes, B., McEwen, J. G., Bagagli, E., Puccia, R.
(2003). Comparison of the Sequences of the Internal Transcribed Spacer Regions and PbGP43 Genes of Paracoccidioides brasiliensis from Patients and Armadillos (Dasypus novemcinctus). J. Clin. Microbiol.
41: 5735-5737
[Abstract]
[Full Text]
-
Andersen, B., Nielsen, K. F., Thrane, U., Szaro, T., Taylor, J. W., Jarvis, B. B.
(2003). Molecular and phenotypic descriptions of Stachybotrys chlorohalonata sp. nov. and two chemotypes of Stachybotrys chartarum found in water-damaged buildings. Mycologia
95: 1227-1238
[Abstract]
[Full Text]
-
Guedes, H. L. d. M., Guimaraes, A. J., Muniz, M. d. M., Pizzini, C. V., Hamilton, A. J., Peralta, J. M., Deepe, G. S. Jr., Zancope-Oliveira, R. M.
(2003). PCR Assay for Identification of Histoplasma capsulatum Based on the Nucleotide Sequence of the M Antigen. J. Clin. Microbiol.
41: 535-539
[Abstract]
[Full Text]
-
Halliday, C. L., Carter, D. A.
(2003). Clonal Reproduction and Limited Dispersal in an Environmental Population of Cryptococcus neoformans var. gattii Isolates from Australia. J. Clin. Microbiol.
41: 703-711
[Abstract]
[Full Text]
-
Kasuga, T., White, T. J., Taylor, J. W.
(2002). Estimation of Nucleotide Substitution Rates in Eurotiomycete Fungi. Mol Biol Evol
19: 2318-2324
[Full Text]
-
Fisher, M. C., Koenig, G. L., White, T. J., Taylor, J. W.
(2002). Molecular and phenotypic description of Coccidioides posadasii sp. nov., previously recognized as the non-California population of Coccidioides immitis. Mycologia
94: 73-84
[Abstract]
[Full Text]
-
Muniz, M. d. M., Pizzini, C. V., Peralta, J. M., Reiss, E., Zancope-Oliveira, R. M.
(2001). Genetic Diversity of Histoplasma capsulatum Strains Isolated from Soil, Animals, and Clinical Specimens in Rio de Janeiro State, Brazil, by a PCR-Based Random Amplified Polymorphic DNA Assay. J. Clin. Microbiol.
39: 4487-4494
[Abstract]
[Full Text]
-
Koufopanou, V., Burt, A., Szaro, T., Taylor, J. W.
(2001). Gene Genealogies, Cryptic Species, and Molecular Evolution in the Human Pathogen Coccidioides immitis and Relatives (Ascomycota, Onygenales). Mol Biol Evol
18: 1246-1258
[Abstract]
[Full Text]
-
Morais, F. V., Barros, T. F., Fukada, M. K., Cisalpino, P. S., Puccia, R.
(2000). Polymorphism in the Gene Coding for the Immunodominant Antigen gp43 from the Pathogenic Fungus Paracoccidioides brasiliensis. J. Clin. Microbiol.
38: 3960-3966
[Abstract]
[Full Text]
-
O'Donnell, K., Kistler, H. C., Tacke, B. K., Casper, H. H.
(2000). Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci. USA
10.1073/pnas.130193297v1
[Abstract]
[Full Text]
-
Jiang, B., Bartlett, M. S., Allen, S. D., Smith, J. W., Wheat, L. J., Connolly, P. A., Lee, C.-H.
(2000). Typing of Histoplasma capsulatum Isolates Based on Nucleotide Sequence Variation in the Internal Transcribed Spacer Regions of rRNA Genes. J. Clin. Microbiol.
38: 241-245
[Abstract]
[Full Text]
-
O'Donnell, K., Kistler, H. C., Tacke, B. K., Casper, H. H.
(2000). Gene genealogies reveal global phylogeographic structure and reproductive isolation among lineages of Fusarium graminearum, the fungus causing wheat scab. Proc. Natl. Acad. Sci. USA
97: 7905-7910
[Abstract]
[Full Text]
Top
Abstract
Introduction
