Previous Article | Next Article 
Journal of Clinical Microbiology, April 1999, p. 925-930, Vol. 37, No. 4
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Serum Is More Suitable than Whole Blood for
Diagnosis of Systemic Candidiasis by Nested PCR
M.-E.
Bougnoux,1,*
C.
Dupont,1,2
J.
Mateo,3
P.
Saulnier,4
V.
Faivre,3
D.
Payen,3 and
M.-H.
Nicolas-Chanoine1
Departments of
Microbiology1 and Internal
Medicine,2 Hôpital Ambroise-Paré,
Université Paris V, 92100 Boulogne-Billancourt, Department of
Anesthesiology and Intensive Care, Hôpital
Lariboisière, Université Paris VII, 75010 Paris,3 and Department of
Microbiology, Institut Gustave Roussy, 94805 Villejuif,4 France
Received 3 November 1998/Returned for modification 7 December
1998/Accepted 13 January 1999
 |
ABSTRACT |
PCR assays for the diagnosis of systemic candidiasis can be
performed either on serum or on whole blood, but results obtained with
the two kinds of samples have never been formally compared. Thus we
designed a nested PCR assay in which five specific inner pairs of
primers were used to amplify specific targets on the rRNA genes of
Candida albicans, C. tropicalis,
C. parapsilosis, C. krusei, and
C. glabrata. In vitro, the lower limit of
detection of each nested PCR assay was 1 fg of purified DNA from
the corresponding Candida species. In rabbits with
candidemia of 120 minutes' duration following intravenous (i.v.)
injection of 108 CFU of C. albicans, the
sensitivities of the PCR in serum and whole blood were not
significantly different (93 versus 86%). In other rabbits, injected
with only 105 CFU of C. albicans,
detection of candidemia by culture was possible for only 1 min, whereas
DNA could be detected by PCR in whole blood and in serum for 15 and 150 min, respectively. PCR was more often positive in serum than in whole
blood in 40 culture-negative samples (27 versus 7%; P < 0.05%). Lastly, experiments with rabbits injected i.v. with 20 or
200 µg of purified C. albicans DNA showed that PCRs
were positive in serum from 30 to at least 120 min after injection,
suggesting that the clearance of free DNA is slow. These results
suggest that serum is the sample of choice, which should be used
preferentially over whole blood for the diagnosis of systemic
candidiasis by PCR.
| |
INTRODUCTION |
Systemic candidiasis is a
major nosocomial infection in patients given immunosuppressive
chemotherapy for cancer treatment or organ transplantation and in
patients undergoing heart or abdominal surgery (18).
Patients with candidemia have a poorer prognosis than those with
nosocomial bacteremia (19, 25). Mortality rates among those
with systemic candidiasis remain high, ranging from 50 to 80%, despite
adequate treatment (11, 26). In the absence of pathognomonic
signs or symptoms of systemic candidiasis, diagnosis is usually based
on the isolation of Candida species from blood cultures or
tissue biopsy specimens. However, since the sensitivity of blood
cultures for diagnosis of systemic candidiasis is low at the early
stage of the infection, and since it has been shown that the prognosis
is better when treatment is started early, it is usually recommended
that antifungal therapy be started as soon as a strong suspicion of
systemic candidiasis exists (9, 16, 20). On the other hand,
such empiric antifungal therapy may be unnecessarily toxic and costly,
and it may increase the selective pressure towards more-resistant
Candida species (29). Thus, efforts have been
made to develop more-sensitive methods for the earliest possible
diagnosis of systemic candidiasis. One of these involves the PCR method
in which different targets of Candida DNA have been tested:
either single-copy genes such as the actin (15), chitin
synthase (14), HSP 90 (7), and lanosterol-14 
-demethylase-encoding genes (3, 4) or multicopy genes
such as the gene coding for rRNA (12, 13, 22, 23).
Hybridization (8, 12, 22, 23) and nested PCR (4,
6) experiments have been used to identify all the amplimers at
the Candida species level. The best of these assays are
those which can identify all the species most commonly involved in
candidemia: Candida albicans, C. tropicalis,
C. krusei, C. parapsilosis, and
C. glabrata (8, 12-14, 22).
It has been demonstrated that PCR can be performed either on
whole-blood samples (3, 4, 10) or on serum samples (5, 6, 15). However, the efficiencies of the same PCR assay applied simultaneously to serum or whole blood have never been formally compared. These might not be equivalent, since the DNAs present in the
two types of samples are probably different in origin. Indeed, only
free template DNA should be detectable in serum samples, since fungal
cells are eliminated by centrifugation without having been lysed to
release intracellular DNA (6). By contrast, when whole-blood
samples are used, both free DNA and intracellular DNA could be present
when the sample is drawn from the patient. However, because of the
presence in blood of PCR inhibitors, such as hemoglobin, a
decontamination step, including lysis of blood cells and washing, is
performed first. These steps probably eliminate free Candida
DNA, leaving intracellular Candida DNA as the sole possible
target for the PCR assay (3, 4, 8, 23). Thus, depending on
the sample used, the origin of the detected DNA probably varies. This
may result in a difference in the sensitivity of the assay and in its
clinical significance. To our knowledge these issues have not been
fully investigated. This is why, in the present study, our efforts have
been focused on that question. We have used a rabbit model of
experimental candidemia specifically developed in this laboratory. We
used DNA coding for the 5.8S rRNA and the adjacent internal transcribed
spacer (ITS) as the target for amplification, and we have compared the
positivities of the PCR on whole-blood and serum specimens, using blood
cultures as the reference assay.
(Part of this work was presented at the 37th Interscience Conference on
Antimicrobial Agents and Chemotherapy, Toronto, Ontario, Canada, 28 September to 1 October 1997 [2a]).
| |
MATERIALS AND METHODS |
Candida organisms.
C. albicans ATCC
2091 was used for both in vitro and in vivo experiments, whereas
C. tropicalis ATCC 66029, C. glabrata
ATCC 66032, C. krusei IP 208-52, C. parapsilosis IP 205-52, and clinical isolates of C. albicans (n = 18), C. tropicalis
(n = 3), C. glabrata (n = 6), C. parapsilosis (n = 3), and
C. krusei (n = 2) were used for the in vitro
experiments only.
Control DNA.
DNAs from different species, including
bacterial species (Proteus mirabilis, Enterobacter
cloacae, Escherichia coli, Staphylococcus aureus, and Mycobacterium tuberculosis), parasites
(Toxoplasma gondii), and non-Candida fungal
species (Aspergillus fumigatus, Cryptococcus
neoformans, Pneumocystis carinii, Trichophyton
rubrum, and Microsporum canis), and human DNA prepared
from amniotic fluid were used to determine the specificity of the
primers designed to amplify Candida DNAs.
Preparation of Candida cells.
Candida
cells from stationary phase cultures in yeast extract-peptone-dextrose
broth (18 h at 37°C, with shaking) were washed twice in
phosphate-buffered saline and counted in a hemocytometer. Counts were
confirmed by agar plate counts.
DNA extractions.
Candida DNA, extracted from broth
culture as previously described (21), was stored at 
80°C
until use. Purified Candida DNA was quantified by using
a GeneQuant RNA/DNA calculator (Pharmacia Biotech, Orsay, France).
DNA was extracted from whole blood as previously described
(23), with slight modifications. Briefly, 100 µl of whole
blood was mixed with 100 µl of blood cell lysis buffer (0.32 M
sucrose, 10 mM Tris-HCl [pH 7.5], 5 mM MgCl2, and 1%
Triton X-100) and centrifuged at 16,000 × g for 5 min.
The pellet was resuspended in 200 µl of lysis buffer to which 7 µl
of DNase I (10 mg/ml; Boehringer Mannheim, Meylan, France) was added,
in order to eliminate free DNA. The mixture was incubated for 1 h
at 37°C, and the DNase was then inactivated by heating for 10 min at
85°C. After centrifugation, the pellet was resuspended in 200 µl of TEG buffer (50 mM glucose, 25 mM Tris-HCl [pH 8], and 10 mM
EDTA) containing 1.5 µl of lyticase (900 U/ml; Sigma, Saint Quentin
Fallavier, France), and incubated for 1 h at 37°C. Three
microliters of pronase E (15 mg/ml; Sigma) and 10 µl of 10%
sodium dodecyl sulfate were added, and incubation was continued for
another hour at 37°C. DNA was then extracted with
phenol-chloroform-isoamyl alcohol, precipitated with 2 volumes of
ethanol, and dissolved in 40 µl of sterile water.
DNA was extracted from serum as previously described (6),
also with slight modifications. Briefly, proteinase K (Sigma) and
sodium dodecyl sulfate were added to 100 µl of serum at final concentrations of 15 µg/ml and 1%, respectively. The mixture was incubated for 1 h at 37°C and then boiled for 10 min to
inactivate proteinase K. After phenol-chloroform-isoamyl alcohol
extraction and ethanol precipitation, DNA was dissolved in 40 µl of
sterile water.
Oligonucleotide primers and PCR.
The fungus-specific
universal primers ITS1 (5'TCCGTAGGTGAACCTGCGG3') and ITS4
(5'TCCTCCGCTTATTGATATGC 3') (27) were used as
outer primers to amplify the intergenic transcribed spacer regions of
Candida species rRNAs. As indicated in Table
1, specific inner primers were designed
for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei on the
basis of the ITS1-ITS4 sequences derived from GenBank (respective
accession numbers: L47111, L47109, L47112, and L47113). For
C. glabrata, inner primers were designed from the
ITS1-ITS3 sequence (GenBank accession no. L47110). The sequences of
the specific inner primers used in the nested PCR, and the sizes of the
amplification products, are indicated in Table 1.
PCR amplification was performed in a final volume of 25 µl by using a
reaction mixture containing 50 mM KCl, 10 mM Tris-HCl
(pH 8.3), 1.5 mM
MgCl
2, 100 µM each deoxynucleoside triphosphate,
and 1.25 U of
Taq DNA polymerase (Boehringer Mannheim). For the
first
PCR, 10 pmol of each outer primer was mixed either with
5 µl of DNA
prepared from whole blood or serum or with 1 µl of
purified DNA. A
9600 thermal cycler (Perkin-Elmer, Saint Quentin-en-Yvelines,
France)
was used with the following temperature cycles: 95°C for
5 min; then
30 cycles of 20 s at 95°C, 15 s at 55°C, and 65 s
at
72°C; and a final cycle of PCR extension at 72°C for 5 min.
For the
nested PCR, 1 µl of the product obtained from the first
amplification
and 10 pmol of each inner primer was mixed in fresh
reaction mixture.
The second amplification was performed under
the conditions described
above, except for the annealing temperatures,
which were specific for
each pair of inner primers, as indicated
in Table
1. The nested PCR
products were submitted to electrophoresis
on a 1.5% agarose gel
containing ethidium bromide. Amplicon carryover
was prevented by using
aerosol-guarded pipette tips (ATGC Biotechnologie,
Noisy Le Grand,
France) and by carefully separating the DNA extraction
area from the
areas in which PCR reaction mixtures were prepared
and the
amplification and electrophoresis were performed. Appropriate
negative
controls, i.e., the DNA extraction and reaction mixture
controls, were
tested for each amplification
reaction.
To avoid false interpretation of negative PCRs in rabbit blood samples,
a positive internal control was designed. Two 39-mer
composite primers
containing M13mp18 phage sequences flanked at
their 5' ends by
C. albicans inner primers (Table
1) were synthesized
(Genset, Paris, France). PCR was performed by using these composite
primers on M13mp18 template DNA to generate an M13mp18 fragment
with a
C. albicans sequence for each 5' position. When 90 pg
of
this amplified product was added to the nested PCR reaction mixture,
a 491-bp fragment was generated in the absence of
inhibitors.
In vitro evaluation of the sensitivity and specificity of
Candida nested PCR.
To determine the detection limit
for the purified DNAs of five Candida species, each nested
PCR was performed with 1 pg and with 100, 10, 1, and 0.1 fg of purified
Candida DNA from each species tested. To check the
inter-Candida species specificity of the five nested PCRs,
each nested PCR was performed with 100 ng of Candida DNA
from the other four species. Candida species specificity was
then evaluated by applying the five nested PCRs to 100 ng of control DNA.
To determine the smallest number of
Candida cells for which
Candida DNA was detectable by nested PCR, different amounts
of
C. albicans and
C. tropicalis cells
were artificially inoculated
into human and rabbit blood samples so
that each sample contained
10
4 to 1 CFU/ml.
Rabbit model.
Fifteen male New Zealand rabbits weighing 2 to
2.5 kg were housed in individual cages and anesthetized by injection of
15 mg of sodium pentobarbital/kg of body weight into the marginal ear
vein. Tracheotomy was performed, and the lungs were mechanically ventilated. Anesthesia and muscle paralysis were maintained by intermittent intravenous injection of 12.5 mg of pentobarbital and 0.2 mg of pancuronium. Throughout the study period, rabbits received 8 ml
of 0.9% sodium chloride solution/h and 2 ml of 8.4% sodium
bicarbonate solution/h, by continuous intravenous infusion. A 14-gauge
cannula was inserted into the right carotid artery to measure mean
arterial pressure, and a jugular vein catheter was inserted under
sterile conditions for volume resuscitation and blood sampling for PCR
and cultures.
Experimental protocol.
Rabbits were injected in the marginal
ear vein either with a 1-ml bolus of 108 (five rabbits) or
105 (six rabbits) C. albicans cells or with
200 (two rabbits) or 20 (two rabbits) µg of purified C. albicans DNA. Before injection and 1, 5, 15, 30, 60, 90, 120, 150, and 180 min thereafter, blood samples were collected in both
EDTA-coated and dry tubes. One milliliter of the blood collected in the
EDTA-coated tube was cultured on Sabouraud-chloramphenicol agar plates
in order to count Candida cells. Another milliliter of the
blood collected in the EDTA-coated tube and 500 µl of the serum
obtained from the dry tube were used for independent DNA extractions
and PCR assays. All PCRs and cultures were performed in duplicate.
Sequencing of the C. albicans fragment amplified
by nested PCR.
The fragment generated by inner primers of
C. albicans from either purified DNA of C. albicans ATCC 2091 or infected rabbit sera was sequenced from both
ends with primers CAL1 and CAL3 (Genome Express, Lyon, France). These
sequences were compared to the C. albicans sequence
available from GenBank (accession no. L47111).
Statistical analysis.
The differences between PCR positivity
rates on serum and on whole blood were tested by using the chi-square
test with Yates' correction at the 5% level of significance.
| |
RESULTS |
In vitro sensitivity and specificity of Candida nested
PCR.
As indicated in Fig. 1, the
limits of purified Candida DNA detection by nested PCR
ranged from 1 to 0.1 fg, depending on the Candida species.
By inoculation of human and rabbit blood samples with either
C. albicans or C. tropicalis cells, a
PCR assay was able to detect the Candida DNA extracted
from as few as 100 CFU/ml for C. albicans and 30 CFU/ml
for C. tropicalis. There was no difference between the
results of experiments performed with human and rabbit blood (data not
shown).
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 1.
Sensitivities and specificities of DNA detection by
species-specific nested PCRs of purified DNA from C. albicans, C. tropicalis, C. krusei, C. parapsilosis, and C. glabrata with ethidium bromide staining on agarose gel
electrophoresis. Shown are nested PCR products obtained with each
species-specific inner pair of primers from different amounts of
template DNA from the corresponding Candida species (lane 1, 1 pg; lane 2, 100 fg; lane 3, 10 fg; lane 4, 1 fg; lane 5, 0.1 fg). The
size of the specific amplified fragment is indicated on the left. The
specificity of the C. albicans primers was tested on
100 ng of purified DNA from C. tropicalis (lane 6),
C. glabrata (lane 7), C. krusei (lane
8), and C. parapsilosis (lane 9). The specificity of
the C. tropicalis primers was tested on 100 ng of
purified DNA from C. albicans (lane 6), C. glabrata (lane 7), C. krusei (lane 8), and
C. parapsilosis (lane 9). The specificity of the
C. krusei primers was tested on 100 ng of purified DNA
from C. albicans (lane 6), C. tropicalis (lane 7), C. glabrata (lane 8), and
C. parapsilosis (lane 9). The specificity of the
C. parapsilosis primers was tested on 100 ng of
purified DNA from C. albicans (lane 6), C. tropicalis (lane 7), C. glabrata (lane 8), and
C. krusei (lane 9). The specificity of the
C. glabrata primers was tested on 100 ng of purified
DNA of C. albicans (lane 6), C. tropicalis (lane 7), C. krusei (lane 8), and
C. parapsilosis (lane 9). In these experiments, the
amplified products generated by the Candida universal
primers (ITS1 and ITS4) in the first reaction are sometimes visible. M,
molecular weight marker.
|
|
The observed specificities of the species-specific
Candida nested PCRs were all 100%. Indeed, the
inner primers designed for
a given
Candida species never
amplified DNA from any of the other
four
Candida species
(Fig.
1 and Table
2) or from any of the
other fungal, bacterial, or parasitic species tested. No
cross-reactivity
with human DNA was observed (Table
2).
Sensitivity of C. albicans nested PCR applied to
whole blood and serum, compared to that of quantitative blood cultures
in the rabbit model.
In the five rabbits injected with
108 CFU of C. albicans ATCC 2091, results
of quantitative blood cultures showed that 90% of the microorganisms
present in the blood 1 min after injection were cleared within 4 min. Blood cultures then remained positive, with a low concentration of
C. albicans (1 to 17 CFU/ml) during the remaining 115 min of the experiment. Nested PCRs performed on whole blood were
positive in 26 of 30 (86%) samples tested, comprising all of the
11 samples in which the counts of C. albicans were
greater than 10 CFU/ml, and 15 of the 19 samples in which the counts
were equal to or lower than 10 CFU/ml (Fig.
2). When PCR was performed on
serum, a total of 28 of 30 (93%) samples were positive. The two
negative serum samples were from the same rabbit and were drawn at 1 and 5 min after injection, when cell concentrations of
C. albicans were high (Fig. 2). Negative PCRs were not due to the presence of inhibitors in whole-blood or serum samples, since the internal positive PCR controls were always positive
(Fig. 3).
View larger version (11K):
[in this window]
[in a new window]
|
FIG. 2.
Sensitivity of quantitative blood cultures compared to
that of nested PCR performed on whole blood and on serum from five
rabbits infected with 108 CFU of C. albicans. Each rabbit is represented by a circle at each sampling
time.  , positive nested PCR in both whole blood and serum;  ,
positive nested PCR in whole blood and negative nested PCR in serum;
 , negative nested PCR in whole blood and positive nested PCR in
serum.
|
|
View larger version (64K):
[in this window]
[in a new window]
|
FIG. 3.
Coamplification of internal PCR control and rabbit blood
samples. Lanes 1, 2, 3, and 4, whole-blood samples; lanes 5 and 6, serum samples which exhibited a negative C. albicans
nested PCR; lanes 7 and 8, two whole-blood samples for which this PCR
was positive. Amplification of the internal control is indicated by the
presence of a 491-bp fragment, and amplification of C. albicans DNA in blood is indicated by the presence of a 386-bp
fragment. M, molecular weight marker.
|
|
When a smaller inoculum of 10
5 CFU of
C. albicans ATCC 2091 was injected, a candidemia of brief duration
was observed in five
rabbits and no candidemia was observed in one
rabbit at 1 min
postinjection, and the PCRs performed on whole blood
and on sera
were positive in 4 of 6 and 3 of 6 of these rabbits,
respectively
(Table
3). The blood
cultures remained negative thereafter, but
the PCRs performed on whole
blood were still positive in two rabbits
and one rabbit at 5 and 15 min
postinjection, respectively (Table
3). In addition, the PCRs
performed on sera were positive for
11 of the 35 samples drawn from 5 to 150 min postinjection but
were always negative for samples drawn 180 min after injection.
Overall, among the 40 culture-negative samples
drawn later than
1 min after injection, 3 (7%) were positive when PCR
was performed
on whole blood and 11 (27%) were positive when PCR was
performed
on serum (
P < 0.05%).
View this table:
[in this window]
[in a new window]
|
TABLE 3.
C. albicans detection from quantitative
blood cultures and from nested PCR performed on whole-blood and serum
samples of rabbits infected with 105 CFU of
C. albicans
|
|
Sequence comparison.
The sequences of the 386-bp fragments
amplified from C. albicans ATCC 2091 and from the sera
of infected rabbits were strictly homologous. They differed from the
corresponding GenBank C. albicans sequence (accession
no. L47111) only by the insertion of a G base between positions
353 and 354 (99.7% homology).
Purified Candida DNA clearance from rabbit blood using
nested PCR.
When purified C. albicans DNA was
directly injected into rabbits at a dose of 200 µg, the PCRs
were positive in serum samples from 1 to at least 120 min. They were
positive from 1 to at least 30 min when only 20 µg was injected
(Table 4).
View this table:
[in this window]
[in a new window]
|
TABLE 4.
PCR evaluation of serum clearance of different amounts of
purified C. albicans DNA injected intravenously into
four rabbits
|
|
| |
DISCUSSION |
We designed a nested Candida PCR assay in which an
amplified fragment of the Candida ITS repeated region was
used as a template for five different inner primer pairs, which were
chosen for specific amplification of the DNAs of the five species most
frequently causing human candidiasis (2, 28). The in vitro
specificity of our five PCRs was 100%. The sensitivity was similar to
that published elsewhere for PCR targeting repeated genes and using specific probe hybridization assays for species differentiation (8, 12).
For in vivo evaluation, we used an experimental model of infection in
rabbits in which candidemia was studied over a period of 120 min after
injection of a 108-CFU C. albicans bolus.
This inoculum was similar to that used in a previously described model
of experimental candidemia in rabbits (1). Because of the
large volumes of the blood samples that could be drawn from rabbits, we
could precisely compare the sensitivities of our nested PCR in whole
blood and serum. Such a strict comparison had not and probably could
not have been performed in studies of experimental candidiasis in
smaller laboratory animals (6, 15, 17). Compared to
quantitative blood cultures, the overall observed sensitivity of our
PCR assay was 86% for whole blood and 93% for serum. The PCR assay
was negative in four whole-blood and two serum samples which were
positive in culture. The sampling times at which the PCR was negative
in whole blood differed from those at which it was negative in serum,
possibly due to the different origins of the template DNA. Considering,
first, that template DNA in whole blood originated from DNA extracted
ex vivo from Candida cells circulating in the blood and,
second, that the four PCRs with false-negative results in whole blood
were performed on samples with low Candida counts (5, 4, 2, and 2 CFU/ml), negativity may reflect difficulty in extracting DNA ex
vivo by cell lysis, as reported elsewhere (23, 24). PCR was
positive in 28 of 30 serum samples for which there was no such ex vivo
cell lysis included in the protocol, suggesting that DNA could be
physiologically released in serum, which is in agreement with results
published by others (5, 6, 15). The only two negative serum
samples were from the same animal and were drawn early, at 1 and 5 min after bolus injection, suggesting that the amount of DNA
physiologically released during the first minutes after injection was
too small to be detectable by PCR.
In previously published clinical studies evaluating the sensitivity of
PCR assays in the diagnosis of candidemia, samples for PCR were drawn
at the same time as blood cultures and were frozen, and only those
yielding positive cultures were later assayed by PCR (4, 10,
15). These samples were either whole blood (4, 10) or
serum (15), but the two kinds of samples were never tested
in the same study. In one study, the sensitivity of a C. albicans- and C. glabrata-specific nested PCR
performed on whole blood was 90% (19 of 21 positive blood
cultures tested) (4). In another study, in which a
C. albicans-specific probe was used for the detection
of Candida DNA amplified from whole blood, all samples
tested were positive by PCR, but they all had Candida counts
equal to or greater than 20 CFU/ml (10). In our work the
only four false-negative PCR results on whole blood were from samples
with Candida cell counts below 10 CFU/ml. By contrast, the
93% sensitivity that we found for PCR performed on serum samples from
candidemic rabbits was higher than the 79% sensitivity reported by others using a single-copy gene (actin gene) target for a PCR assay performed on serum samples from candidemic patients
(15). We concluded from this first set of experiments in
rabbits injected with a large Candida inoculum
(108 CFU) that the PCR assay that we designed had a high
sensitivity for detection of DNA both in whole-blood samples and in
serum samples drawn during the culture-positive candidemic periods.
When we injected the rabbits with only 105 CFU of
C. albicans, blood cultures were positive only during
the 1st min following injection, but PCRs performed on whole blood and
on sera remained positive for a longer period, confirming that
PCR was more sensitive than cultures in diagnosing candidemia, as
reported both for murine (6, 15, 17, 24) and for human
(5, 6, 15) candidemia. However, we also showed that
during the culture-negative period, the PCRs performed on sera remained
positive longer than those performed on whole blood. This could be
explained by the different origins of template DNA amplified in the two
types of samples. We suggest that the positivity of whole-blood PCRs
performed on culture-negative samples was due to the presence of
noncultivable Candida cells, as previously reported
(17, 23). The positivity of PCR on serum samples long after
cultures and PCR on whole blood had become negative suggested that the
clearance of free DNA was slower than that of either cultivable or
noncultivable Candida cells. A slow clearance of free DNA
was also observed in the rabbits that we injected with purified
C. albicans DNA.
In conclusion, our results showed that serum samples should be used
preferentially over whole blood to diagnose candidemia by PCR. They
also confirmed that Candida template DNA which can be
detected by PCR during the candidemic episodes corresponds both to DNA
from intact cultivable or noncultivable Candida cells, and
to free DNA released in vivo. Whether the same will be observed in
neutropenic and postsurgery patients who are at high risk of Candida infection is now being investigated in a prospective
clinical trial.
| |
ACKNOWLEDGMENTS |
This work was supported in part by grant CRC95238 from Assistance
Publique
Hôpitaux de Paris and by a grant from the Ligue Nationale Fran
aise contre le Cancer.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Service de
Microbiologie, Hôpital Ambroise-Paré, 9, avenue du
Général de Gaulle, 92100 Boulogne-Billancourt, France.
Phone: 33 (0) 1 49 09 55 45. Fax: 33 (0) 1 49 09 59 21. E-mail:
marie-elisabeth.bougnoux{at}apr.ap-hop-paris.fr.
| |
REFERENCE |
| 1.
|
Baine, W. B.,
M. G. Koenig, and J. S. Goodman.
1974.
Clearance of Candida albicans from the bloodstream of rabbits.
Infect. Immun.
10:1420-1425[Abstract/Free Full Text].
|
| 2.
|
Barns, S. M.,
D. J. Lane,
M. L. Sogin,
C. Bibeau, and W. G. Weinsburg.
1991.
Evolutionary relationships among pathogenic Candida species and relatives.
J. Bacteriol.
173:2250-2255[Abstract/Free Full Text].
|
| 2a.
|
Bougnoux, M. E.,
C. Dupont,
J. Mateo,
P. Saulnier,
D. Payen, and M. H. Nicolas-Chanoine.
1997.
Rapid diagnosis of candidemia by DNA amplification applied to serum abstr. D-131, p. 106.
In
Abstracts of the 37th Interscience Conference on Antimicrobial Agents and Chemotherapy. American Society for Microbiology, Washington, D.C.
|
| 3.
|
Buchman, T. G.,
M. Rossier,
W. G. Merz, and P. Charache.
1990.
Detection of surgical pathogens by in vitro DNA amplifications. Part 1. Rapid identification of Candida albicans by in vitro amplification of a fungus-specific gene.
Surgery
108:338-347[Medline].
|
| 4.
|
Burgener-Kairuz, P.,
J. P. Zuber,
P. Jaunin,
T. G. Buchman,
J. Billie, and M. Rossier.
1994.
Rapid detection and identification of Candida albicans and Torulopsis (Candida) glabrata in clinical specimens by species-specific nested PCR amplification of a cytochrome P-450 lanosterol--demethylase (L1A1) gene fragment.
J. Clin. Microbiol.
32:1902-1907[Abstract/Free Full Text].
|
| 5.
|
Burnie, J. P.,
N. Golbang, and R. C. Matthews.
1997.
Semiquantitative polymerase chain reaction enzyme immunoassay for diagnosis of disseminated candidiasis.
Eur. J. Clin. Microbiol. Infect. Dis.
16:346-350[Medline].
|
| 6.
|
Chryssanthou, E.,
B. Andersson,
B. Petrini,
S. Löfdahl, and J. Tollemar.
1994.
Detection of Candida albicans DNA in serum by polymerase chain reaction.
Scand. J. Infect. Dis.
26:479-485[Medline].
|
| 7.
|
Crampin, A. C., and R. C. Matthews.
1993.
Application of the polymerase chain reaction to the diagnosis of candidosis by amplification of an HSP 90 gene fragment.
J. Med. Microbiol.
39:233-238[Abstract/Free Full Text].
|
| 8.
|
Einsele, H.,
H. Hebart,
G. Roller,
J. Löffler,
I. Rothenhofer,
C. A. Müller,
R. A. Bowden,
J.-A. van Burik,
D. Engelhard,
L. Kanz, and U. Schumacher.
1997.
Detection and identification of fungal pathogens in blood by using molecular probes.
J. Clin. Microbiol.
35:1353-1360[Abstract].
|
| 9.
|
European Organization for Research and Treatment of Cancer and International Antimicrobial Therapy Cooperative Group.
1989.
Empiric antifungal therapy in febrile granulocytopenic patients.
Am. J. Med.
86:668-672[Medline].
|
| 10.
|
Flahaut, M.,
D. Sanglard,
M. Monod,
J. Bille, and M. Rossier.
1998.
Rapid detection of Candida albicans in clinical samples by DNA amplification of common regions from C. albicans-secreted aspartic proteinase genes.
J. Clin. Microbiol.
36:395-401[Abstract/Free Full Text].
|
| 11.
|
Fraser, V. J.,
M. Jones,
J. Dunkel,
S. Storfer,
G. Medoff, and W. C. Dunagan.
1992.
Candidemia in a tertiary care hospital: epidemiology, risk factors, and predictors of mortality.
Clin. Infect. Dis.
15:414-421[Medline].
|
| 12.
|
Fujita, S. I.,
B. A. Lasker,
T. J. Lott,
E. Reiss, and C. J. Morrison.
1995.
Microtitration plate enzyme immunoassay to detect PCR-amplified DNA from Candida species in blood.
J. Clin. Microbiol.
33:962-967[Abstract].
|
| 13.
|
Haynes, K. A.,
T. J. Westerneng,
J. W. Fell, and W. Moens.
1995.
Rapid detection and identification of pathogenic fungi by polymerase chain reaction amplification of large subunit ribosomal DNA.
J. Med. Vet. Mycol.
33:319-325[Medline].
|
| 14.
|
Jordan, J. A.
1994.
PCR identification of four medically important Candida species by using a single primer pair.
J. Clin. Microbiol.
32:2962-2967[Abstract/Free Full Text].
|
| 15.
|
Kan, V. L.
1993.
Polymerase chain reaction for the diagnosis of candidemia.
J. Infect. Dis.
168:779-783[Medline].
|
| 16.
|
Karp, J. E.,
W. G. Merz, and P. Churache.
1991.
Response to empiric amphotericin B during antileukemic therapy-induced granulocytopenia.
Rev. Infect. Dis.
13:592-599[Medline].
|
| 17.
|
Makimura, K.,
S. Y. Murayama, and H. Yamaguchi.
1994.
Detection of a wide range of medically important fungi by the polymerase chain reaction.
J. Med. Microbiol.
40:358-364[Abstract/Free Full Text].
|
| 18.
|
Pfaller, M. A.
1996.
Nosocomial candidiasis: emerging species, reservoirs, and modes of transmission.
Clin. Infect. Dis.
22:S89-S94.
|
| 19.
|
Pittet, D.,
M. Monod,
P. M. Suter,
E. Frenk, and R. Auckenthaler.
1994.
Candida colonization and subsequent infections in critically ill surgical patients.
Ann. Surg.
220:751-758[Medline].
|
| 20.
|
Pizzo, P. A.
1993.
Management of fever in patients with cancer and treatment-induced neutropenia.
N. Engl. J. Med.
328:1323-1332[Free Full Text].
|
| 21.
|
Robert, F.,
F. Lebreton,
M.-E. Bougnoux,
A. Paugam,
D. Wassermann,
M. Schlotterer,
C. Tourte-Schaefer, and J. Dupouy-Camet.
1995.
Use of random amplified polymorphic DNA as a typing method for Candida albicans in epidemiological surveillance of a burn unit.
J. Clin. Microbiol.
33:2366-2371[Abstract].
|
| 22.
|
Shin, J. H.,
F. S. Notle, and C. J. Morrison.
1997.
Rapid identification of Candida species in blood cultures by a clinically useful PCR method.
J. Clin. Microbiol.
35:1454-1459[Abstract].
|
| 23.
|
van Deventer, A. J. M.,
W. H. F. Goessens,
A. van Belkum,
H. J. A. van Vliet,
E. W. M. van Etten, and H. A. Verbrugh.
1995.
Improved detection of Candida albicans by PCR in blood of neutropenic mice with systemic candidiasis.
J. Clin. Microbiol.
33:625-628[Abstract].
|
| 24.
|
van Deventer, A. J. M.,
W. H. F. Goessens,
A. van Belkum,
J. A. van Vliet,
W. M. van Etten, and H. A. Verbrugh.
1996.
PCR monitoring of response to liposomal amphotericin B treatment of systemic candidiasis in neutropenic mice.
J. Clin. Microbiol.
34:25-28[Abstract].
|
| 25.
|
Weinstein, M. P.,
M. L. Towns,
S. M. Quartey,
S. Mirrett,
L. G. Reimer,
G. Parmigiani, and L. Barth Reller.
1997.
The clinical significance of positive blood cultures in the 1990s: a prospective comprehensive evaluation of the microbiology, epidemiology, and outcome of bacteremia and fungemia in adults.
Clin. Infect. Dis.
24:584-602[Medline].
|
| 26.
|
Wey, S. B.,
M. Mori,
M. A. Pfaller,
R. F. Woolson, and R. P. Wenzel.
1988.
Hospital-acquired candidemia: the attributable mortality and excess length of stay.
Arch. Intern. Med.
148:2642-2645[Abstract/Free Full Text].
|
| 27.
|
White, T. J.,
T. D. Burns,
S. B. Lee, and J. W. Taylor.
1990.
Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322.
In
M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols. A guide to methods and applications. Academic Press, Inc., San Diego, Calif.
|
| 28.
|
Wingard, J. R.
1995.
Importance of Candida species other than C. albicans as pathogens in oncology patients.
Clin. Infect. Dis.
20:115-125[Medline].
|
| 29.
|
Wingard, J. R.
1994.
Infections due to resistant Candida species in patients with cancer who are receiving chemotherapy.
Clin. Infect. Dis.
19:S49-S53.
|
Journal of Clinical Microbiology, April 1999, p. 925-930, Vol. 37, No. 4
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Metwally, L., Fairley, D. J., Coyle, P. V., Hay, R. J., Hedderwick, S., McCloskey, B., O'Neill, H. J., Webb, C. H., McMullan, R.
(2008). Comparison of serum and whole-blood specimens for the detection of Candida DNA in critically ill, non-neutropenic patients. J Med Microbiol
57: 1269-1272
[Abstract]
[Full Text]
-
Metwally, L., Fairley, D. J., Coyle, P. V., Hay, R. J., Hedderwick, S., McCloskey, B., O'Neill, H. J., Webb, C. H., Elbaz, W., McMullan, R.
(2008). Improving molecular detection of Candida DNA in whole blood: comparison of seven fungal DNA extraction protocols using real-time PCR. J Med Microbiol
57: 296-303
[Abstract]
[Full Text]
-
Innings, A., Ullberg, M., Johansson, A., Rubin, C. J., Noreus, N., Isaksson, M., Herrmann, B.
(2007). Multiplex Real-Time PCR Targeting the RNase P RNA Gene for Detection and Identification of Candida Species in Blood. J. Clin. Microbiol.
45: 874-880
[Abstract]
[Full Text]
-
Mennink-Kersten, M. A. S. H., Ruegebrink, D., Wasei, N., Melchers, W. J. G., Verweij, P. E.
(2006). In Vitro Release by Aspergillus fumigatus of Galactofuranose Antigens, 1,3-{beta}-D-Glucan, and DNA, Surrogate Markers Used for Diagnosis of Invasive Aspergillosis.. J. Clin. Microbiol.
44: 1711-1718
[Abstract]
[Full Text]
-
Chong, P. P., Chieng, D. C.-S., Low, L. Y., Hafeez, A., Shamsudin, M. N., Seow, H. F., Ng, K. P.
(2006). Recurrent candidaemia in a neonate with Hirschsprung's disease: fluconazole resistance and genetic relatedness of eight Candida tropicalis isolates.. J Med Microbiol
55: 423-428
[Abstract]
[Full Text]
-
Maaroufi, Y., Ahariz, N., Husson, M., Crokaert, F.
(2004). Comparison of Different Methods of Isolation of DNA of Commonly Encountered Candida Species and Its Quantitation by Using a Real-Time PCR-Based Assay. J. Clin. Microbiol.
42: 3159-3163
[Abstract]
[Full Text]
-
Davies, A., Brailsford, S., Broadley, K., Beighton, D.
(2002). Resistance amongst yeasts isolated from the oral cavities of patients with advanced cancer. Palliat Med
16: 527-531
[Abstract]
-
Luo, G., Mitchell, T. G.
(2002). Rapid Identification of Pathogenic Fungi Directly from Cultures by Using Multiplex PCR. J. Clin. Microbiol.
40: 2860-2865
[Abstract]
[Full Text]
-
Yeo, S. F., Wong, B.
(2002). Current Status of Nonculture Methods for Diagnosis of Invasive Fungal Infections. Clin. Microbiol. Rev.
15: 465-484
[Abstract]
[Full Text]
-
SENDID, B., POIROT, J. L., TABOURET, M., BONNIN, A., CAILLOT, D., CAMUS, D., POULAIN, D.
(2002). Combined detection of mannanaemia and anti-mannan antibodies as a strategy for the diagnosis of systemic infection caused by pathogenic Candida species. J Med Microbiol
51: 433-442
[Abstract]
[Full Text]
-
Zhao, J., Kong, F., Li, R., Wang, X., Wan, Z., Wang, D.
(2001). Identification of Aspergillus fumigatus and Related Species by Nested PCR Targeting Ribosomal DNA Internal Transcribed Spacer Regions. J. Clin. Microbiol.
39: 2261-2266
[Abstract]
[Full Text]
-
Zerva, L., Bourantas, K., Mitka, S., Kansouzidou, A., Legakis, N. J.
(2001). Serum Is the Preferred Clinical Specimen for Diagnosis of Human Brucellosis by PCR. J. Clin. Microbiol.
39: 1661-1664
[Abstract]
[Full Text]
-
Deak, T., Chen, J., Beuchat, L. R.
(2000). Molecular Characterization of Yarrowia lipolytica and Candida zeylanoides Isolated from Poultry. Appl. Environ. Microbiol.
66: 4340-4344
[Abstract]
[Full Text]
-
Loeffler, J., Hebart, H., Brauchle, U., Schumacher, U., Einsele, H.
(2000). Comparison between Plasma and Whole Blood Specimens for Detection of Aspergillus DNA by PCR. J. Clin. Microbiol.
38: 3830-3833
[Abstract]
[Full Text]
Top
Abstract
Introduction
