Previous Article | Next Article 
Journal of Clinical Microbiology, April 1999, p. 1045-1048, Vol. 37, No. 4
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Helicobacter pylori Can Be Induced To
Assume the Morphology of Helicobacter heilmannii
Paul T.
Fawcett,*
Kathleen M.
Gibney, and
Kathleen
M. B.
Vinette
Immunology Laboratory, Department of Clinical
Science, duPont Hospital for Children, Wilmington, Delaware
Received 22 September 1998/Returned for modification 8 December
1998/Accepted 7 January 1999
 |
ABSTRACT |
Cultures of Helicobacter pylori obtained from the
American Type Culture Collection (strain 43504) were grown as isolated
colonies or lawns on blood agar plates and in broth culture with
constant shaking. Examination of bacterial growth with Gram-stained
fixed preparation and differential interference contrast microscopy on
wet preparations revealed that bacteria grown on blood agar plates had
a morphology consistent with that normally reported for H. pylori whereas bacteria from broth cultures had the morphologic appearance of Helicobacter heilmannii. Bacteria harvested
from blood agar plates assumed an H. heilmannii-like
morphology when transferred to broth cultures, and bacteria from broth
cultures grew with morphology typical of H. pylori when
grown on blood agar plates. Analysis by PCR of bacteria isolated from
blood agar plates and broth cultures indicated that a single strain of
bacteria (H. pylori) was responsible for both morphologies.
 |
INTRODUCTION |
The presence of spiral bacteria in
gastric mucosa was first reported over a century ago; however, it was
not until the work of Warren and Marshall in the 1980s that the role of
these bacteria in gastric disease became clear (4, 5, 12).
It is now well established that Helicobacter pylori can be
pathogenic in humans and is the cause of gastric disease in a
significant percentage of the human population. A second bacterium,
currently named Helicobacter heilmannii, has also been
implicated as a potential cause of gastric disease in humans (6,
10). Infection with H. heilmannii is thought to be
considerably less frequent than infection with H. pylori.
Standard tests for gastric infection including detection of urease
activity and antibody-based assays may not distinguish between these
bacteria due to common enzymes and cross-reactivity (2, 13).
Furthermore, there is no available routine method to culture H. heilmannii (1). Thus, differentiation between H. heilmannii and H. pylori as a cause of gastric
infection is based primarily on morphological differences between the
two organisms. Typically, H. pylori assumes a curved
rod-like or short spiral morphology with up to three turns while
H. heilmannii is reported to grow as a long spiral bacterium
with four or more turns (6, 7).
Our laboratory has been working on the development of molecularly and
serologically based assays for aid in diagnosing infection with
H. pylori. As part of these studies, we adopted a broth
culture technique to enhance our capabilities to produce and process
H. pylori for use in our assays. Stock cultures of H. pylori were obtained from the American Type Culture Collection
(ATCC) (Manassas, Va.) and grown on blood agar plates or in broth.
Routine microscopic examination of cultured organisms revealed that
growth in broth induced the H. pylori cells to grow as long
spirals (5 to >20 turns) while morphology typical of H. pylori was observed for cultures grown on blood agar. Morphology
appeared to be dependent on culture conditions, as it could be reversed
by changing the culture method. These results suggest that reliance on
morphology as the sole criterion for distinguishing between H. heilmannii and H. pylori may need to be reevaluated, as
at least some reports of H. heilmannii may represent in vivo
growth of H. pylori in its long spiral form.
 |
MATERIALS AND METHODS |
Broth culture.
Lyophilized H. pylori ATCC 43504 was reconstituted with 0.3 ml of brucella broth (Difco, Detroit, Mich.)
with 1% cyclodextrin (BBCD) (8). This inoculum was added to
25 ml of BBCD in a 25-cm2 tissue culture flask and
incubated at 37°C with rocking under microaerobic conditions with BBL
Campy Pack Plus system (Becton Dickinson, Cockeysville, Md.). After 4 days, 8 ml of the culture was transferred to 100 ml of BBCD in a 150-ml
filter unit receiver flask (Nalgene, Rochester, N.Y.) and incubated as
described above. After 4 days, the bacteria were harvested by
centrifugation at 10,000 × g for 10 min at 4°C. The
pellet was resuspended in phosphate-buffered saline (PBS) with 5 mM
MgCl2, centrifuged, and resuspended for a total of five
washes. The protein concentration of the final suspension was
determined with a Bradford microassay (Bio-Rad, Richmond, Calif.).
Plate culture.
The ATCC stock culture was reconstituted,
transferred to the initial 25-ml broth culture, and incubated as
described above. After 4 days, 20 plates of Trypticase soy agar with
5% sheep blood (Becton Dickinson) were each inoculated with 6 drops of
broth culture. The plates were incubated inverted in a GasPak
CO2 jar system (Becton Dickinson). After 7 days, the
bacteria were harvested by scraping the colonies from the agar,
suspending them in PBS with 5 mM MgCl2, washing them five
times, and determining the protein concentration as described above.
Microscopy.
Wet preparations and Gram-stained (Becton
Dickinson) smears were prepared for all cultures at times of transfer
and harvest. These were examined with a Zeiss Axioplan photomicroscope
with 63× and 100× objectives under bright-field, phase-contrast, and differential interference contrast settings.
Western blot.
Harvested bacteria from broth and plate
cultures were diluted to a concentration of 4.0 mg/ml in sample buffer
containing 0.1 M dithiothreitol as the reducing agent. The samples were
electrophoresed on 11% polyacrylamide gels by a modification of the
Laemmli method (3) with an LKB Multiphore II electrophoresis
unit (Pharmacia Biotech, Piscataway, N.J.). Separated antigens were
transferred to a nitrocellulose membrane (Schleicher & Schuell, Keene,
N.H.) with a Nova blot semidry transfer system (Pharmacia Biotech). Membranes were blocked with 0.5% bovine serum albumin in PBS, cut into
strips, dried, and stored desiccated until needed. Strips were
incubated with polyclonal rabbit or human anti-H. pylori sera diluted 1:1,000 in PBS with 1% nonfat dry milk for 1 h at room temperature. Test strips were washed three times with PBS and then
incubated with a 1:1,000 dilution of biotinylated goat anti-rabbit
immunoglobulin G (heavy plus light chains) (Kirkegaard & Perry
Laboratories, Gaithersburg, Md.). Strips were washed as described above
and then incubated with a 1:1,000 dilution of peroxidase-conjugated
streptavidin for 1 h at room temperature. Strips were washed again
and incubated with 4-chloro-1-naphthol substrate (7.8 mM
4-chloro-1-naphthol diluted 1:2 with 1:1,500 30%
H2O2 in citrate phosphate buffer, pH 4.0).
Strips were washed with distilled water, air dried, and evaluated for
banding patterns.
PCR analysis.
PCR was carried out in a Perkin-Elmer 9600 thermocycler (Foster City, Calif.) with 10 ng of H. pylori
genomic DNA per 100-µl reaction mixture unless otherwise noted. All
oligonucleotides used were purchased from Integrated DNA Technologies
(Coralville, Iowa).
Oligonucleotides HpF1 (5' GATAAGTTGATGCTCCACTACGCTG 3') and
HpB25 (5' CTCAATAGGGGTATGCACGGTTAC 3') were used to amplify
a 279-nucleotide (nt) product of the H. pylori urease
A-encoding gene. Oligonucleotides HpF2 (5'
AAGCAGTAGCTTTGATTAGTGCCC 3') and HpB5 (5'
CGCCATCCATCACATCATCTG 3') are internal to HpF1 and HpB25 in the
H. pylori urease A-encoding gene and were used in a
secondary reaction to amplify a 120-nt product from the 279-nt primary
amplification product.
A 212-nt product of the urease A-encoding gene (in a region not covered
by the HpF1-HpB25 and HpF2-HpB5 primer pairs) was
amplified with
oligonucleotides HpF34 (5' GTTCAAATCGGCTCACACTTCC
3') and
HpB36 (5' TCGTTGTCTGCTTGTCTATCAACC 3'). Oligonucleotides
Hpcag1 (5' TTTCAAATACACCAACGCCTCC 3') and HpcagB3 (5'
CCAACCAATTCTTTGTTGCTGC
3') were used to amplify a 243-nt product
of the
H. pylori cytotoxin-associated
gene
(
cagA). Following amplification, 20-µl samples of each
reaction
mixture were mixed with 5 µl of gel loading buffer (Sigma
Biochemical,
St. Louis, Mo.) and run in 3.75% Nusieve 3:1 agarose (FMC
Bioproducts,
Rockland, Maine)
gels.
Urease gene fingerprinting.
A 2.4-kb fragment encompassing
the H. pylori urease A- and urease B-encoding genes was
amplified with oligonucleotides designated HpR1 (5'
AGGAGAATGAGATGA 3') and HpR2 (5' ACTTTATTGGCTGGT 3'). Each reaction mixture contained 20 µg of H. pylori
genomic DNA, and each was run in the thermocycler as described above.
Reaction mixtures were analyzed on 0.7% SeaKem GTG agarose (FMC
Bioproducts) gels to verify successful amplification of the
expected
2.4-kb product. Amplified products were ethanol precipitated
and
resuspended in 20 µl of Tris-EDTA buffer. The DNA was digested
with
10 to 20 U of restriction enzyme
HaeIII (Promega, Madison,
Wis.) in the appropriate buffer for 4 h at 37°C. Samples were
electrophoresed on 3.75% Nusieve 3:1 agarose gels to compare
restriction
patterns.
Genomic DNA fingerprinting.
Three micrograms of purified
genomic DNA from broth- or plate-grown bacteria was digested separately
with 10 to 20 U of restriction endonucleases HaeIII,
HindIII, and DraI (Promega). Reaction
mixtures were incubated at 37°C for 4 h. Five microliters of gel
loading buffer was added to each 20-µl reaction mixture. Samples were run on a 0.8% SeaKem GTG agarose gel in order to compare restriction patterns.
 |
RESULTS |
Examination of Gram-stained smears and wet preparations from blood
agar- and broth-grown cultures revealed that growth on agar resulted in
a bacterial morphology consistent with H. pylori (Fig.
1A) while bacteria grown in broth assumed
a morphology consistent with that reported for H. heilmannii
(Fig. 1B). Individual colonies from blood agar plates used to inoculate
broth resulted in cultures containing long spiral forms resembling
H. heilmannii. By the second or third passage in broth
cultures, microscopic examination revealed only long spiral and
degenerate coccoid forms. When broth cultures (third or higher passage)
were used to streak blood agar plates, all resultant colonies examined
showed bacteria with a morphology typical of H. pylori. The
use of individual colonies from blood agar plates to start new agar
plates and broth cultures was repeated four times. In each instance,
resultant growth was typical of H. pylori when blood agar
plate colonies were tested and typical of H. heilmannii when
broth cultures were tested.

View larger version (92K):
[in this window]
[in a new window]
|
FIG. 1.
Photomicrographs show the morphologic differences which
occur as a result of growing H. pylori (ATCC 43504) on blood
agar plates (A) or in broth (B). Bacteria harvested from the
appropriate culture source were prepared as wet preparations and
photographed with a 63× objective with differential interference
contrast optics.
|
|
Protein profiles from polyacrylamide gel electrophoresis gels for blood
agar- and broth-grown bacteria did not reveal any readily discernible
differences. Western blot results (Fig.
2A) indicate that there are no or only
minor differences in production or expression of immunodominant
proteins associated with shifts in morphology.

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Western blots prepared from broth-cultured bacteria
(left) and blood agar-grown bacteria (right) were reacted with
polyclonal rabbit anti-H. pylori sera. No major differences
in antigen profile were observed. The high-molecular-weight band
present on the blot strip on the right is detected in approximately
50% of blots made from blood agar-grown bacteria. The reason for the
variability in expression and/or detection is not known. (B) PCR
analysis of H. pylori genomic DNA. Lanes 1 to 12 are PCRs
with DNA from H. pylori grown on agar plates (lanes 1, 2, 7, and 10), DNA from H. pylori grown in broth (lanes 3, 4, 8, and 11), and water negative controls (lanes 5, 6, 9, and 12). Lane 13 shows DNA molecular mass marker set V (Boehringer Mannheim,
Indianapolis, Ind.), size range, 587 to 89 bp. Lanes 14 (plate-grown
H. pylori), 15 (broth-grown H. pylori), and 16 (negative control) show restriction patterns resulting from
HaeIII digestion of the 2.4-kb PCR product obtained from
amplification of genomic DNA with primers HpR1 and HpR2. Primer pairs
used for amplification are HpF1-HpB25 (lanes 1, 3, and 5), HpF2-HpB5
(lanes 2, 4, and 6), HpF34-HpB36 (lanes 7 to 9), and HpcagF1-HpcagB3
(lanes 10 to 12).
|
|
Molecular analysis for the urease and cytotoxin-associated genes by PCR
and nested PCR and genomic and urease gene fingerprinting revealed no
differences between blood agar-grown and broth-grown cultures. Results
of PCR and urease gene fingerprinting are shown in Fig. 2B.
 |
DISCUSSION |
Bacteria belonging to the Helicobacter genus have been
detected in the gastrointestinal tracts of humans and a wide variety of
other mammalian species. The presence of these bacteria in the gastric
mucosa is associated with gastritis and other, more serious, gastric
diseases. Morphologically, members of this genus appear quite diverse,
occurring in apparently nonviable coccoid forms or as rods, curved
rods, and short and long spiral forms. Many species are identified
primarily by their morphology. This is particularly true for H. heilmannii, which cannot be routinely cultured. During efforts to
scale up production of H. pylori antigen for use in
immunoassays, we noted that culturing our ATCC-derived strain in BBCD
with shaking yielded bacterial growth which resembled that reported for
H. heilmannii. The present study was performed to confirm
our observations that culture conditions were responsible for the
change in bacterial morphology. Results obtained demonstrate that
morphologic changes are associated with culture conditions and are
completely reversible. We further demonstrated that no overt changes in
production of immunologically relevant proteins are associated with
changes in morphology, and finally, we provide molecular evidence that
a single bacterial strain is present in the cultures.
The significance of our findings with relation to the genus
Helicobacter and gastrointestinal disease remains to be
determined. While growth of H. pylori as a long spiral
bacterium may be limited to the specific growth conditions used in this
study, it seems more likely that this morphology is also assumed in
vivo under some as-yet-unknown conditions. If the latter is the case,
some reported H. heilmannii infections may actually be due
to H. pylori, since, by microscopic analysis, the two
organisms appear to be indistinguishable. This could also explain some
of the conflicts between reports on H. heilmannii. Perusal
of the literature reveals that some investigators feel that H. heilmannii infection in humans represents zoonotic transmission
from cats, dogs, or possibly swine (9, 11, 13). These
conclusions are based in part on morphologic and in part on molecular
analysis. There is also a considerable variation in reported levels of
urease activity, immunologic cross-reactivity with H. pylori, and the localization of H. pylori versus
H. heilmannii (stomach epithelial surface or lumen and
gastric pits, respectively) (4, 10, 11). Based on the
findings reported in this study, it seems reasonable to speculate that
at least some reports of H. heilmannii infection are in fact
in vivo detection of H. pylori in its long spiral form,
which the organism may assume under different in vivo microenvironments.
Considerable work needs to be done before the significance of our
finding can be determined. It is necessary to evaluate multiple well-defined strains of H. pylori to learn if the ability to
assume a long spiral morphology is a common trait, and efforts must be made to isolate and culture long spiral bacteria from patient material
to determine if these can be cultured by the broth procedure reported
here and, if successful, to determine if growth on semisolid media will
result in a morphology consistent with H. pylori.
The growing literature on H. heilmannii concerning infection
rates, pathology, treatments, and diagnosis which is based almost exclusively on morphologic identification should be viewed with some
caution based on the findings reported herein. We provide clear
evidence, based on growth in vitro and molecular analysis, that
H. pylori, under appropriate conditions, can be
indistinguishable from H. heilmannii if morphology is used
as a sole criterion. We are currently performing further studies to
determine the role, if any, that long spiral forms of H. pylori play in human gastric disease.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: duPont Hospital
for Children, Department of Clinical Science, P.O. Box 269, Wilmington, DE 19899. Phone: (302) 651-6776. Fax: (302) 651-6881. E-mail: pfawcett{at}nemours.org.
 |
REFERENCES |
| 1.
|
Andersen, L. P.,
A. Norgaard,
S. Holck,
J. Blom, and L. Elsborg.
1996.
Isolation of a "Helicobacter heilmanii"-like organism from the human stomach.
Eur. J. Clin. Microbiol. Infect. Dis.
15:95-96[Medline].
|
| 2.
|
Debongnie, J. C.,
M. Donnay, and J. Mairesse.
1995.
Gastrospirillum hominis ("Helicobacter heilmanii"): a cause of gastritis, sometimes transient, better diagnosed by touch cytology?
Am. J. Gastroenterol.
90:411-416[Medline].
|
| 3.
|
Fawcett, P. T.,
K. M. Gibney,
C. D. Rose,
S. B. Dubbs, and R. A. Doughty.
1992.
Frequency and specificity of antibodies that crossreact with Borrelia burgdorferi antigens.
J. Rheumatol.
19:582-587[Medline].
|
| 4.
|
Lee, A., and J. O'Rourke.
1993.
Gastric bacteria other than Helicobacter pylori.
Gastroenterol. Clin. N. Am.
22:21-42[Medline].
|
| 5.
|
Marshall, B.
1983.
Unidentified curved bacilli on gastric epithelium in active chronic gastritis.
Lancet
i:1273-1275.
|
| 6.
|
McNulty, C. A. M.,
J. C. Dent,
A. Curry,
J. S. Uff,
G. A. Ford,
M. W. L. Gear, and S. P. Wilkinson.
1989.
New spiral bacterium in gastric mucosa.
J. Clin. Pathol.
42:585-591[Abstract/Free Full Text].
|
| 7.
|
Morris, A.,
M. R. Ali,
L. Thomsen, and B. Hollis.
1990.
Tightly spiral shaped bacteria in the human stomach: another cause of active chronic gastritis?
Gut
31:139-143[Abstract/Free Full Text].
|
| 8.
|
Olivieri, R.,
M. Bugnoli,
D. Armellini,
S. Bianciardi,
R. Rappuoli,
P. F. Bayeli,
L. Abate,
E. Esposito,
L. De Gregorio,
J. Aziz,
C. Basagni, and N. Figura.
1993.
Growth of Helicobacter pylori in media containing cyclodextrins.
J. Clin. Microbiol.
31:160-162[Abstract/Free Full Text].
|
| 9.
|
Queiroz, D. M. M.,
G. A. Rocha,
E. N. Mendes,
S. B. Moura,
A. M. R. Oliveira, and D. Miranda.
1996.
Association between Helicobacter and gastric ulcer disease of the pars esophagea in swine.
Gastroenterology
111:19-27[Medline].
|
| 10.
|
Solnick, J.,
J. O'Rourke,
A. Lee,
B. Paster,
F. Dewhirst, and L. Tompkins.
1993.
An uncultured gastric spiral organism is a newly identified Helicobacter in humans.
J. Infect. Dis.
168:379-385[Medline].
|
| 11.
|
Solnick, J. V.,
J. O'Rourke,
A. Lee, and L. S. Tompkins.
1994.
Molecular analysis of urease genes from a newly identified uncultured species of Helicobacter.
Infect. Immun.
62:1631-1638[Abstract/Free Full Text].
|
| 12.
|
Warren, J. R.
1983.
Unidentified curved bacilli on gastric epithelium in active chronic gastritis.
Lancet
i:1273.
|
| 13.
|
Yeomans, N. D., and S. D. Kolt.
1996.
Helicobacter heilmannii (formerly Gastrospirillum): association with pig and human gastric pathology.
Gastroenterology
111:244-247[Medline].
|
Journal of Clinical Microbiology, April 1999, p. 1045-1048, Vol. 37, No. 4
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Young, K. D.
(2006). The Selective Value of Bacterial Shape. Microbiol. Mol. Biol. Rev.
70: 660-703
[Abstract]
[Full Text]
-
Van den Bulck, K., Decostere, A., Baele, M., Driessen, A., Debongnie, J.-C., Burette, A., Stolte, M., Ducatelle, R., Haesebrouck, F.
(2005). Identification of Non-Helicobacter pylori Spiral Organisms in Gastric Samples from Humans, Dogs, and Cats. J. Clin. Microbiol.
43: 2256-2260
[Abstract]
[Full Text]
-
Terio, K. A., Munson, L., Marker, L., Aldridge, B. M., Solnick, J. V.
(2005). Comparison of Helicobacter spp. in Cheetahs (Acinonyx jubatus) with and without Gastritis. J. Clin. Microbiol.
43: 229-234
[Abstract]
[Full Text]
-
Priestnall, S. L., Wiinberg, B., Spohr, A., Neuhaus, B., Kuffer, M., Wiedmann, M., Simpson, K. W.
(2004). Evaluation of "Helicobacter heilmannii" Subtypes in the Gastric Mucosas of Cats and Dogs. J. Clin. Microbiol.
42: 2144-2151
[Abstract]
[Full Text]
-
Toyokawa, T., Yokota, K., Mizuno, M., Fujinami, Y., Takenaka, R., Okada, H., Hayashi, S., Hirai, Y., Oguma, K., Shiratori, Y.
(2004). Characterization of elongated Helicobacter pylori isolated from a patient with gastric-mucosa-associated lymphoid-tissue lymphoma. J Med Microbiol
53: 207-212
[Abstract]
[Full Text]
-
Solnick, J. V., Schauer, D. B.
(2001). Emergence of Diverse Helicobacter Species in the Pathogenesis of Gastric and Enterohepatic Diseases. Clin. Microbiol. Rev.
14: 59-97
[Abstract]
[Full Text]