JCM Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Feucht, H.-H.
Right arrow Articles by Laufs, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feucht, H.-H.
Right arrow Articles by Laufs, R.

Journal of Clinical Microbiology, May 1999, p. 1294-1297, Vol. 37, No. 5
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

Age-Dependent Acquisition of Hepatitis G Virus/GB Virus C in a Nonrisk Population: Detection of the Virus by Antibodies

Heinz-Hubert Feucht,* Matthias Schröter, Bernhard Zöllner, Susanne Polywka, and Rainer Laufs

Institute of Medical Microbiology and Immunology, Universitäts-Krankenhaus Eppendorf, Hamburg, Germany

Received 21 September 1998/Returned for modification 19 November 1998/Accepted 22 January 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Until now there have been few seroepidemiological data for hepatitis G virus/GB virus type C (HGV/GBV-C). A four-antigen HGV/GBV-C immunoblot was established to examine 446 serum specimens from healthy individuals without risk factors for parenteral viral transmission. These individuals were divided into seven groups according to age. Seroprevalence rates were low for children and adolescents (5.6%) and increased for the age groups assumed to be the most sexually active (15.3 to 26.8%). Remarkably, none of the 80 individuals who tested positive for HGV/GBV-C antibodies were simultaneously positive for HGV/GBV-C viremia. From our data we conclude that HGV/GBV-C infection is widespread in the general population (16 to 25%). The development of an antibody response is associated with clearance of HGV/GBV-C viremia. Due to the lack of risk factors for HGV/GBV-C infection of blood, other efficient transmission routes must exist. It must be assumed that HGV/GBV-C transmission may be linked to sexual activity.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

For about 3% of infectious hepatitis cases the causative agent is unknown (1). An RNA virus named hepatitis G virus (HGV) has recently been identified in the plasma of a patient with chronic hepatitis (17). HGV and the previously described GB virus type C (GBV-C) appear to be different strains of the same virus (16). It has been reported that HGV/GBV-C is associated with acute, chronic, and fulminant hepatitis in humans (16, 17, 21). Nevertheless, the clinical relevance of HGV/GBV-C infection is still unclear (5).

Reverse transcription (RT)-PCR for the detection of HGV/GBV-C RNA was the first assay to examine the prevalence of HGV/GBV-C infection. HGV/GBV-C viremia has been detected in 1.7 to 3.2% of healthy blood donors (1, 6). In contrast, individuals with risk factors for parenteral viral transmission have an increased prevalence of HGV/GBV-C viremia: intravenous drug users, 25 to 50%, and hemophilia patients, 15 to 35% (6, 13). Therefore, transmission by blood represents one main route for HGV/GBV-C infection.

Seroepidemiological studies of HGV/GBV-C have been hampered by the lack of commercially available assays. Therefore, we established a strip immunoblot assay (SIA) using recombinant proteins from different putative structural (envelope 1 and 2) and nonstructural (NS) regions (NS3 and NS4) of HGV/GBV-C expressed in Escherichia coli.

By a first-generation HGV/GBV-C SIA with three recombinant HGV/GBV-C proteins of the env1, NS3, and NS3/NS4 regions, we tested for the seroprevalence of antibodies in the blood of healthy blood donors and individuals at risk for parenteral viral transmission, like hemophilia patients, intravenous drug users, recipients of multiple blood transfusions, and hemodialysis patients (7). We found seroreactivity to HGV/GBV-C in 15.5% of healthy blood donors and an increased prevalence of 28 to 53% in individuals with risk factors. Due to this high seroprevalence in healthy blood donors, we assumed that other important transmission routes besides blood must exist. To address this issue we used our antibody assay to examine whether the age-dependent distribution of HGV/GBV-C seroprevalence provides further information about possible transmission routes. Therefore, we surveyed the HGV/GBV-C seroprevalence according to age in 446 healthy individuals without any risk factors for parenteral viral transmission.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Patients. Only healthy individuals who had no risk factors for parenteral viral transmission according to an anamnestic questionnaire were included in this study. They consisted of blood donors, vaccination candidates (German measles, measles, epidemic parotitis, hepatitis A virus, and hepatitis B virus [HBV]), and routinely screened medical staff. Individuals with risk factors, like intravenous drug addiction, hemophilia, a history of blood transfusion, or hemodialysis, were excluded. The study was performed with written consent of the local ethics committee. Sera were drawn from 446 healthy individuals; 274 were male and 172 were female, and the median age was 31 years. They tested negative for HBV surface antigen and were negative by antibody detection tests for HBV core antigen, hepatitis C virus, and human immunodeficiency virus infection. Anamnestically, they had no clinical or biochemical signs of hepatitis when sera were drawn; alanine aminotransferase levels were measured and were <30 U/liter.

These individuals were divided into seven groups according to their age.

HGV/GBV-C PCR. The HGV/GBV-C PCR was performed as described previously (5). Briefly, after RT a nested PCR with primer pairs for the viral 5' noncoding and NS3 regions were used for amplification. The amplification products were separated by electrophoresis in 2% NuSieve 3:1 agarose (FMC, Rockland, Maine) and were blotted onto a positively charged nylon membrane. After hybridization to a radioactively labeled HGV/GBV-C-specific oligonucleotide, membranes were exposed to Kodak X-Omat-AR films for 3 h. To avoid cross-contamination, PCR was performed under stringent conditions (3, 14).

Recombinant HGV/GBV-C proteins. For our new recombinant HGV/GBV-C SIA four regions of HGV/GBV-C were amplified under standard conditions by RT-PCR with sera from HGV/GBV-C PCR-positive German patients (7). For the putative HGV/GBV-C envelope 1 region, the following primer pair was used: c6 (5'-CACGAATTCATGGGGCCACCCAGC; nucleotide position [np] 469 to 483, according to a recently published sequence [17]; GenBank accession no. HGU44402) and E1 (5'-TATAAGCTTACAGGGCGCACAACAGTT; np 662 to 648). For the envelope 2 region, primers E22 (5'-CGCGAATTCATGGCGGGCATGTCG; np 1143 to 1157) and H54 (5'-ATGAAGCTTACTCGGGCCAGCAGTCCCT; np 1673 to 1656) were used. For the N-terminal region of NS3, primers N72 (5'GCGGAATTCCTGGAGTGGGAC; np 3042 to 3053) and N76 (5'-TCTAAGCTTACCATGCCCATA; np 4288 to 4278) were used. For the C-terminal region of NS3 and the N-terminal region of NS4, primers G2 (5'-CTCGAATTCATGCGGACCGG; np 4305 to 4315) and G8 (5'-TCTAAGCTTAATGTCGTCAACTATGTG; np 5069 to 5055) were used. The amplification products were cloned into pTrxFus expression vector (Invitrogen, NV Leek, The Netherlands). To confirm the sequences of the amplification products, the nucleotide sequences were determined from both ends with the Sequenase, version 2.0, sequencing kit (United States Biochemicals, Cleveland, Ohio). After transformation into E. coli GI724 (Invitrogen), expression was induced, and the HGV/GBV-C fusion proteins were separated from bacterial proteins by affinity chromatography as described previously (7). The four soluble HGV/GBV-C fusion proteins and, as an internal control, different concentrations of human immunoglobulin G (IgG) from an HCV- and HGV/GBV-C-negative standard serum (Behring, Marburg, Germany) and E. coli thioredoxin protein lacking HGV/GBV-C fusion proteins were fixed on polyvinylidene difluoride membranes (Millipore, Eschborn, Germany). An immunoblot assay was performed as described previously (7). All sera were tested three times by the HGV/GBV-C immunoblot assay with different batches of blot strips.

In analogy to HCV immunoblotting, the HGV/GBV-C blot pattern was considered positive when antibodies against at least two recombinant proteins were detectable. If seroreactivity to only one recombinant protein was present, the HGV/GBV-C SIA results were rated indeterminate.

Statistics. For statistical analysis Fisher's exact test was used.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The seroprevalence of HGV/GBV-C in 446 healthy individuals without risk factors for parenteral viral transmission and without clinical or biochemical signs of hepatitis was determined by a new four-antigen HGV/GBV-C SIA. Of these individuals, 80 (17.9%) had antibodies to HGV/GBV-C by the immunoblot assay; 51 were male, and 29 were female. The 446 individuals were divided into seven groups according to age. Five (5.6%) of 89 children between 2 and 14 years of age were positive by the HGV/GBV-C SIA (Fig. 1). These five children were 7 to 11 years old. Six (15.3%; P = 0.09) of 39 individuals between 15 and 20 years of age were seroreactive; 1 was 18 years old, 3 were 19 years old, and 2 were 20 years old. Furthermore, 13 (16.7%; P = 0.03) of 78 individuals between 21 and 30 years of age, 19 (19.2%; P = 0.01) of 99 patients between 31 and 40 years of age, 14 (26.4%; P = 0.002) of 53 patients between 41 and 50 years of age, 12 (25.5%; P = 0.004) of 47 individuals between 51 and 60 years of age, and 11 (26.8%; P = 0.004) of 41 individuals older than 60 years of age tested positive for HGV/GBV-C antibodies.


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1.   Seroprevalence of HGV/GBV-C in healthy individuals. The 446 volunteers were divided into seven groups according to age. They had no risk factors for parenteral viral transmission. The numbers of individuals and P values (Fisher's exact test) are indicated for each group.

Different patterns of seroreactivity were found by the HGV/GBV-C SIA, as shown in Table 1. The sera of 36 (45.0%) individuals had reactivity against four recombinant HGV/GBV-C proteins, the sera of 28 (35.0%) had reactivity against three proteins, and the sera of 16 (20.0%) had reactivity against two proteins. For sera from five individuals (6.2%) an indeterminate HGV/GBV-C SIA result was found because reactivity only against the recombinant HGV/GBV-C env2 protein was detectable. No other serum specimen drawn before or after was available for examination of the antibody response in the further course of the infection. Of the sera from 80 HGV/GBV-C SIA-positive individuals, 78 (97.5%) showed reactivity to HGV/GBV-C env2 protein, the sera of 75 (93.8%) had reactivity to the NS3-C/NS4 protein, the sera of 60 (75.0%) had reactivity to the NS3-N protein, and the sera of 47 (58.8%) had reactivity to the env1 protein (Table 1).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Frequency of antibody response patterns in sera from 80 individuals testing positive by HGV/GBV-C SIA

All 80 individuals positive by HGV/GBV-C SIA and the 5 individuals with indeterminate HGV/GBV-C SIA results were negative for detectable HGV/GBV-C viremia by PCR.

In addition, we were able to observe HGV/GBV-C seroconversion in five individuals. They had persistent HGV/GBV-C viremia with no detectable antibody response over 3 to 5 years. When seroconversion occurred, the primary antibodies were directed against the env2 region, followed by antibodies to the NS3-C/NS4 and NS3-N regions. Over a short period, 3 to 8 weeks, HGV/GBV-C viremia and antibodies were present simultaneously. Then, detectable HGV/GBV-C viremia disappeared and only antibodies to HGV/GBV-C were found during follow-up. The reappearance of viremia was never observed.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Seroepidemiological studies for HGV/GBV-C infection have been hampered by the lack of commercially available assays. Until now, only a few data on the seroprevalence in the general population were available. Using a four-antigen recombinant HGV/GBV-C SIA, we found a high prevalence of seroreactivity to HGV/GBV-C in the general population (Fig. 1). Seroprevalence rates were low in children (5.6%) and started to increase among teenagers and adults (15.3 to 26.8%). These findings correspond well with two recently published studies (11, 15). There was no significant difference with regard to seroreactivity in male subjects (51 of 274; 18.6%) compared to that in female subjects (29 of 172; 16.9%).

Neither a disease caused by HGV/GBV-C nor its transmission routes have yet been identified. Transmission by blood or blood products has been shown to be one efficient route of HGV/GBV-C transmission (17, 20, 24). In the present study, we investigated sera from a collection of 446 individuals who neither had received blood products nor had other risk factors for parenteral viral transmission. Therefore, besides blood other routes of HGV/GBV-C transmission must exist. In our collection of individuals the most probable means of HGV/GBV-C transmission was the vertical, sexual, or household route or was by droplet infection.

Vertical transmission of HGV/GBV-C occurs at a high rate (>30%) (4). However, we cannot conclude from this cross-sectional study that the five children who tested positive by HGV/GBV-C SIA were infected by their mothers during pregnancy. In individuals between 15 and 20 years of age there was a sharp but not significant (P = 0.099) increase in the seroprevalence of HGV/GBV-C compared to that in the group of younger children (Fig. 1). The six individuals who tested positive by the HGV/GBV-C SIA were 18 (n = 1), 19 (n = 3), and 20 (n = 2) years old. On inquiry, it was learned that these individuals had had sexual experiences for some years. Among the individuals older than 50 years of age we observed no increase in HGV/GBV-C seroprevalence compared to that among the younger adults. There are numerous examples of viruses whose prevalences in the population rise with age. The increase in the seroprevalence of HGV/GBV-C in the group of individuals who are assumed to be the most sexually active may indicate sexual transmission of HGV/GBV-C. Indeed, the HGV/GBV-C seroprevalence profile resembles that of herpes simplex virus type 2, a sexually transmitted virus infecting 20 to 30% of adults (9). Therefore, sexual HGV/GBV-C transmission may be one route in adult individuals. This assumption is supported by other studies which found a high prevalence of detectable HGV/GBV-C viremia in prostitutes (8, 12, 19, 22).

HGV/GBV-C transmission by droplets seems to be unlikely, because the seroprevalence profile did not resemble that of viruses known to be transmitted by droplets (10). In addition, we were not able to find HGV/GBV-C RNA in the saliva of viremic individuals, in contrast to another investigation (2, 7). Furthermore, household contacts could be another potential mechanism for virus transmission. However, 58 children who were not vertically infected with HGV/GBV-C and who were in close contact with their viral RNA-positive mothers did not acquire the virus over a 3-year period (4). Therefore, transmission via household contacts seems to be a rare event. Two recently published studies introduced serological tests consisting of a single antigen from HGV/GBV-C env2 (18, 23). The results of those studies differed from those of the present study in terms of seroprevalence in volunteer blood donors, with rates of 3.4 and 9%, respectively. This lower seroprevalence may be due to the fact that the recombinant proteins were expressed in different systems. The small number of subjects included in those studies may also limit the significance of the results. However, further studies will have to reveal the differences in the rates of seroprevalence when sera are tested in parallel by different HGV/GBV-C antibody assays. Consistent with those studies, we found no simultaneous appearance of viremia and antibodies to HGV/GBV-C in the group of healthy individuals. Therefore, the development of an antibody response seems to be associated with the clearance of viremia. This hypothesis is supported by five longitudinal courses in which we were able to follow seroconversion during HGV/GBV-C infection. Therefore, we conclude from our cross-sectional and longitudinal data that especially the env2 protein, which is located on the surface of the virus, seems to be an important target for the immune response and, in the end, for viral clearance.


    ACKNOWLEDGMENT

This study was supported by the Förderverein der Deutschen Vereinigung zur Bekämpfung von Viruskrankheiten.


    FOOTNOTES

* Corresponding author. Mailing address: Institute of Medical Microbiology and Immunology, UKE, Martinistr. 52, 20246 Hamburg, Germany. Phone: 49-40-47173159. Fax: 49-40-47174062. E-mail: feucht{at}uke.uni-hamburg.de.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Alter, M. J., M. Gallagher, T. T. Morris, L. A. Moyer, E. L. Meeks, K. Krawczynski, J. P. Kim, and H. S. Margolis. 1997. Acute non-A-E hepatitis in the United States and the role of hepatitis G virus infection. N. Engl. J. Med. 336:741-746[Abstract/Free Full Text].
2. Chen, M., A. Sonnerborg, B. Johannson, and M. Sallberg. 1997. Detection of hepatitis G virus (GB virus C) RNA in human saliva. J. Clin. Microbiol. 35:973-975[Abstract].
3. Feucht, H. H., B. Zöllner, and R. Laufs. 1995. Comparison of conventional autoradiography with a new DNA enzyme immunoassay for the detection of hepatitis C virus-polymerase chain reaction amplification products. J. Virol. Methods 55:105-110[Medline].
4. Feucht, H. H., B. Zöllner, S. Polywka, and R. Laufs. 1996. Vertical transmission of hepatitis G virus. Lancet 347:615-616[Medline].
5. Feucht, H. H., L. Fischer, M. Sterneck, C. E. Broelsch, and R. Laufs. 1997. GB virus C transmission by blood products. Lancet 349:435[Medline].
6. Feucht, H. H., B. Zöllner, S. Polywka, B. Knödler, M. Schröter, H. Nolte, and R. Laufs. 1997. Prevalence of hepatitis G viremia among healthy subjects, individuals with liver disease, and persons at risk for parenteral transmission. J. Clin. Microbiol. 35:767-768[Abstract].
7. Feucht, H. H., B. Zöllner, S. Polywka, B. Knödler, M. Schröter, H. Nolte, and R. Laufs. 1997. Distribution of hepatitis G viremia and antibody response to recombinant proteins with special regard to risk factors in 709 patients. Hepatology 26:491-494[Medline].
8. Fiordalisi, G., A. Bettinardi, I. Zanella, R. Stellini, G. Paraninfo, G. Cadeo, and D. Primi. 1997. Parenteral and sexual transmission of GB virus C and hepatitis C virus among human immunodeficiency virus-positive patients. J. Infect. Dis. 175:1025-1026[Medline].
9. Fleming, D. T., G. M. McQuillan, R. E. Johnson, A. J. Nahmias, S. O. Aral, F. K. Lee, and M. E. St. Louis. 1997. Herpes simplex virus type 2 in the United States 1976 to 1994. N. Engl. J. Med. 337:1105-1111[Abstract/Free Full Text].
10. Gil, A., A. Gonzales, R. Dal-Re, P. Ortega, and V. Dominguez. 1998. Prevalence of antibodies against varicella zoster, herpes simplex (types 1 and 2), hepatitis B and hepatitis A viruses among Spanish adolescents. J. Infect. 36:53-56[Medline].
11. Hyland, C. A., L. Mison, N. Solomon, J. Cockerill, L. Wang, J. Hunt, L. A. Selvey, J. Faoagali, W. G. Cooksley, I. F. Young, R. Trowbridge, I. Borthwick, and E. J. Gowans. 1998. Exposure to GB virus type C or hepatitis G virus in selected Australian adult and children populations. Transfusion 38:821-827[Medline].
12. Ibanez, A., M. Gimenez-Barcons, A. Tajahuerce, C. Tural, G. Sierra, B. Clotet, J. M. Sancjez-Tapias, J. Rodes, M. A. Martinez, and J. C. Saiz. 1998. Prevalence and genotypes of GB virus C/hepatitis G virus (GBV-C/HGV) and hepatitis C virus among patients infected with human immunodeficiency virus: evidence for GBV-C/HGV sexual transmission. J. Med. Virol. 55:293-299[Medline].
13. Jarvis, L. M., F. Davidson, J. P. Hanley, P. L. Yap, C. A. Ludlam, and P. Simmonds. 1996. Infection with hepatitis G virus among recipients of plasma products. Lancet 348:1352-1355[Medline].
14. Kwok, S., and R. Higuchi. 1989. Avoiding false positives with PCR. Nature 339:237-238[Medline].
15. Lampe, E., F. L. Saback, S. Viazov, M. Roggendorf, and C. Niel. 1998. Age specific prevalence and genetic diversity of GBV-C/hepatitis G virus in Brazil. J. Med. Virol. 56:39-43[Medline].
16. Leary, T. P., A. S. Muerhoff, J. N. Simons, T. J. Pilot-Matias, J. C. Erker, M. L. Chalmers, G. G. Schlauder, G. J. Dawson, S. M. Desai, and I. K. Mushahwar. 1996. Sequence and genomic organization of GBV-C, a novel member of the flaviviridae associated with human non-A-E hepatitis. J. Med. Virol. 48:60-67[Medline].
17. Linnen, J., J. Wages, Z. Y. Zhang-Keck, K. E. Fry, K. Z. Krawczynski, H. Alter, E. Koonin, M. Gallagher, M. Alter, S. Hadziyannis, P. Karayiannis, K. Fung, Y. Nakatsuji, J. W. Shih, L. Young, M. Piatak, Jr., C. Hoover, J. Fernandez, S. Chen, J. C. Zou, T. Morris, K. C. Hyams, S. Ismay, J. D. Lifson, and J. P. Kim. 1996. Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 271:505-508[Abstract].
18. Pilot-Matias, T. J., R. J. Carrick, P. F. Coleman, T. P. Leary, T. K. Surowy, J. N. Simons, A. S. Muerhoff, S. L. Buijk, M. L. Chalmers, G. J. Dawson, S. M. Desai, and I. K. Mushahwar. 1996. Expression of the GB virus C E2 glycoprotein using the Semliki Forest virus vector system and its utility as a serologic marker. Virology 225:282-292[Medline].
19. Scallan, M. F., D. Clutterbuck, L. M. Jarvis, G. R. Scott, and P. Simmonds. 1998. Sexual transmission of GB virus C/hepatitis G virus. J. Med. Virol. 55:203-208[Medline].
20. Schmidt, B., K. Korn, and B. Fleckenstein. 1996. Molecular evidence for transmission of hepatitis G virus by blood transfusion. Lancet 347:909[Medline].
21. Simons, J. N., T. P. Leary, G. J. Dawson, T. J. Pilot-Matias, G. G. Schlauder, S. M. Desai, and I. K. Mushahwar. 1995. Isolation of novel virus-like sequences associated with human hepatitis. Nat. Med. 1:564-569[Medline].
22. Stark, K., U. Bienzle, G. Hess, A. M. Engel, B. Hegenscheid, and V. Schlüter. 1996. Detection of the hepatitis G virus genome among injecting drug users, homosexual and bisexual men, and blood donors. J. Infect. Dis. 174:1320-1323[Medline].
23. Tacke, M., K. Kiyosawa, K. Stark, V. Schlueter, B. Ofenloch-Haehnle, G. Hess, and A. M. Engel. 1997. Detection of antibodies to a putative hepatitis G virus envelope protein. Lancet 349:318-320[Medline].
24. Wang, J. T., P. J. Chen, D. P. Liu, J. C. Sheu, T. H. Wang, and D. S. Chen. 1998. Prevalence and infectivity of hepatitis G virus and its strain variant, the GB agent, in volunteer blood donors in Taiwan. Transfusion 38:290-295[Medline].


Journal of Clinical Microbiology, May 1999, p. 1294-1297, Vol. 37, No. 5
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Feucht, H.-H.
Right arrow Articles by Laufs, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feucht, H.-H.
Right arrow Articles by Laufs, R.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
Antimicrob. Agents Chemother. Clin. Microbiol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS