Previous Article | Next Article ![]()
Journal of Clinical Microbiology, March 1999, p. 694-699, Vol. 37, No. 3
The Second Department of Internal Medicine,
Oita Medical University, Hasama-machi, Oita 879-5593, Japan
Received 17 June 1998/Returned for modification 20 July
1998/Accepted 18 December 1998
Deep-seated trichosporonosis is a lethal opportunistic infection
that disseminates rapidly and widely in immunocompromised patients, and
early diagnosis is crucial for the treatment of this infection. We
developed a novel nested-PCR assay that detects DNA specific for
clinically important strains of Trichosporon in serum
samples from patients with disseminated trichosporonosis. In this
assay, two sets of oligonucleotide primers were derived from the
sequence of 26S rRNA genes of Trichosporon asahii. The specific fragment was amplified from T. asahii and T. mucoides, but not from other microorganisms, including some other
basidiomycetous fungi (Cryptococcus, Malassezia,
Rhodotorula, and Sporobolomyces). Target DNA
was detected by the nested PCR with as little as 5 fg of the extracted
DNA of T. asahii. In a study using 11 clinical samples, the
specific fragment was detected by the nested PCR in 64% (7 of 11) of
sera from patients with histologically diagnosed disseminated
trichosporonosis, while glucuronoxylomannan antigen was detected in
only 54% (6 of 11) of the samples. Our new nested-PCR assay using
serum samples can be performed repeatedly throughout the course of the
disease. In addition, not only can it be used for early diagnosis of
trichosporonosis, but it may also be beneficial for monitoring its
progress or response to therapy.
Disseminated trichosporonosis is a
lethal opportunistic infection associated with morbidly severe
conditions, such as rapidly developing respiratory failure, renal
failure, or disseminated intravascular coagulation syndrome, in
immunocompromised patients (e.g., those with hematological
malignancies) (19). In recent years, the efficacy of
different combination therapies for this condition has been reported.
These include a variety of antifungal agents and granulocyte-colony
stimulating factors (G-CSFs) (3, 14). However, these
therapies are only effective if the disease is detected at an early
stage, and, therefore, early diagnosis is an important step in the
successful management of patients with disseminated trichosporonosis.
Unfortunately, an early diagnosis of the disease is very difficult, and
in most cases, this disease is only confirmed at autopsy. A firm
diagnosis of disseminated trichosporonosis is usually established by
histological examination of tissue samples obtained by biopsy as well
as by detecting the causative pathogenic fungi in clinical samples.
However, invasive examinations, such as biopsy, cannot be repeatedly
performed in patients with severe underlying diseases, and even though
the detection of causative fungi in the blood is clinically valuable, the results of blood cultures usually become available only after a
relatively long period of time.
Various fungal antigen assays have been developed recently for the
diagnosis of deep-seated mycosis, and several assays have been applied
clinically (6, 13, 18). Even though patients with
disseminated trichosporonosis may test positive for the
glucuronoxylomannan (GXM) antigen (9, 10) or
(1 In the present study, we developed a novel PCR assay for the detection
of DNA of clinically important strains of Trichosporon species in serum samples from patients with disseminated
trichosporonosis and investigated its sensitivity and specificity.
Organisms and growth conditions.
The fungal and bacterial
strains used in this study are listed in Table
1. All of the fungal strains except for
Trichosporon asahii OMU239 were supplied by Teikyo
University Research Center for Medical Mycology. The fungi were
incubated and allowed to proliferate in Sabouraud dextrose broth for
72 h at 30°C, while the bacteria were incubated in Luria-Bertani
medium for 24 h at 37°C.
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
PCR Detection of DNA Specific for
Trichosporon Species in Serum of Patients with
Disseminated Trichosporonosis
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
3)-
-D-glucan (11), patients with other
mycoses also test positive in these assays (12), and
therefore the specificity of these tests is not satisfactory. PCR has
also been used for the diagnosis of deep-seated mycosis, and several
attempts have been made to detect fungal DNA from blood samples
(2, 5, 7, 23, 24). However, to our knowledge, there are no
reports on the use of PCR for direct detection of DNA specific for
Trichosporon species in serum samples.
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and methods
Results
Discussion
References
TABLE 1.
Specificity of PCR for the fungal and bacterial strains
used in this study
Extraction of DNA from cultured strains.
Extraction of DNA
from fungi was performed according to the method described by Yamakami
et al. (23). Briefly, 50 ml of Sabouraud glucose broth in a
flask was inoculated with conidia and incubated for 72 h at
30°C. The mycelial mat was transferred into a 50-ml polypropylene
screw-cap tube containing six glass beads (4 mm in diameter). The tube
was then immersed in liquid nitrogen for 10 s and vortexed
vigorously for 20 s. In the next step, 2 ml of DNA extraction
buffer (10 mM Tris-HCl [pH 8.0], 10 mM EDTA, 0.15 M NaCl, 2% sodium
dodecyl sulfate, and 0.5 mg of proteinase K per ml [Sigma Chemical
Co., St. Louis, Mo.]) was added, and the mixture was allowed to thaw.
The mixture was then incubated for 2 h at 55°C, followed by
inactivation of proteinase K by heating it to 95°C for 10 min. A
volume of 0.7 ml of the mixture was transferred to a 1.5-ml
microcentrifuge tube, and an equal volume of phenol-chloroform (1:1)
was added, followed by centrifugation at 10,000 × g
for 5 min at 4°C (MRX-150; Tomy Seiko Co., Tokyo, Japan). The
supernatant was transferred to a fresh tube, and the same procedure was
repeated with chloroform-isoamyl alcohol (24:1). The DNA was
precipitated with 2 volumes of ethanol at
20°C and centrifuged at
12,000 × g for 20 min at 4°C, and the pellet was
allowed to dry. After being rinsed with 70% ethanol at 4°C, the
pellet remained intact, and the sample was air dried. The extracted DNA
was then suspended in 50 µl of distilled water, and 5 µl of the
suspension was used for PCR. Extraction of DNA from bacteria was
performed according to the method described by Sambrook et al.
(16), using lysis by alkali and sodium dodecyl sulfate.
Clinical samples and DNA extraction. The protocol was approved by the Humans Ethics Review Committee of our University, and signed consent was obtained from each subject. Clinical samples were obtained from 20 healthy subjects and 11 patients with disseminated trichosporonosis diagnosed by an immunohistochemical technique described by Tashiro et al. (19). All histological diagnoses were established by autopsy. To isolate Trichosporon species, the blood asamples were cultured on Sabouraud glucose broth at 30 and 37°C for 7 days. Trichosporon species were identified by their morphological and biochemical characteristics (19).
The GXM antigen assay and PCR were performed in a retrospective fashion. Blood samples for these assays were centrifuged at 2,500 × g for 10 min, and the sera were stored at
20°C until use. Extraction of DNA from the serum was performed according to the
method described by Tokimatsu et al. (20). In the first step, a serum sample of 100 µl was combined with the same volume of a
lysis buffer containing 100 mM KCl, 20 mM Tris-HCl (pH 8.3), 5 mM
MgCl2, 0.2 mg of gelatin per ml, and 0.9% polysorbate 20 (Tween 20) solution. Proteinase K was added to a final concentration of
60 µg/ml. The mixture was incubated for 60 min at 55°C. Proteinase K was then inactivated by heating of the mixture to 95°C for 10 min.
The supernatant was used for PCR amplification following centrifugation
at 12,000 × g for 10 min at 4°C.
Oligonucleotide primers and PCR. The design of oligonucleotides used in the present study was based on a comparison of the sequences of 26S rRNA genes (rDNA) of Trichosporon species and other fungi available in the GenBank database. Nested PCR was performed with two sets of primers. The outer primer set consisted of TB26-1 (5'AAAGATGAAAAGCACTTTGG3') and TB26-2 (5'AAGCCATTATGTCAACATCC3'), amplifying a 287-bp sequence. The inner primer set consisted of TB26-9 (5'AGCACTTTGGAAAGAGAG3') and TB26-10 (5'CCTAAGCTCGAACGTGCC3'), amplifying a 259-bp sequence. The reaction mixtures used in the present series of experiments consisted of 50 mM KCl, 10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2, 0.1% oxtoxynol (Triton X-100), 160 mM (each) deoxynucleoside triphosphates (dATP, dCTP, dTTP, and dGTP), and 1 U of Thermus aquaticus (Taq) DNA polymerase (Takara Taq; Takara Shuzo Co., Otsu, Japan). In a single PCR step, 50 pmol of each outer primer was combined with 5 µl of the prepared sample to a final volume of 50 µl. The tube was covered with mineral oil to prevent evaporation, and PCR was conducted in an automatic thermal cycler (program temperature control system PC-700; Astec, Co., Fukuoka, Japan). The amplification reactions were run for 30 cycles of DNA denaturation at 94°C for 1 min, primer annealing at 55°C for 2 min, and DNA extension at 72°C for 2 min. The final cycle of DNA extension was carried out at 72°C for 10 min. In the nested-PCR step, 1 µl of the first amplification product was added to a new reaction mixture with 50 pmol of each inner primer and reamplified with 30 cycles as described above, except for the primer annealing step. This step was carried out at 63°C for 2 min. To avoid possible contamination of PCR mixtures, all reactions were performed under stringent conditions, as recommended by Kwok and Higuchi (8). Three negative controls, including control reagents and sera from healthy subjects, were run along with the test samples for all reactions. The nested-PCR products were electrophoresed on a 2% agarose gel containing ethidium bromide, and the results were photographed.
Southern blot hybridization. Gel-fractionated nested-PCR products were transferred onto nylon membranes (Hybond N+; Amersham International, Buckinghamshire, United Kingdom) and then hybridized with a DNA probe specific for T. asahii, TA-p (5'TAGTAGGAATGTGACTTCTCCGGAA3'), or specific for T. mucoides, TM-p (5'ATAGTAGGAATGTAGCTCCCCCGGG3'), labeled with an enhanced chemiluminescence detection system (ECL 3'-oligolabeling and detection system; Amersham). The membranes were washed according to the instructions provided by the manufacturer and exposed to X-ray films for 60 min.
Glucuronoxylomannan antigen assay. Circulating GXM antigen was detected by a latex agglutination test, the Serodirect "Eiken" Cryptococcus test (Eiken Kagaku Co., Tokyo, Japan). Assays were performed according to the instructions provided by the manufacturer. Briefly, the serum sample was incubated at 56°C with a serum treatment solution for 30 min. After being heated at 95°C for 5 min, the mixture was tested with latex beads.
| |
RESULTS |
|---|
|
|
|---|
Specificity of nested PCR for Trichosporon species. DNA samples from the organisms tested were examined to see whether the primer amplified the same DNA products. Using a single PCR with outer primers, a specific 287-bp fragment was amplified from all Trichosporon tested species (T. asahii, T. mucoides, and T. montevideense) and other basidiomycetous fungi tested but not from other microorganisms. In nested PCR with inner primers, a specific 259-bp fragment was amplified from T. asahii and T. mucoides, but not from other microorganisms, including other basidiomycetous fungi tested (T. montevideense, Cryptococcus neoformans, and so on) (Table 1 and Fig. 1).
|
Sensitivity of nested PCR for Trichosporon species. We used a T. asahii DNA, extracted as described above, to evaluate the sensitivity of nested PCR. Serial 10-fold dilutions of the gene were prepared, and each dilution was then subjected to amplification by PCR. Five hundred femtograms of target DNA was detected by a single PCR, whereas as little as 5 fg was detected by the nested PCR, indicating that the sensitivity of nested PCR was 100 times higher than that of the single PCR. The method involving nested PCR with a gel detection system was as sensitive as the following hybridization method (Fig. 2).
|
Southern blot hybridization for Trichosporon species. As shown in Fig. 3, we were able to differentiate between T. asahii and T. mucoides by Southern blot hybridization performed after the nested PCR by using DNA probes specific for each of these two species.
|
Detection of DNA specific for Trichosporon species in
clinical samples.
A summary of the results of blood culture, GXM
antigen assays, and nested PCR using serum samples of patients with a
histological diagnosis of disseminated trichosporonosis is shown
in Table 2. The detection sensitivity
levels of these three assays were as follows: 72% (8 of 11) for blood
cultures, 54% (6 of 11) for the GXM antigen assay, and 64% (7 of 11)
for nested PCR. All isolates of Trichosporon species were
further identified as T. asahii var. asahii by
the technique based on the DNA-DNA homology of Trichosporon species. The results of a Southern blot hybridization that was performed after nested PCR also showed that all seven PCR-positive patients had T. asahii infection (data not shown). All
samples from healthy subjects were negative in these three assays. The results of nested PCR became available a few days to a few weeks earlier than those of blood cultures for five subjects (data not shown).
|
-globin DNA) by nested PCR according to the
methods described by Saiki et al. (15), and these samples
were positive for
-globin DNA. On the basis of these results, it was
considered that there were no PCR inhibitors in these samples (data not shown).
| |
DISCUSSION |
|---|
|
|
|---|
Deep-seated trichosporonosis is a lethal opportunistic infection
associated with morbid severe conditions in immunocompromised patients,
disseminating to various organs, such as the lungs, kidneys, digestive
tract, adrenal gland, and central nervous system (19). Even
though disseminated trichosporonosis is resistant to antifungal agents
such as amphotericin B (21), combination therapy consisting
of a recombinant human G-CSF and an azole antifungal agent (in
particular, fluconazole) may be effective (14). However, due
to the lack of rapid and reliable methods for early diagnosis of
disseminated trichosporonosis, it has been difficult to institute therapy at the early stages of the disease. Disseminated
trichosporonosis was previously diagnosed by mycological,
histopathological, or serodiagnostic tests. However, since
Trichosporon species colonize and proliferate in the oral
cavity, digestive tract, or urinary tract or on the skin, detection of
Trichosporon species in the sputum, feces, and urine is
unreliable. Nonetheless, when a Trichosporon species is
detected in an abscess or aseptic specimens, such as blood, spinal
fluid, or pleural effusion, the detection of such fungi is clinically
significant. However, a long period of time is needed before the
results of the diagnostic tests mentioned above become available.
Because of these delays in diagnosis, trichosporonosis is sometimes
diagnosed after the patient has died. Even though trichosporonosis can
be diagnosed by an immunohistological assay using monoclonal
antibodies, invasive examinations such as biopsy cannot often be
performed in patients with severe underlying diseases. Furthermore,
serological diagnosis also has certain disadvantages. For example,
Trichosporon species and C. neoformans are known
to share common antigens. While a latex agglutination test is used for
the diagnosis of cryptococcosis, patients with deep-seated
trichosporonosis are also found positive by this test (9,
10). Consequently, trichosporonosis and cryptococcosis cannot be
distinguished by this assay. Furthermore,
(1
3)-
-D-glucan, a common component of the cell wall
of fungi, can be detected in patients with disseminated
trichosporonosis (11), but since this compound can be
detected in patients with almost all deep-seated mycotic diseases,
except for mucormycosis (12), assays for the detection of
(1
3)-
-D-glucan lack specificity for trichosporonosis. Trichosporon cutaneum was reported as the causative agent of
disseminated trichosporonosis, but due to the molecular evolution
classification system, based on DNA-DNA homology, introduced by Gueho
et al. in 1992, T. cutaneum was reclassified into 20 species
(4). In the past, serum types I and II were classified as
the causative agents of deep-seated mycosis, but after the new
classification, they were identified as T. mucoides and
T. asahii, respectively (17). The new primers
developed in the present study were capable of specifically detecting
these two species of Trichosporon. Therefore, unlike the GXM
antigen assay, the nested-PCR assay distinguished between clinically
important Trichosporon species and other basidiomycetous fungi, including T. montevideense (serum type III, which is
not a usual causative agent of deep-seated mycosis).
Furthermore, the two DNA probes (TA-p and TM-p) used in the present study distinguished T. asahii from T. mucoides. Trichosporon species are resistant to certain antifungal agents, such as amphotericin B (21). However, Anaissie et al. reported that the activity of amphotericin B varied, with some strains exhibiting a good in vivo response and others showing resistance to this agent, suggesting this heterogeneity is based on differences among species of Trichosporon (1). Therefore, implementation of molecular techniques used in previous studies (4, 17) and the present investigation would be also helpful for the development of new antifungal agents against certain species of Trichosporon.
Our results with clinical samples from 11 patients with histologically diagnosed disseminated trichosporonosis showed that 7 patients (64%) were positive for nested PCR. In two patients who had positive blood cultures but who were negative for nested PCR (patients 6 and 7), T. asahii was first detected by a blood culture that was conducted just before death, while serum samples for PCR assays were collected 4 or 16 days before the blood culture. Therefore, the time difference in sample collection might have played an important role in the false-negative test. In patients 9 and 11, blood culture, GXM antigen assay, and nested PCR were all negative. It is possible that these results may be due to the presence of only a small number of causative fungi below the threshold level of these assays. This assumption is based on the fact that these two patients were treated with a drip infusion of amphotericin B or fluconazole for more than 10 days before samples were obtained for these diagnostic tests.
The new nested-PCR assay was performed on more than one occasion with samples from eight patients, and the assay detected the causative fungi a few days to a few weeks earlier than blood culture in five patients (data not shown). Therefore, our nested-PCR assay is useful for the early diagnosis of disseminated trichosporonosis.
In a clinical situation, Trichosporon species were also recognized to be the causative agents of summer-type hypersensitivity pneumonia and white piedra. In addition, these fungi are considered to colonize at the catheter sites. We had a chance to test samples from two patients with summer-type hypersensitivity pneumonia. These samples were negative for Trichosporon DNA by nested PCR (data not shown). Because the Trichosporon organisms usually cannot be isolated from the blood of patients with summer-type hypersensitivity pneumonia, the organisms are not considered to exist in such patients' blood. Therefore, the sera from these patients should be negative for Trichosporon DNA. In this study, we could not test the samples from patients with white piedra and catheter site colonization, because we did not have serum from such patients. Recently, Walsh et al. reported cases of development of disseminated aspergillosis from primary cutaneous aspergillosis (22). There is a possibility that white piedra also advances to disseminated trichosporonosis, so we think that, in patients with white piedra, the PCR might be positive. On the other hand, we consider that PCR should be positive with sera from patients with venous catheter site colonization because of the existence of the components, including DNA, of Trichosporon in the blood vessels. Therefore, the PCR method might be positive with the serum of some patients with nondisseminated trichosporonosis. However, we believe that the results of the nested PCR should provide very helpful information for diagnosing disseminated trichosporonosis when the other clinical data are combined.
In conclusion, we have described the development of a novel PCR assay for the detection of clinically important species of Trichosporon in serum samples from patients with disseminated trichosporonosis. Detection of DNA specific for Trichosporon species with this method requires only a serum sample and can be repeated several times during the course of the disease. Further studies are necessary to prospectively evaluate our new PCR with a large clinical population sample.
| |
ACKNOWLEDGMENTS |
|---|
We thank Takako Shinoda, Department of Microbiology, Meiji College of Pharmacy, for performing identification of Trichosporon species by a technique based on DNA-DNA homology. We also thank Kiyoko Arita, Second Department of Internal Medicine, Oita Medical University, for preparing fungal strains and F. G. Issa, Department of Medicine, University of Sydney, for assistance with reading and editing the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: The Second Department of Internal Medicine, Oita Medical University, Hasama-machi, Oita 879-5593, Japan. Phone: 81 (97) 586-5804. Fax: 81 (97) 549-4245.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Anaissie, E. J.,
R. Hachem,
N. C. Karyotakis,
A. Gokaslan,
M. C. Dignani,
L. C. Stephens, and C. K. Tin-U.
1994.
Comparative efficacies of amphotericin B, triazoles, and combination of both as experimental therapy of murine trichosporonosis.
Antimicrob. Agents Chemother.
38:2541-2544 |
| 2. | Einsele, H., H. Hebart, G. Roller, J. Löffler, I. Rothenhöfer, C. A. Müller, R. A. Bowden, J.-A. van Burik, D. Engelhard, L. Kanz, and U. Schumacher. 1997. Detection and identification of fungal pathogens in blood by using molecular probes. J. Clin. Microbiol. 35:1353-1360[Abstract]. |
| 3. | Grauer, M. E., C. Bokemeyer, W. Bautsch, M. Freund, and H. Link. 1994. Successful treatment of a Trichosporon beigelii septicemia in granulocytopenic patients with amphotericin B and granulocyte colony-stimulating factor. Infection 22:238-286[Medline]. |
| 4. | Gueho, E., G. S. de Hoog, G. Billon-Grand, R. Christen, and W. H. Batenburg van der Vegte. 1992. Contributions to a revision of genus Trichosporon. Antonie Leeuwenhoek 61:289-316. |
| 5. |
Hashimoto, A.,
Y. Yamakami,
P. Kamberi,
E. Yamagata,
R. Karashima,
H. Nagaoka, and M. Nasu.
1998.
Comparison of PCR, (1 3)- -D-glucan and galactomannan assays in sera of rats with experimental invasive aspergillosis.
J. Clin. Lab. Anal.
12:257-262[Medline].
|
| 6. |
Herent, P.,
D. Stynen,
F. Hernando,
J. Fruit, and D. Poulain.
1992.
Retrospective evaluation of two latex agglutination tests for detection of circulating antigens during invasive candidosis.
J. Clin. Microbiol.
30:2158-2164 |
| 7. |
Holmes, A. R.,
R. D. Cannon,
M. G. Shepherd, and H. F. Jenkinson.
1994.
Detection of Candida albicans and other yeasts in blood by PCR.
J. Clin. Microbiol.
32:228-231 |
| 8. | Kwok, S., and R. Higuchi. 1989. Avoiding false positives with PCR. Nature (London) 339:237-238[Medline]. |
| 9. |
McManus, E. J., and J. M. Jones.
1985.
Detection of a Trichosporon beigelii antigen cross-reactive with Cryptococcus neoformans capsular polysaccharide in serum from a patient with disseminated Trichosporon infection.
J. Clin. Microbiol.
21:681-685 |
| 10. |
Melcher, G. P.,
K. D. Reed,
M. G. Rinaldi,
J. W. Lee,
P. A. Pizzo, and T. J. Walsh.
1991.
Demonstration of a cell wall antigen cross-reacting with cryptococcal polysaccharide in experimental disseminated trichosporonosis.
J. Clin. Microbiol.
29:192-196 |
| 11. |
Miyazaki, T.,
S. Kohno,
K. Mitsutake,
S. Maesaki,
K. Tanaka, and K. Hara.
1995.
(1 3)- -D-Glucan in culture fluid of fungi activates factor G. A limulus coagulation factor.
J. Clin. Lab. Anal.
9:334-339[Medline].
|
| 12. |
Miyazaki, T.,
S. Kohno,
K. Mitsutake,
S. Maesaki,
K.-I. Tanaka,
N. Ishikawa, and K. Hara.
1995.
Plasma (1 3)- -D-glucan and fungal antigenemia in patients with candidemia, aspergillosis, and cryptococcosis.
J. Clin. Microbiol.
33:3115-3118[Abstract].
|
| 13. | Patterson, T. F., P. Miniter, J. E. Patterson, J. M. Rappaport, and V. T. Andriole. 1995. Aspergillus antigen detection in the diagnosis of invasive aspergillosis. J. Infect. Dis. 171:1553-1558[Medline]. |
| 14. | Perparim, K., A. Hashimoto, and M. Nasu. 1996. Efficacy of recombinant human granulocyte-colony stimulating factor alone and in combination with anti-fungal agents against disseminated trichosporonosis in neutropenic mice. J. Infect. Chemother. 2:232-239. |
| 15. |
Saiki, R. K.,
S. Scharf,
F. Faloona,
K. B. Mullis,
G. T. Horn,
H. A. Erlich, and N. Arnheim.
1985.
Enzymatic amplification of -globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.
Science
230:1350-1354 |
| 16. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 17. | Sugita, T., A. Nishikawa, T. Shinoda, and H. Kume. 1995. Taxonomic position of deep-seated, mucosa-associated and superficial isolates of Trichosporon cutaneum from trichosporonosis patients. J. Clin. Microbiol. 33:1368-1370[Abstract]. |
| 18. |
Tanner, D. C.,
M. P. Weinstein,
B. Fedorciw,
K. L. Jono,
J. J. Thorpe, and L. B. Reller.
1994.
Comparison of commercial kits for detection of cryptococcal antigen.
J. Clin. Microbiol.
32:1680-1684 |
| 19. | Tashiro, T., H. Nagai, P. Kamberi, Y. Goto, H. Kikuchi, M. Nasu, and S. Akizuki. 1994. Disseminated Trichosporon beigelii infection in patients with malignant disease, immuno-histochemical study and review. Eur. J. Microbiol. Infect. Dis. 13:218-224. |
| 20. | Tokimatsu, I., T. Tashiro, and M. Nasu. 1995. Early diagnosis and monitoring of human cytomegalovirus pneumonia in patients with adult T-cell leukemia by DNA amplification in serum. Chest 107:1924-1927. |
| 21. |
Walsh, T. J.,
G. P. Melcher,
M. G. Rinaldi,
J. Lecciones,
D. A. McGough,
P. Kelly,
J. Lee,
D. Callender,
M. Rubin, and P. A. Pizzo.
1990.
Trichosporon beigelii, an emerging pathogen resistant to amphotericin B.
J. Clin. Microbiol.
28:1616-1622 |
| 22. |
Walsh, T. J.
1998.
Primary cutaneous aspergillosis an emerging infection among immunocompromised patients.
Clin. Infect. Dis.
27:453-457[Medline].
|
| 23. | Yamakami, Y., A. Hashimoto, I. Tokimatsu, and M. Nasu. 1996. PCR detection of DNA specific for Aspergillus species in serum of patients with invasive aspergillosis. J. Clin. Microbiol. 34:2464-2468[Abstract]. |
| 24. |
Yamakami, Y.,
A. Hashimoto,
E. Yamagata,
P. Kamberi,
R. Karashima,
H. Nagai, and M. Nasu.
1998.
Evaluation of PCR for detection of DNA specific for Aspergillus species in sera of patients with various forms of pulmonary aspergillosis.
J. Clin. Microbiol.
36:3619-3623 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»