Previous Article | Next Article 
Journal of Clinical Microbiology, April 1999, p. 931-936, Vol. 37, No. 4
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Species Identification and Strain Differentiation of Dermatophyte
Fungi by Analysis of Ribosomal-DNA Intergenic Spacer
Regions
Colin J.
Jackson,
Richard C.
Barton,* and
E. Glyn V.
Evans
Department of Microbiology and PHLS Mycology
Reference Laboratory, University of Leeds and General Infirmary,
Leeds LS2 9JT, United Kingdom
Received 14 October 1998/Returned for modification 11 November
1998/Accepted 13 January 1999
 |
ABSTRACT |
Restriction fragment length polymorphisms (RFLPs) identified in the
ribosomal-DNA (rDNA) repeat were used for molecular strain differentiation of the dermatophyte fungus Trichophyton
rubrum. The polymorphisms were detected by hybridization of
EcoRI-digested T. rubrum genomic DNAs with
a probe amplified from the small-subunit (18S) rDNA and adjacent
internal transcribed spacer (ITS) regions. The rDNA RFLPs mapped to the
nontranscribed spacer (NTS) region of the rDNA repeat and appeared
similar to those caused by short repetitive sequences in the intergenic
spacers of other fungi. Fourteen individual RFLP patterns (DNA types A
to N) were recognized among 50 random clinical isolates of
T. rubrum. A majority of strains (19 of 50 [38%])
were characterized by one RFLP pattern (DNA type A), and four types
(DNA types A to D) accounted for 78% (39 of 50) of all strains. The
remaining types (DNA types E to N) were represented by one or two
isolates only. A rapid and simple method was also developed for
molecular species identification of dermatophyte fungi. The contiguous
ITS and 5.8S rDNA regions were amplified from 17 common dermatophyte
species by using the universal primers ITS 1 and ITS 4. Digestion of
the amplified ITS products with the restriction endonuclease
MvaI produced unique and easily identifiable fragment
patterns for a majority of species. However, some closely related taxon
pairs, such as T. rubrum-T. soudanense and
T. quinkeanum-T. schoenlenii could not be
distinguished. We conclude that RFLP analysis of the NTS and ITS
intergenic regions of the rDNA repeat is a valuable technique both for
molecular strain differentiation of T. rubrum and for
species identification of common dermatophyte fungi.
 |
INTRODUCTION |
Dermatophyte fungi cause a variety
of superficial and usually easily treated mycoses. However, nail
infections (onychomycoses) due to Trichophyton rubrum are
often more intractable, and relapse frequently occurs following
cessation of antifungal therapy. Drug resistance is not a primary
factor in such episodes, as susceptibility testing of nail isolates
pre- and posttherapy usually confirms the strains to be fully sensitive
to the chemotherapeutic agent used. We are currently attempting to
establish whether recurrence of T. rubrum onychomycosis
following an appropriate course of treatment is due primarily to
treatment failure or to reinfection with a new strain. This
requires the development and evaluation of an effective method for
strain differentiation in T. rubrum.
Conventional (phenotypic) strain typing of dermatophyte
fungi is problematic due to a lack of stable
characteristics distinguishing between isolates. Most T. rubrum strains show uniformity in both microscopical and colonial
appearance, although variations in colony morphology do exist. However,
these apparent strain differences are often not stable on subculture or
may simply be artifacts due to specific growth conditions or the
presence of contaminating bacteria (21). Alternative
molecular (genotypic) approaches to the subtyping of dermatophyte fungi
have met with limited success. The discrimination achieved by
techniques such as arbitrarily primed PCR (AP-PCR) (7, 11),
random amplified polymorphic DNA analysis (RAPD) (16, 27),
and restriction analysis of mtDNA (15) is generally adequate
for species identification but insufficiently sensitive for strain
differentiation of T. rubrum. Zhong et al. examined
thirty isolates of T. rubrum by RAPD and found 22 strains to be indistinguishable and 8 to show very minor
differences (27), while Liu et al., using AP-PCR, reported
no differences between 8 strains of T. rubrum
(11).
Interstrain polymorphisms in the spacer regions of fungal ribosomal-DNA
(rDNA) repeat units have provided practical epidemiological markers for
typing a range of clinically important species. Recently, fragment
length polymorphisms present in the rDNA nontranscribed spacer (NTS)
regions have been used to type both Candida krusei (4) and Aspergillus fumigatus (19),
and nucleotide sequence variations in the internal transcribed spacers
(ITS I and II) have been shown to differentiate strains of
Pneumocystis carinii f. sp. hominis
(10). We have examined molecular variation in the rDNA
repeats of T. rubrum and other dermatophyte fungi and identified length variations in the NTS region which have been used for
strain differentiation.
Additional analysis of the ITS regions has provided a simple and
reproducible molecular method for dermatophyte species
characterization, utilizing MvaI restriction enzyme patterns
of PCR-amplified ITS I and ITS II regions. In this report we show that
polymorphism analysis of the rDNA intergenic regions is a valuable
technique both for strain typing and species identification in this
important group of pathogenic fungi.
 |
MATERIALS AND METHODS |
Dermatophyte isolates.
Clinical isolates of T. rubrum and other dermatophyte species were cultured from skin,
hair, and nail samples submitted to the Leeds PHLS Mycology Reference
Laboratory by general practitioners and hospital dermatology
departments in the United Kingdom. Isolates from Iceland, Finland,
Holland, and Germany were received during the course of a clinical
trial from patients with onychomycosis in these countries. Cultures of
six dermatophyte species were provided by Gillian Midgley, Institute of
Dermatology, St. Thomas' Hospital, London, United Kingdom, and three
type cultures were obtained from the National Collection of Pathogenic
Fungi, PHLS Mycology Reference Laboratory, Bristol, United Kingdom.
All clinical isolates were identified to species level on the basis of
standard biochemical tests, microscopy, and colony characteristics.
Strains grown from clinical samples were subcultured once to confirm
purity, and cultures were maintained in sterile water and on Sabouraud
agar slopes.
Isolation of fungal DNA.
Strains were cultured in 100 ml of
Sabouraud liquid medium (Oxoid; Unipath Ltd., Basingstoke, United
Kingdom) and incubated with shaking for up to 7 days at 27°C. Hyphal
growth was harvested by filtration and washed twice with 100 ml of
sterile saline. Strains which could not be processed immediately were
frozen at
80°C prior to extraction. Liquid nitrogen was added to 2 to 3 g of frozen hyphae in a prechilled mortar, and the cells were ground finely with a pestle. Approximately 200 mg of frozen, ground mycelium was placed in a 1.5-ml microcentrifuge tube, and 600 µl of
lysis buffer (400 mM Tris-HCl, pH 8.0; 60 mM EDTA; 150 mM NaCl; 1%
sodium dodecyl sulfate [SDS]; 40 mg/ml proteinase K) was added.
Samples were incubated for 1 h at 60°C with occasional mixing,
and then 100 µl of 5 M sodium perchlorate was added and incubation
continued for a further 15 min at 60°C. Tubes were cooled on ice, and
extraction was performed with 500 µl of ice-cold chloroform and then
with equal volumes of phenol-chloroform-isoamyl alcohol (25:24:1; pH
8.0; BDH Lab Supplies, Poole, United Kingdom) and finally with
chloroform. Purified nucleic acids were precipitated with 2 volumes of
ice-cold 95% ethanol, washed twice in 500 µl of 70% ethanol, air
dried, and resuspended in 150 to 200 µl of sterile water.
Detection of rDNA polymorphisms in T. rubrum.
Ten micrograms (~10 µl) of each DNA sample was
digested for 18 h with 15 U of restriction endonuclease
EcoRI (MBI Fermentas, IGI Ltd., Sunderland, United Kingdom)
in a total volume of 20 µl. Samples were electrophoresed in
0.8% agarose gels, stained with ethidium bromide, and photographed.
Gel denaturation and neutralization and immobilization of DNA fragments
onto nylon membranes (Hybond-N; Amersham International plc, Little
Chalfont, United Kingdom) by Southern transfer were performed according to standard protocols.
An rDNA probe was amplified from template DNA of
T. rubrum NCPF 295 by using universal primers NS 5 (5'
AACTTAAAGGAATTGACGGAAG
3') and ITS 4 (5'
TCCTCCGCTTATTGATATGC 3') (
26). The 1,219-bp
probe
consisted of a 550-bp fragment from the 3' end of the 18S
rDNA plus
the adjacent ITS I, 5.8S rDNA, and ITS II regions (Fig.
1). The probe was labelled by
incorporating digoxigenin (DIG)-labelled
dUTP (Boehringer-Mannheim UK
Ltd., Lewes, United Kingdom) into
a standard PCR mixture. The PCR
mixture contained reaction buffer
(50 mM KCl, 10 mM Tris-HCl [pH
9.0], 0.1% Triton X-100), 1.5 mM
magnesium chloride, a
DIG-deoxynucleoside triphosphate (dNTP)
mix (0.2 mM each of dATP,
dCTP, dGTP; 0.13 mM dTTP; 0.07 mM DIG-11-dUTP,
alkali labile, pH 7.0),
30 pmol each of primers NS 5 and ITS 4
(MWG-Biotech, Milton Keynes,
United Kingdom), 5 U of
Taq polymerase
(Stratech Scientific
Ltd., Luton, United Kingdom), and approximately
10 ng of diluted
template DNA, made up to a total volume of 100
µl with pure water.
PCR cycling conditions were 35 cycles of 95°C
for 1 min, 55°C for 1 min, and 72°C for 2 min, followed by an
extension step of 72°C for
10 min. The probe was gel purified
with a GX resin system (Nucleon
Biosciences, Coatbridge, United
Kingdom), and the probe concentration
was adjusted to ~20 ng/ml
in a 15-ml volume of hybridization solution
(5× SSC [1× SSC is
0.15 M NaCl plus 0.015 M sodium citrate], 0.1%
N-lauroylsarcosine,
0.02% SDS, 1% blocking reagent
[formulation unknown; Boehringer-Mannheim]).
Hybridization was
carried out for 18 h at 65°C, followed by four
stringent washes
(twice for 5 min at 25°C with 2× SSC-0.1% SDS
and twice for 15 min
at 65°C with 0.5× SSC-0.1% SDS). Bound, labelled
probe was
conjugated with anti-DIG-AP Fab fragments (Boehringer-Mannheim),
and
signal was developed by using the chemiluminescent substrate
CSPD
(Boehringer-Mannheim).

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1.
EcoRI restriction map of the rDNA repeat unit
of T. rubrum. The fragment between restriction sites Ec
1 and Ec 2 may encompass the whole of the 25S gene and is of constant
length (~3 kb) in all strains. The fragment between sites Ec 2 and Ec
3 represents the NTS region and the 18S gene and shows fragment length
polymorphisms in several T. rubrum strains. One
hypothesis to account for these length variations is the presence of a
repetitive element located in the NTS region.
|
|
Detection of Mva I restriction site polymorphisms in
the ITS I and II regions of the rDNA.
The contiguous ITS I, 5.8S,
and ITS II regions were amplified from a range of dermatophyte species
by using the conserved primers ITS 1 (5' TCCGTAGGTGAACCTGCGG
3') and ITS 4 (26). The PCR mixture and amplification
conditions were the same as those used for preparing the labelled
probe, but the DIG-dNTP labelling mix was replaced with a standard mix
producing a final concentration of 0.2 mM of each dNTP.
Species-characteristic restriction site polymorphisms were detected by
digestion of the amplified product with the restriction enzyme
MvaI (MBI Fermentas), which recognizes the sequence 5'
CC(T/A)GG 3'. Digest fragments were separated by electrophoresis
in 2% agarose gels and stained with ethidium bromide prior to photography.
 |
RESULTS |
Strain typing of T. rubrum.
From the results
of the probe hybridizations and using sequence data of the
T. rubrum 18S and ITS I and ITS II regions (1, 2), a provisional restriction map of the rDNA repeat was
constructed (Fig. 1). An EcoRI fragment comprising ITS I,
all of the 18S gene, and an indeterminate length of the NTS region was
polymorphic in size between strains. In most isolates, the length of
this fragment varied over the range 4.7 to 5.8 kb (Fig.
2A), although a smaller proportion
of strains had either two or four polymorphic bands in the same
region (Fig. 2B). A second lower-molecular-weight EcoRI fragment of approximately 3 kb (not shown)
was invariant in size and represented an uncharacterized segment of the
25S gene and the ITS II region proximal to this (Fig. 1). The probe also detected a third, high-molecular-weight band which was
approximately equal in length to the sum of the sizes of the first two
fragments. This may represent a subpopulation of repeat units from
which one of the two EcoRI sites has been lost.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 2.
Southern blot of EcoRI-digested genomic DNA
from 14 strains of T. rubrum, probed as described in
Materials and Methods. Two distinct types of restriction fragment
length polymorphism are present in the rDNA repeat of these strains.
The six strains (types A to F) illustrated in panel A have a single
variable fragment in the size range 4.7 to 5.8 kb, while the
eight pattern types (G to N) shown in panel B have multiple variable
fragments (either two or four) in the same region. An
additional high-molecular-weight variable fragment(s) is
present in the 9.0-kb region of all strains. The single, invariant band
at 3.0 kb representing fragment Ec 1 to Ec 2 (Fig. 1) is not shown.
Molecular weights of standards (in thousands) are given to the right of
each panel. = molecular weight marker
(HindIII-digested lambda DNA).
|
|
Six different single band types (types A to F [Fig.
2A]) and eight
multiple band patterns (types G to N [Fig.
2B]) were recognized,
making a total of 14 patterns overall among the 50 isolates examined.
One pattern, DNA type A, was found for 19 of 50 (38%) of strains
and
was present in isolates from all geographic locations. Three
other
pattern types were prevalent: DNA types B (9 of 50 strains;
18%), C (5 of 50 strains; 10%), and D (6 of 50 strains; 12%).
All other types
were represented by single isolates only, except
for two strains
of DNA type I (Table
1; Fig.
2B). There
was no
obvious correlation between any pattern type and the
geographical
or clinical origin of an isolate, although such
associations may
not have been apparent due to the relatively small
number of strains
examined. Ten isolates with different rDNA profiles
(rDNA types
A, B, C, D, E, F, J, K, L, and M) were evaluated by
RAPD using
the primer OPK-17 (
27). No clearly
evident variations in RAPD
pattern were found between any of
these strains (data not shown).
Species identification of dermatophytes.
The ITS I, 5.8S, and
ITS II region amplified from Trichophyton rubrum by using
primers ITS 1 and ITS 4 was 692 bp in length (1). The
amplification products obtained from 10 other Trichophyton spp. and from Microsporum persicolor were of approximately
equivalent size (Fig. 3A). The ITS
regions amplified from Epidermophyton floccosum and
Microsporum canis were larger than that of
T. rubrum by about 50 bp, while those from
Trichophyton terrestre, Microsporum gypseum, and
Microsporum audouinii were smaller, at approximately 670, 610, and 590 bp, respectively. Amplified products from all species had
between two and four recognition sites for MvaI, except for
M. audouinii, which had none. Thirteen different
MvaI restriction patterns were produced from 17 dermatophyte
species. Nine patterns were unique to one species only (M. audouinii, M. canis, M. gypseum, M. persicolor, E. floccosum, Trichophyton
mentagrophytes, T. terrestre, Trichophyton
verrucosum, and Trichophyton violaceum), while four patterns were shared between each of two Trichophyton
species (T. quinkeanum and T. schoenlenii, T. soudanense and T. rubrum, T. equinum and T. tonsurans, and T. concentricum and T. erinacei) (Fig. 3B).

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 3.
Agarose gel electrophoresis of PCR-amplified ITS regions
(A) and MvaI restriction digests of amplified ITS products
(B) from 17 dermatophyte species. All products were electrophoresed in
2% agarose gels and stained with ethidium bromide. Lanes: 1, E. floccosum DS.EF; 2, M. audouinii SJ.EM 4875; 3, M. canis 97/12400; 4, M. gypseum SJ.EM 3928; 5, M. persicolor NCPF 356; 6, T. concentricum
NCPF 600; 7, T. erinacei LM 47; 8, T. quinkeanum LM 54; 9, T. schoenleinii SJ.EV 327;
10, T. verrucosum 98/4545; 11, T. rubrum NCPF 295; 12, T. soudanense 98/7676; 13, T. violaceum SJ.EM 7115; 14, T. mentagrophytes DS.TMvM; 15, T. equinum SJ.A1; 16, T. tonsurans SJ.EM 6717; 17, T. terrestre LM 39.
|
|
Three clinical isolates with atypical or equivocal species
characteristics could be unambiguously assigned to specific taxa
by the
ITS PCR method (data not
shown).
Stability and reproducibility of strain typing and species
identification.
Five separate DNA extractions were made over a
period of 8 months on strain T. rubrum NCPF 295. Multiple DNA extractions, restriction digests, and Southern blotting
were also performed for several other isolates for comparative
purposes. In each case, the rDNA types resulting from repeat
extractions were unchanged (data not shown).
The results obtained from a comparison of
MvaI ITS digestion
and conventional species identification were fully concordant
for
multiple isolates of certain species, including 55
T. rubrum isolates 18
T. mentagrophytes
isolates, 8
T. tonsurans isolates,
6
T. erinacei isolates, and 5
M. canis
isolates (data not shown).
The species-characteristic patterns were
reproducible irrespective
of the strain phenotype, geographic
origin, frequency of subculture,
or storage conditions.
Additionally, the method demonstrated the
stability of
T. rubrum, in that
T. rubrum NCPF 295, isolated several
decades ago, showed a restriction pattern
identical to that of
strains from the modern
era.
 |
DISCUSSION |
We have developed a molecular method for strain differentiation in
T. rubrum to determine whether recurrent posttreatment onychomycosis is due to treatment failure or to reinfection with a new
fungal strain. Strain typing of dermatophytes has a number of other
potential clinical and epidemiological applications. Nail infections
due to T. rubrum are increasingly being treated with a
new generation of systemic triazole and allylamine antifungal agents.
Treatment courses of either continuous or pulsed therapy (22) typically last for several months, increasing the
potential for acquisition of resistance to some of these compounds
(5). If resistant isolates do emerge, typing methods will
allow these strains to be characterized and their occurrence and
distribution to be monitored.
The ability to type dermatophytes could also provide new insights into
the epidemiology, population biology and pathogenicity of these fungi.
For example, our data suggest that only a limited number of strains are
prevalent in T. rubrum infections, with four
pattern types (DNA types A to D) predominant among our clinical isolates and one type (DNA type A) accounting for over a third of all strains. One reason for this may be a low discrimination index
for the typing system we describe. However, this distribution pattern
may also have resulted from a recent and widespread dissemination of these particular strain types, which may possess enhanced
infectivity, invasiveness, or other virulence characteristics. The
etiology of dermatophyte infection in the United Kingdom is
undoubtedly linked to factors such as recent changes in
foot hygiene, combined with an increased usage of communal recreational
facilities such as swimming pools and leisure centers. These
developments may have provided ideal conditions for the
proliferation of a single or small number of particularly
anthropophilic or pathogenic T. rubrum clones. This
type of strain distribution has been termed epidemic or explosive
spread in prokaryotes (14).
The success in typing dermatophytes according to phenotypic criteria
such as colony morphology or biochemical reactivity has been limited.
Molecular approaches such as RAPD have similarly failed to identify
substantive intraspecific polymorphisms within T. rubrum or other dermatophyte species (7, 11, 16, 27). What little variations were seen for RAPD between isolates of T. rubrum were minor, and reduced-specificity PCR
amplifications are notorious for problems of reproducibility
(23). These results may reflect an innate lack of
chromosomal variation in these fungi, perhaps as a consequence of the
clonal population structure suggested above. However, our results
demonstrate that substantial molecular diversity is present in the rDNA
repeat of T. rubrum, and interstrain variations
elsewhere in the genome may subsequently be identified by molecular
methods other than RAPD, such as microsatellite typing. Interestingly,
an early report also demonstrated rDNA variation in the dimorphic
pathogenic fungus Histoplasma capsulatum (24). This species is a member of the order Onygenales, a monophyletic lineage from whose ancestor the family of dermatophyte fungi
(Arthrodermataceae) also evolved (9).
The molecular polymorphisms we have identified may be due
to variations in the copy number of a repetitive element present in the
nontranscribed intergenic regions of the rDNA cistrons. Similar
repetitive units have been identified in the rDNA intergenic regions of
higher organisms such as Xenopus laevis (25) and Drosophila melanogaster (12), as well as in fungi
such as Schizophyllum commune (20), Pythium
ultimum (8), and C. krusei (3). The size difference separating each of the fragments in types A to D
appears to be about 100 to 150 bp, which may indicate the presence of a
repeating sequence of this length in the T. rubrum NTS region. We are currently attempting to confirm the
existence and genetic identity of this presumptive repetitive element
in our laboratory. The size difference separating types D, E, and F is somewhat larger than 150 bp, and fragments of intermediate sizes
may be identified from a wider sample of isolates. The multiple banding
patterns (types G to M) may be the result of heterogeneities in the
number of repeat units within different copies of the rDNA cistrons of
individual strains (8). If T. rubrum is
diploid, then these isolates may additionally demonstrate
heterozygosity in the rDNA interrepeats derived from each chromosomal
homologue (13). A third possibility is that these strains
represent heterokaryons, with different rDNA polymorphisms originating
from each haploid mate (20).
While strain typing is useful for studying the clinical and
epidemiological aspects of onchomycoses, species identification has a
wider role in monitoring the demographic distribution and changes in
frequency of specific dermatophyte infections (6). Accurate
identification of dermatophytes can be time-consuming and requires
extensive familiarity with the microscopical and cultural
characteristics of these taxa (21). A molecular solution to
problems of species identification in the commercially important black
truffle fungi (Tuber melanosporum) involved simple
restriction analysis of the amplified ITS region (18). The
same approach has proved successful for the dermatophytes, although
some closely related taxa cannot be distinguished. These include
T. quinkeanum and T. schoenlenii, which
have been shown to be closely related by mtDNA restriction analysis
(17). Similarly, the 18S rDNA sequence data for
T. soudanese and T. rubrum, species
which have the same MvaI profile, are practically identical
(9). No pattern differences were observed among
T. mentagrophytes varieties interdigitale, granulosum, mentagrophytes, or
sulphureum. Overall, the discrimination achieved by
MvaI digestion of the ITS regions correlates well with
species identification obtained by AP-PCR (7, 11). Further refinements of our system may enable the lack of discrimination evident
from the above examples to be overcome. However, we cannot exclude the
possibility that some of these apparently anomalous results will be
resolved when dermatophyte taxonomy is fully defined on the basis of
comparative sequence data.
The MvaI restriction patterns are highly reproducible and
consistent for several species, indicating that the ITS regions in
dermatophytes are conserved. This contrasts with pathogenic fungi such
as P. carinii, for which sequence variability of the ITS
regions is sufficient for strain characterization (10). Strain-specific variations in T. rubrum are located in
the NTS rather than the ITS intergenic regions, and the demonstration of these rDNA polymorphisms has provided the first molecular technique for strain differentiation in this species.
 |
ACKNOWLEDGMENT |
We are grateful to the Janssen Research Foundation, Beerse,
Belgium, who provided the financial support for this project.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: PHLS Mycology
Reference Laboratory, Department of Microbiology, The Old Medical
School, Thoresby Place, University of Leeds, Leeds LS2 9JT,
England. Phone: 44 113 233 5598. Fax: 44 113 233 5640. E-mail:
micrb{at}leeds.ac.uk.
 |
REFERENCES |
| 1.
|
Berbee, M. L.,
A. Yoshimura,
J. Sugiyama, and J. W. Taylor.
1995.
Is Penicillium monophyletic an evaluation of phylogeny in the family Trichocomaceae from 18S, 5.8S and ITS ribosomal DNA sequence data.
Mycologia
87:210-222.
|
| 2.
|
Bowman, B. H.,
J. W. Taylor, and T. J. White.
1992.
Molecular evolution of the fungi: human pathogens.
Mol. Biol. Evol.
9:893-904[Abstract].
|
| 3.
|
Carlotti, A.,
T. Srikantha,
K. Schröppel,
C. Kvaal,
J. Villard, and D. R. Soll.
1997.
A novel repeat sequence (CKRS-1) containing a tandemly repeated sub-element (kre) accounts for differences between Candida krusei strains fingerprinted with the probe CkF1,2.
Curr. Genet.
31:255-263[Medline].
|
| 4.
|
Carlotti, A.,
F. Chaib,
A. Couble,
N. Bourgeois,
V. Blanchard, and J. Villard.
1997.
Rapid identification and fingerprinting of Candida krusei by PCR-based amplification of the species-specific repetitive polymorphic sequence CKRS-1.
J. Clin. Microbiol.
35:1337-1343[Abstract].
|
| 5.
|
Evans, E. G. V.
1998.
Causative pathogens in onychomycosis and the possibility of treatment resistance: a review.
J. Am. Acad. Dermatol.
38:S32-S56[Medline].
|
| 6.
|
Ginter, G.,
E. Reiger,
K. Heigl, and E. Propst.
1996.
Increasing frequency of onychomycoses. Is there a change in the spectrum of infectious agents?
Mycoses
39(Suppl. 1):118-122.
|
| 7.
|
Gräser, Y.,
M. el Fari,
W. Presber,
W. Sterry, and H.-J. Tietz.
1998.
Identification of common dermatophytes (Trichophyton, Microsporum, Epidermophyton) using polymerase chain reactions.
Br. J. Dermatol.
138:576-582[Medline].
|
| 8.
|
Klassen, G. R., and J. Buchko.
1990.
Subrepeat structure of the intergenic region in the ribosomal DNA of the oomycetous fungus Pythium ultimum.
Curr. Genet.
17:125-127.
|
| 9.
|
Leclerc, M. C.,
H. Philippe, and E. Guého.
1994.
Phylogeny of dermatophytes and dimorphic fungi based on large subunit ribosomal RNA sequence comparisons.
J. Med. Vet. Mycol.
32:331-341[Medline].
|
| 10.
|
Lee, C.-H.,
J. Helweg-Larsen,
X. Tang,
S. Jin,
B. Li,
M. S. Bartlett,
J.-J. Lu,
B. Lundgren,
J. D. Lundgren,
M. Olsson,
S. B. Lucas,
P. Roux,
A. Cargnel,
C. Atzori,
O. Matos, and J. W. Smith.
1998.
Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes.
J. Clin. Microbiol.
36:734-741[Abstract/Free Full Text].
|
| 11.
|
Liu, D.,
S. Coloe,
J. Pedersen, and R. Baird.
1996.
Use of arbitrarily primed polymerase chain reaction to differentiate Trichophyton dermatophytes.
FEMS Microbiol. Lett.
136:147-150[Medline].
|
| 12.
|
Long, E. O., and I. O. Dawid.
1979.
Restriction analysis of spacers in ribosomal DNA of Drosophila melanogaster.
Nucleic Acids Res.
7:205-215[Abstract/Free Full Text].
|
| 13.
|
Magee, B. B.,
T. M. d'Souza, and P. T. Magee.
1987.
Strain and species identification by restriction fragment length polymorphisms in the ribosomal DNA repeat of Candida species.
J. Bacteriol.
169:1639-1643[Abstract/Free Full Text].
|
| 14.
|
Maynard Smith, J.,
N. H. Smith,
M. O'Rourke, and B. G. Spratt.
1993.
How clonal are bacteria?
Proc. Natl. Acad. Sci. USA
90:4384-4388[Abstract/Free Full Text].
|
| 15.
|
Mochizuki, T.,
S. Watanabe, and M. Uehara.
1996.
Genetic homogeneity of Trichophyton mentagrophytes var. interdigitale isolated from geographically distant regions.
J. Med. Vet. Mycol.
34:139-143[Medline].
|
| 16.
|
Mochizuki, T.,
N. Sugie, and M. Uehara.
1997.
Random amplification of polymorphic DNA is useful for the differentiation of several anthropophilic dermatophytes.
Mycoses
40:405-409[Medline].
|
| 17.
|
Nishio, K.,
M. Kawasaki, and H. Ishizaki.
1991.
Phylogeny of the genera Trichophyton using mitochondrial DNA analysis.
Mycopathologia
11:127-132.
|
| 18.
|
Paolocci, F.,
A. Rubini,
B. Granetti, and S. Arcioni.
1997.
Typing Tuber melanosporum and Chinese black truffle species by molecular markers.
FEMS Microbiol. Lett.
153:255-260[Medline].
|
| 19.
|
Radford, S. A.,
E. M. Johnson,
J. P. Leeming,
M. R. Millar,
J. M. Cornish,
A. B. M. Foot, and D. W. Warnock.
1998.
Molecular epidemiological study of Aspergillus fumigatus in a bone marrow transplantation unit by PCR amplification of ribosomal intergenic spacer sequences.
J. Clin. Microbiol.
36:1294-1299[Abstract/Free Full Text].
|
| 20.
|
Specht, C. A.,
C. P. Novotny, and R. C. Ullrich.
1984.
Strain specific differences in ribosomal DNA from the fungus Schizophyllum commune.
Curr. Genet.
8:219-222.
|
| 21.
|
Summerbell, R., and J. Kane.
1997.
Physiological and other special tests for identifying dermatophytes, p. 45-79.
In
J. Kane, and R. Summerbell (ed.), Laboratory handbook of dermatophytes. Star Publishing Co., Belmont, Calif.
|
| 22.
|
Tosti, A.,
B. M. Priaccini,
C. Stinchi,
N. Venturon,
F. Bardazzi, and M. D. Colombo.
1996.
Treatment of dermatophyte nail infections: an open randomized study comparing intermittent terbinafine therapy with continuous terbinafine treatment and intermittent itraconazole therapy.
J. Am. Acad. Dermatol
34:595-600[Medline].
|
| 23.
|
Tyler, K. D.,
G. Wang,
S. D. Tyler, and W. M. Johnson.
1997.
Factors affecting reliability and reproducibility of amplification-based DNA fingerprinting of representative bacterial pathogens.
J. Clin. Microbiol.
35:339-346[Medline].
|
| 24.
|
Vincent, R. D.,
R. Goewert,
W. E. Goldman,
G. S. Kobayashi,
A. M. Lambowitz, and G. Medoff.
1986.
Classification of Histoplasma capsulatum isolates by restriction fragment polymorphisms.
J. Bacteriol.
165:813-818[Abstract/Free Full Text].
|
| 25.
|
Wellauer, P.,
I. Dawid,
D. Brown, and R. Reeder.
1976.
The molecular basis for length heterogeneity in ribosomal DNA from Xenopus laevis.
J. Mol. Biol.
105:461-486[Medline].
|
| 26.
|
White, T. J.,
T. Bruns, and J. Taylor.
1990.
Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315-322.
In
M. A. Innis (ed.), PCR protocols: a guide to methods and applications. Academic Press, London, United Kingdom.
|
| 27.
|
Zhong, Z.,
R. Li,
D. Li, and D. Wang.
1997.
Typing of common dermatophytes by random amplification of polymorphic DNA.
Jpn. J. Med. Mycol
38:239-246.
|
Journal of Clinical Microbiology, April 1999, p. 931-936, Vol. 37, No. 4
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Shehata, A. S., Mukherjee, P. K., Aboulatta, H. N., El Akhras, A. I., Abbadi, S. H., Ghannoum, M. A.
(2008). Single-Step PCR Using (GACA)4 Primer: Utility for Rapid Identification of Dermatophyte Species and Strains. J. Clin. Microbiol.
46: 2641-2645
[Abstract]
[Full Text]
-
White, T. C., Oliver, B. G., Graser, Y., Henn, M. R.
(2008). Generating and Testing Molecular Hypotheses in the Dermatophytes. Eukaryot Cell
7: 1238-1245
[Full Text]
-
Kong, F., Tong, Z., Chen, X., Sorrell, T., Wang, B., Wu, Q., Ellis, D., Chen, S.
(2008). Rapid Identification and Differentiation of Trichophyton Species, Based on Sequence Polymorphisms of the Ribosomal Internal Transcribed Spacer Regions, by Rolling-Circle Amplification. J. Clin. Microbiol.
46: 1192-1199
[Abstract]
[Full Text]
-
Chang, J.-C., Hsu, M. M.-L., Barton, R. C., Jackson, C. J.
(2008). High-Frequency Intragenomic Heterogeneity of the Ribosomal DNA Intergenic Spacer Region in Trichophyton violaceum. Eukaryot Cell
7: 721-726
[Abstract]
[Full Text]
-
Cascio, G. L., Dalle Carbonare, L., Maccacaro, L., Caliari, F., Ligozzi, M., Cascio, V. L., Fontana, R.
(2007). First Case of Bloodstream Infection Due to Candida magnoliae in a Chinese Oncological Patient. J. Clin. Microbiol.
45: 3470-3473
[Abstract]
[Full Text]
-
Abdel-Rahman, S. M., Preuett, B., Gaedigk, A.
(2007). Multilocus Genotyping Identifies Infections by Multiple Strains of Trichophyton tonsurans. J. Clin. Microbiol.
45: 1949-1953
[Abstract]
[Full Text]
-
Binstock, J. M.
(2007). Molecular Biology Techniques for Identifying Dermatophytes and Their Possible Use in Diagnosing Onychomycosis in Human Toenail: A Review. J. Am. Podiatr. Med. Assoc.
97: 134-144
[Abstract]
[Full Text]
-
Bhardwaj, S., Sutar, R., Bachhawat, A. K., Singhi, S., Chakrabarti, A.
(2007). PCR-based identification and strain typing of Pichia anomala using the ribosomal intergenic spacer region IGS1. J Med Microbiol
56: 185-189
[Abstract]
[Full Text]
-
Yu, L., Zhang, W., Wang, L., Yang, J., Liu, T., Peng, J., Leng, W., Chen, L., Li, R., Jin, Q.
(2007). Transcriptional Profiles of the Response to Ketoconazole and Amphotericin B in Trichophyton rubrum. Antimicrob. Agents Chemother.
51: 144-153
[Abstract]
[Full Text]
-
Jackson, C. J., Mochizuki, T., Barton, R. C.
(2006). PCR fingerprinting of Trichophyton mentagrophytes var. interdigitale using polymorphic subrepeat loci in the rDNA nontranscribed spacer.. J Med Microbiol
55: 1349-1355
[Abstract]
[Full Text]
-
Kardjeva, V., Summerbell, R., Kantardjiev, T., Devliotou-Panagiotidou, D., Sotiriou, E., Graser, Y.
(2006). Forty-Eight-Hour Diagnosis of Onychomycosis with Subtyping of Trichophyton rubrum Strains. J. Clin. Microbiol.
44: 1419-1427
[Abstract]
[Full Text]
-
Brasch, J., Graser, Y.
(2005). Trichophyton eboreum sp. nov. Isolated from Human Skin. J. Clin. Microbiol.
43: 5230-5237
[Abstract]
[Full Text]
-
Hsiao, C. R., Huang, L., Bouchara, J.-P., Barton, R., Li, H. C., Chang, T. C.
(2005). Identification of Medically Important Molds by an Oligonucleotide Array. J. Clin. Microbiol.
43: 3760-3768
[Abstract]
[Full Text]
-
Rad, M. M., Jackson, C., Barton, R. C, Evans, E G.
(2005). Single strains of Trichophyton rubrum in cases of tinea pedis. J Med Microbiol
54: 725-726
[Abstract]
[Full Text]
-
Gaedigk, A., Gaedigk, R., Abdel-Rahman, S. M.
(2003). Genetic Heterogeneity in the rRNA Gene Locus of Trichophyton tonsurans. J. Clin. Microbiol.
41: 5478-5487
[Abstract]
[Full Text]
-
Mochizuki, T., Ishizaki, H., Barton, R. C., Moore, M. K., Jackson, C. J., Kelly, S. L., Evans, E. G. V.
(2003). Restriction Fragment Length Polymorphism Analysis of Ribosomal DNA Intergenic Regions Is Useful for Differentiating Strains of Trichophyton mentagrophytes. J. Clin. Microbiol.
41: 4583-4588
[Abstract]
[Full Text]
-
Mukherjee, P. K., Leidich, S. D., Isham, N., Leitner, I., Ryder, N. S., Ghannoum, M. A.
(2003). Clinical Trichophyton rubrum Strain Exhibiting Primary Resistance to Terbinafine. Antimicrob. Agents Chemother.
47: 82-86
[Abstract]
[Full Text]
-
Klamer, M., Roberts, M. S., Levine, L. H., Drake, B. G., Garland, J. L.
(2002). Influence of Elevated CO2 on the Fungal Community in a Coastal Scrub Oak Forest Soil Investigated with Terminal-Restriction Fragment Length Polymorphism Analysis. Appl. Environ. Microbiol.
68: 4370-4376
[Abstract]
[Full Text]
-
LIU, D., PEARCE, L., LILLEY, G., COLOE, S., BAIRD, R., PEDERSEN, J.
(2002). PCR identification of dermatophyte fungi Trichophyton rubrum, T. soudanense and T. gourvilii. J Med Microbiol
51: 117-122
[Abstract]
[Full Text]
-
Fujita, S.-I., Senda, Y., Nakaguchi, S., Hashimoto, T.
(2001). Multiplex PCR Using Internal Transcribed Spacer 1 and 2 Regions for Rapid Detection and Identification of Yeast Strains. J. Clin. Microbiol.
39: 3617-3622
[Abstract]
[Full Text]
-
Gupta, A. K., Kohli, Y., Summerbell, R. C.
(2001). Variation in Restriction Fragment Length Polymorphisms among Serial Isolates from Patients with Trichophyton rubrum Infection. J. Clin. Microbiol.
39: 3260-3266
[Abstract]
[Full Text]
-
Buzina, W., Lang-Loidolt, D., Braun, H., Freudenschuss, K., Stammberger, H.
(2001). Development of Molecular Methods for Identification of Schizophyllum commune from Clinical Samples. J. Clin. Microbiol.
39: 2391-2396
[Abstract]
[Full Text]
-
Okeke, C. N., Tsuboi, R., Kawai, M., Hiruma, M., Ogawa, H.
(2001). Isolation of an Intron-Containing Partial Sequence of the Gene Encoding Dermatophyte Actin (ACT) and Detection of a Fragment of the Transcript by Reverse Transcription-Nested PCR as a Means of Assessing the Viability of Dermatophytes in Skin Scales. J. Clin. Microbiol.
39: 101-106
[Abstract]
[Full Text]
-
Jackson, C. J., Barton, R. C., Kelly, S. L., Evans, E. G. V.
(2000). Strain Identification of Trichophyton rubrum by Specific Amplification of Subrepeat Elements in the Ribosomal DNA Nontranscribed Spacer. J. Clin. Microbiol.
38: 4527-4534
[Abstract]
[Full Text]
-
Gupta, A. K., Kohli, Y., Summerbell, R. C.
(2000). Molecular Differentiation of Seven Malassezia Species. J. Clin. Microbiol.
38: 1869-1875
[Abstract]
[Full Text]