This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moissenet, D.
Right arrow Articles by Vu-Thien, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moissenet, D.
Right arrow Articles by Vu-Thien, H.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, June 1999, p. 1777-1781, Vol. 37, No. 6
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.

CDC Group IV c-2: a New Ralstonia Species Close to Ralstonia eutropha

Didier Moissenet,1 Christophe P. Goujon,2 Antoine Garbarg-Chenon,1 and Hoang Vu-Thien1,*

Service de Microbiologie, Hôpital d'Enfants Armand-Trousseau,1 and Service de Microbiologie, ISARS, Hôpital Rothschild,2 Paris, France

Received 3 November 1998/Returned for modification 14 January 1999/Accepted 22 February 1999


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

CDC group IV c-2, an environmental gram-negative bacillus recently proposed for inclusion in the genus Ralstonia, has been isolated in several human infections. Biochemical characterization and 16S ribosomal DNA (rDNA) sequencing with phylogenetic analysis were used to characterize eight clinical isolates and four type strains. Other typing tools, such as pulsed-field gel electrophoresis (PFGE) and randomly amplified polymorphic DNA (RAPD) analysis, were also used. PFGE typing of clinical isolates was unsuccessful because the DNA was degraded, and RAPD analysis was poorly discriminatory. In contrast, the type strains were clearly distinguished with both PFGE and RAPD analysis. All of the 16S rDNA sequences were identical. Comparison of the 16S rDNA sequences to the GenBank sequences showed that they were consistent with CDC group IV c-2 belonging to the genus Ralstonia. The closest matches were obtained with Ralstonia eutropha. However, four differences in 32 biochemical tests separated R. eutropha from CDC group IV c-2, which suggests that CDC group IV c-2 is a new species of the genus Ralstonia.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

CDC group IV c-2 (C IV-2) is an environmental gram-negative bacillus recently proposed for inclusion in the genus Ralstonia (17). Although rarely isolated from clinical specimens, it is commonly isolated from hospital pool water (5), water from ultrafiltration systems (16), and bottled mineral water (13). We have previously reviewed all published cases of human C IV-2 infections (15). Three other cases of bacteremia have recently been reported (3, 4, 18). Despite the low pathogenicity of C IV-2, its ability to cause serious infections in immunocompromised patients warrants consideration.

In 1996, we reported five cases of nosocomial catheter-related bacteremia at our children's hospital (15). Epidemiological investigation of these clinical isolates, using the randomly amplified polymorphic DNA (RAPD) technique, suggested that all the patients were infected with the same strain, but the source of the outbreak could not be determined. Another six clinical isolates were later collected from four hospitals in the Paris area.

At present, C IV-2 can be identified more or less reliably by biochemical identification procedures. Taxonomically, it was recently linked to the genus Ralstonia (17). In order to investigate the clonality of clinical isolates from different French hospitals and to assess similarity to Ralstonia eutropha strains we studied eight clinical isolates and four type strains by pulsed-field gel electrophoresis (PFGE), RAPD and 16S ribosomal DNA (rDNA) phylogenetic analysis, and biochemical characterization.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Bacterial strains. Eight C IV-2 clinical isolates derived from blood cultures were studied: two from Armand-Trousseau Hospital, one from Antoine-Béclère Hospital, one from Paul Brousse Hospital, one from Saint Vincent-de-Paul Hospital, and three from Saint-Antoine Hospital; all of the hospitals are located in the Paris area. We also studied R. eutropha ATCC 17697 and four C IV-2 type strains obtained from the Centers for Disease Control and Prevention (CDC): F4862 (Maine, 1983), G608 and G3900 (Colorado, 1987 and 1989, respectively), and G6817 (Argentina, 1991).

PFGE and RAPD analysis. PFGE was performed as previously described (21). After digestion with XbaI, DNA fragments were separated in a 1% agarose gel by electrophoresis, using the CHEF DR III system (Bio-Rad, Ivry, France) with the switch time ramped from 5 to 20 s over an 18-h period at 220 V and 14°C. For C IV-2 clinical isolates, DNase activity in the PFGE technique was inhibited by formaldehyde fixation as described by Gibson et al. (9).

RAPD analysis was performed as previously described (15) with the three primers 5'-TCACGATGCA-3' (AP3), 5'-GCCCCCAGGGGCACAGT-3' (217d2), and 5'-TTATGTAAAACGACGGCCAGT-3' (M13 [universal primer]). Three other primers were also tested: GGAAACAGCTATGACCATG (M13 reverse), GCAATTAACCCTCACTAAAG (T3), and GTAATACGACTCACTATAG (T7). Strains were considered different from one another if their patterns differed by one prominent band in three repeated experiments; small differences in the intensity of major bands and the loss of weak bands were ignored.

Biochemical characterization was based on 32 metabolic assimilation tests with the ID-32-GN system (bioMérieux, Marcy-l'Etoile, France), used according to the manufacturer's instructions. Test strips were read after 24 h of incubation at 30°C; when identification confidence was below 90%, the strips were reincubated for a further 24 h (2). Other characteristics, such as gram stain morphology, motility, growth at different temperatures, and catalase and oxidase activities, were determined by standard methods.

Susceptibility testing was performed by the disk diffusion method (15).

PCR and rRNA gene sequencing. The sequences of the entire rRNA genes (approximately 1,500 nucleotides) were amplified by PCR with the primers reported by Tee et al. (20). Full-length products were sequenced directly with terminal and internal primers specific for 16S rDNA (Table 1). Both strands were sequenced. For PCR, 100-µl reaction mixtures containing 10 µl (approximately 100 ng) of chromosomal DNA, 50 pmol of each of the primers (27f and 1525r), 0.2 mM concentration of each deoxynucleoside triphosphate, 1× Taq DNA polymerase buffer, and 2 U of Taq DNA polymerase (Boehringer, Mannheim, Germany) were used. Negative controls, containing all the PCR components except the template, were always used. The PCR product was analyzed on a 1% agarose gel; after Southern blotting, the specificity of the approximately 1.5-kb double-stranded DNA band was controlled with a probe of a 16S gene conserved region, cold labelled in the presence of digoxigenin-11-dUTP (Boehringer). DNA sequencing of purified PCR products was done at Euro Sequence Genes Service (Evry, France) on an ABI 377 sequencer by using the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction kit with AmpliTaq DNA polymerase (Perkin-Elmer, Foster City, Calif.).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Oligonucleotide primers used for amplification and sequencing of 16S rRNA genes of C IV-2

rDNA sequence alignment and phylogenetic tree construction. Sequences similar to clinical isolate sequences were extracted from GenBank by using BLAST (1). A BLAST search was also run on sequence fragments (nucleotides 300 to 700, 700 to 1100, and 1100 to 1400). All sequences with significant similarity (11) in any search were included for comparison; a search was also performed in the Ribosomal Database Project (12). Partially documented sequences (of less than 950 nucleotides) were excluded. The final analysis included only relevant sequences.

Sequence alignments were done with CLUSTAL W 1.61 (10) and improved by hand. Neighbor joining, maximum-parsimony, and maximum-likelihood reconstruction were done with PHYLIP, version 3.572 (7). Puzzle, version 4.0 (19), was used for quartet likelihood reconstruction and phylogenic-content assessment. Node support was assessed by bootstrap resampling for neighbor joining trees (10,000 resamplings) and parsimony trees (5,000 resamplings) (6).

Nucleotide sequence accession number. The rRNA gene sequence has been registered with the GenBank database under accession no. AF098288.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

PFGE typing of C IV-2 clinical isolates was not possible because the DNA was directly degraded during the standard extraction procedure. This problem persisted after formaldehyde treatment, which should have inhibited DNase activity. Conversely, none of the four type strains exhibited DNA degradation, and all had quite different PFGE patterns (Fig. 1).


View larger version (97K):
[in this window]
[in a new window]
 
FIG. 1.   XbaI PFGE patterns of four C IV-2 type strains and eight C IV-2 clinical isolates. Phage lambda DNA was used as a size ladder. Lanes 1 through 4, type strains G6817, G3900, G608, and F; lane 5, Armand-Trousseau Hospital isolate; lane 6, Antoine-Béclère Hospital isolate; lane 7, Paul Brousse Hospital isolate; lane 8, Saint Vincent-de-Paul Hospital isolate; lane 9, Saint-Antoine Hospital isolate. The four type strains showed four different patterns. In contrast, no pattern was obtained for the clinical isolates, probably because of DNase produced by these strains.

RAPD analysis with the AP3, 217d2, universal M13, T3, and M13 reverse primers produced identical banding patterns for seven of the eight C IV-2 clinical isolates, while one isolate showed a slightly different pattern. Conversely, whatever primer was used, the four type strains showed four different patterns, which were also distinct from those of the clinical isolates (Fig. 2). No strains were successfully typed with primer T7. The RAPD analysis pattern of R. eutropha ATCC 17697 was different from the C IV-2 patterns (data not shown).


View larger version (73K):
[in this window]
[in a new window]
 
FIG. 2.   RAPD patterns with primer AP3 (I) and the universal primer M13 (II). Lanes 1 through 4, type strains G6817, G3900, G608, and F; lanes 5 and 6, Armand-Trousseau Hospital isolates; lane 7, Antoine-Béclère Hospital isolate; lane 8, Paul Brousse Hospital isolate; lane 9, Saint Vincent-de-Paul Hospital isolate; lanes 10 through 12, Saint-Antoine Hospital isolates. The four type strains showed four different patterns. Seven of the eight clinical isolates had identical banding patterns; only one isolate (lane 10) showed a slightly different pattern. Lanes M, molecular size markers; sizes are in base pairs.

The biochemical patterns were similar for all C IV-2 strains (clinical isolates and type strains). After 48 h of incubation, all of the ID-32-GN patterns were obtained with a confidence level of 99.9%. Conversely, the results for C IV-2 in 4 of the 32 assimilation tests (3-hydroxy-benzoate, 2-keto-gluconate, malonate, and 4-hydroxy-benzoate) were consistently discordant with those for R. eutropha ATCC 17697 (Table 2). This strain was wrongly identified as Comamonas acidovorans, with a low degree of confidence, because the species R. eutropha is not yet present in the ID-32-GN database. Both R. eutropha and the C IV-2 strains were positive for motility, catalase and oxidase activities, and growth at 37 and 41°C (22).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Biochemical features of R. eutropha ATCC 17697 and IV-2 isolates, determined by the ID-32-GN system

Moreover, R. eutropha and the C IV-2 strains all showed the same susceptibility pattern (susceptibility to ticarcillin-clavulanate, piperacillin, cefotaxime, imipenem, trimethoprim-sulfamethoxazole, ciprofloxacin and colistin; intermediate susceptibility to ticarcillin and ceftazidime; and resistance to aztreonam, gentamicin, netilmicin, tobramycin, and amikacin).

All clinical isolates and type strains had identical 16S rDNA sequences (FRA01). Moreover, this sequence was identical to the recently published sequence AF067657 (17). When screening databases (GenBank and the Ribosomal Database Project), the closest matches were observed with R. eutropha strains. Similarity rates ranged from 97% (R. eutropha IAM12368) to 98.9% (R. eutropha strain with the AF027407 sequence), and the rate was 97.8% with the reference strain, R. eutropha ATCC 17697 (Table 3). Within the species R. eutropha, similarity rates ranged from 95.3 to 99.1%. Phylogenetic reconstruction by the neighbor-joining, maximum-parsimony, maximum-likelihood, and quartet-puzzling methods were congruent (Fig. 3). All strongly supported the notion that C IV-2 belongs to the R. eutropha species, as shown by the extremely high support value for the R. eutropha cluster.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Levels of 16S rDNA sequence similarity among R. eutropha sequences and C IV-2 sequencesa


View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3.   Unrooted tree reconstruction based on 979 bases of the 16S rDNA sequences of 24 bacteria. FRA01, sequence of clinical isolates and type strains. JHH, sequence obtained by Osterhout et al. (17). Trees shown were obtained by neighbor joining. Parsimony, maximum-likelihood, and quartet-puzzling methods yielded very similar topologies. Support for clades was evaluated by bootstrap resampling (10,000 times). Radial representation (a) accounts for the distance between strains, expressed as the expected number of substitutions per site. Relevant cluster support values are indicated on the cladogram (b). Sequences obtained from C IV-2 isolates cluster strongly with sequences obtained from R. eutropha strains.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

C IV-2 is an opportunistic pathogen which can cause serious infections, especially in immunocompromised patients (3, 4, 15, 18), and it is important to identify the organism readily and reliably in the clinical laboratory. In 1995, an unusual cluster of C IV-2 infections was observed in our hospitals and led us to conduct an epidemiological investigation based on the RAPD method (15). This study, which included several type strains obtained from the CDC, was then extended to other clinical isolates from different Parisian hospitals and was complemented with PFGE experiments.

Due to DNA degradation probably caused by strong DNase activity, PFGE was unsuccessful in typing the French clinical isolates, whereas no such problem was encountered with the type strains, which were markedly distinct. RAPD analysis was also clearly discriminatory for the type strains, although it performed poorly with the clinical isolates, despite the use of six primers. In contrast, all the C IV-2 strains had identical biochemical patterns and similar drug susceptibility profiles. These results indicate that the Parisian outbreak of C IV-2 infections probably originated from a single strain distinct from those found in the United States.

We show here that the ID-32-GN identification system provides a simple, rapid, and reliable means of identifying C IV-2 with a high degree of confidence (99.9%). In contrast with previous studies, it dispenses with sophisticated complementary analyses, such as cellular fatty acid composition and 16S rRNA sequencing (17), and does not lead to the spurious identification of Bordetella bronchiseptica, Alcaligenes xylosoxidans, or Oligella ureolytica (3).

In order to clarify the taxonomic position of C IV-2, we used sequencing of 16S rDNA, which has been shown to be a reliable and stable method of classifying bacteria (14). Despite the wide geographical range of their origins, all eight French clinical isolates and all four type strains obtained from the CDC had identical 16S rDNA sequences. In accordance with the results of Osterhout et al. (17), our results show that the closest matches for C IV-2 all belong to the R. eutropha (formerly Alcaligenes eutropha) species. However, our phylogenetic analyses do not suggest a "close but distinct relationship" (17) but instead strongly favor the notion that C IV-2 belongs to the species R. eutropha.

We also show that the sequences of R. eutropha strains available from GenBank are quite heterogeneous, with pairwise similarity scores as low as 95.3%, whereas the commonly accepted threshold for strains of the same species is 98% (20). This demonstrates that assignment to a species based on sequencing should not rely only on similarity scores but should also take phylogenetic analysis into account.

It has been shown, however, that classification by 16S rDNA phylogeny can be discordant with other classification methods (8, 14). French C IV-2 isolates consistently diverged from R. eutropha in four assimilation tests. On those grounds, we conclude that, in spite of the 16S rDNA phylogeny results, C IV-2 is a member of a new species of the genus Ralstonia.

The genus Ralstonia was proposed in honor of the American bacteriologist E. Ralston, who first described Pseudomonas pickettii and suggested a taxonomic relationship to Pseudomonas solanacearum on the basis of DNA homology. These two species were then named Burkholderia pickettii and Burkholderia solanacearum. In 1995, Yabuuchi et al. (23) proposed the transfer of B. pickettii, B. solanacearum, and A. eutropha to the new genus Ralstonia on the basis of phenotypic characterization, cellular lipid and fatty acid analysis, rRNA-DNA hybridization, and phylogenetic analysis of 16S rDNA nucleotide sequences.

16S rRNA gene sequence analysis for bacterial characterization has improved bacterial taxonomy and can be used to identify new species. Phylogenetic analysis places C IV-2 strains in the genus Ralstonia, probably as a new species. Other tests, such as cellular lipid analysis, DNA-DNA hybridization, or the determination of the G+C content (in moles percent), could confirm our data.


    ACKNOWLEDGMENTS

We thank Frédéric Barbut (Saint-Antoine Hospital), Danièle Mathieu (Paul Brousse Hospital), Patrice Nordmann (Antoine-Béclère Hospital), and Josette Raymond (Saint Vincent-de-Paul Hospital) for providing us with C IV-2 isolates.


    FOOTNOTES

* Corresponding author. Mailing address: Service de Microbiologie, Hôpital d'Enfants Armand-Trousseau, 26, Av. du Dr. A. Netter, 75012 Paris, France. Phone: 33 (1) 44 73 61 43. Fax: 33 (1) 44 73 62 88. E-mail: hoang.vuthien{at}trs.ap-hop-paris.fr.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410[Medline].
2. Altwegg, M., and J. Zollinger-Iten. 1987. Identification of Enterobacteriaceae, Aeromonas spp. and Plesiomonas shigelloides with the ATB 32-GN system. J. Microbiol. Methods 7:103-109.
3. Anderson, R. R., P. Warnick, and P. C. Schreckenberger. 1997. Recurrent CDC group IVc-2 bacteremia in a human with AIDS. J. Clin. Microbiol. 35:780-782[Abstract].
4. Arance, A., A. Montes, M. Cismal, R. Mesia, C. Falo, J. Garcia del Muro, and J. R. Germa. 1997. CDC group IV c-2 infection in a stem cell transplant recipient. Bone Marrow Transplant. 11:1005-1006.
5. Aspinall, S. T., and R. Graham. 1989. Two sources of contamination of a hydrotherapy pool by environmental organisms. J. Hosp. Infect. 14:285-292[Medline].
6. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using bootstrap. Evolution 39:783-791.
7. Felsenstein, J. 1989. PHYLIP---Phylogeny Inference Package. Cladistics 5:164-166.
8. Fox, G. E., J. D. Wisotzkey, and P. Jurtshuk, Jr. 1992. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity. Int. J. Syst. Bacteriol. 42:166-170[Abstract/Free Full Text].
9. Gibson, J. R., K. Sutherland, and R. J. Owen. 1994. Inhibition of DNAse activity in PFGE analysis of DNA from Campylobacter jejuni. Lett. Appl. Microbiol. 19:357-358[Medline].
10. Higgins, D. G., A. J. Bleasby, and R. Fuchs. 1992. CLUSTAL V: improved software for multiple sequence alignment. Comput. Appl. Biosci. 8:189-191[Abstract/Free Full Text].
11. Karlin, S., and S. F. Altschul. 1990. Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc. Natl. Acad. Sci. USA 87:2264-2268[Abstract/Free Full Text].
12. Maidak, B. L., N. Larsen, M. J. McCaughey, R. Overbeek, G. J. Olsen, K. Fogel, J. Blandy, and C. R. Woese. 1994. The Ribosomal Database Project. Nucleic Acids Res. 22:3485-3487[Abstract/Free Full Text].
13. Manaia, C. M., O. C. Nunes, P. V. Morais, and M. S. da Costa. 1990. Heterotrophic plate counts and the isolation of bacteria from mineral waters on selective and enrichment media. J. Appl. Bacteriol. 69:871-876[Medline].
14. Martinez-Murcia, A. J., S. Benlloch, and M. D. Collins. 1992. Phylogenetic interrelationships of members of the genera Aeromonas and Plesiomonas as determined by 16S ribosomal DNA sequencing: lack of congruence with results of DNA-DNA hybridizations. Int. J. Syst. Bacteriol. 42:412-421[Abstract/Free Full Text].
15. Moissenet, D., M.-D. Tabone, J.-P. Girardet, G. Leverger, A. Garbarg-Chenon, and H. Vu-Thien. 1996. Nosocomial CDC group IV c-2 bacteremia: epidemiological investigation by randomly amplified polymorphic DNA analysis. J. Clin. Microbiol. 34:1264-1266[Abstract].
16. Oie, S., M. Oomaki, K. Yorioka, T. Tatsumi, M. Amasaki, T. Fukuda, H. Hakuno, K. Nagano, M. Matsuda, N. Hirata, N. Miyano, and A. Kamiya. 1998. Microbial contamination of 'sterile water' used in Japanese hospitals. J. Hosp. Infect. 38:61-65[Medline].
17. Osterhout, G. J., J. L. Valentine, and J. D. Dick. 1998. Phenotypic and genotypic characterization of clinical strains of CDC group IVc-2. J. Clin. Microbiol. 36:2618-2622[Abstract/Free Full Text].
18. Salar, A., J. Carratala, A. Zurita, E. Gonzalez-Barca, and A. Granena. 1998. Bacteremia caused by CDC group IV c-2 in a patient with acute leukemia. Haematologica 7:670-672.
19. Strimmer, K., and A. von Haeseler. 1996. Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol. Biol. Evol. 13:964-969.
20. Tee, W., M. Dyall-Smith, W. Woods, and D. Eisen. 1996. Probable new species of Desulfovibrio isolated from a pyogenic liver abscess. J. Clin. Microbiol. 34:1760-1764[Abstract].
21. Vu-Thien, H., D. Moissenet, M. Valcin, C. Dulot, G. Tournier, and A. Garbarg-Chenon. 1996. Molecular epidemiology of Burkholderia cepacia, Stenotrophomonas maltophilia and Alcaligenes xylosoxidans in a cystic fibrosis center. Eur. J. Clin. Microbiol. Infect. Dis. 15:876-879[Medline].
22. Weyant, R. S., C. W. Moss, R. E. Weaver, D. G. Hollis, J. G. Jorda, E. C. Cook, and M. I. Daneshvar. 1996. Identification of unusual pathogenic Gram-negative aerobic and facultatively anaerobic bacteria, 2nd ed. Williams & Wilkins, Baltimore, Md.
23. Yabuuchi, E., Y. Kosako, I. Yano, H. Hotta, and Y. Nishiuchi. 1995. Transfer of two Burkholderia and an Alcaligenes species to Ralstonia gen. nov.: proposal of Ralstonia pickettii (Ralston, Palleroni and Doudoroff 1973) comb. nov., Ralstonia solanacearum (Smith 1896) comb. nov. and Ralstonia eutropha (Davis 1969) comb. nov. Microbiol. Immunol. 39:897-904[Medline].


Journal of Clinical Microbiology, June 1999, p. 1777-1781, Vol. 37, No. 6
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Vaneechoutte, M., Kampfer, P., De Baere, T., Falsen, E., Verschraegen, G. (2004). Wautersia gen. nov., a novel genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species, and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al. 1990) comb. nov.. Int. J. Syst. Evol. Microbiol. 54: 317-327 [Abstract] [Full Text]  
  • Moissenet, D., Vu-Thien, H., Benzerara, Y., Arlet, G. (2003). DNA Fingerprinting of Ralstonia paucula by Infrequent-Restriction-Site PCR and Randomly Amplified Polymorphic DNA Analysis. J. Clin. Microbiol. 41: 5747-5749 [Abstract] [Full Text]  
  • Zhou, N.-Y., Fuenmayor, S. L., Williams, P. A. (2001). nag Genes of Ralstonia (Formerly Pseudomonas) sp. Strain U2 Encoding Enzymes for Gentisate Catabolism. J. Bacteriol. 183: 700-708 [Abstract] [Full Text]  
  • Moissenet, D., Bidet, P., Garbarg-Chenon, A., Arlet, G., Vu-Thien, H. (2001). Ralstonia paucula (Formerly CDC Group IV c-2): Unsuccessful Strain Differentiation with PCR-Based Methods, Study of the 16S-23S Spacer of the rRNA Operon, and Comparison with Other Ralstonia Species (R. eutropha, R. pickettii, R. gilardii, and R. solanacearum). J. Clin. Microbiol. 39: 381-384 [Abstract] [Full Text]  
  • Römling, U., Tümmler, B. (2000). Achieving 100% Typeability of Pseudomonas aeruginosa by Pulsed-Field Gel Electrophoresis. J. Clin. Microbiol. 38: 464-465 [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moissenet, D.
Right arrow Articles by Vu-Thien, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moissenet, D.
Right arrow Articles by Vu-Thien, H.