Previous Article | Next Article 
Journal of Clinical Microbiology, June 1999, p. 1985-1993, Vol. 37, No. 6
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Identification of Medically Relevant
Trichosporon Species Based on Sequences of Internal
Transcribed Spacer Regions and Construction of a Database for
Trichosporon Identification
Takashi
Sugita,1
Akemi
Nishikawa,2
Reiko
Ikeda,1 and
Takako
Shinoda1,*
Department of
Microbiology1 and Department of
Immunobiology,2 Meiji Pharmaceutical
University, Kiyose, Tokyo, Japan
Received 16 October 1998/Returned for modification 14 January
1999/Accepted 1 March 1999
 |
ABSTRACT |
The nucleotide sequences of the internal transcribed spacer (ITS) 1 and 2 regions in the rRNA gene were determined by directly sequencing
PCR-amplified fragments for all of the species (17 species and five
varieties) in the genus Trichosporon. Comparative sequence
analysis suggests that six medically relevant species, T. asahii, T. asteroides, T. cutaneum,
T. inkin, T. mucoides, and T. ovoides, can be readily identified by their ITS sequences. In
addition, the sequence analysis showed that conspecific strains have
fewer than 1% nucleotide differences in the ITS 1 and 2 regions overall. Molecular phylogenetic trees are also presented.
| |
INTRODUCTION |
Trichosporon Behrend is a
medically important genus that includes the causative agents of both
deep-seated, mucosa-associated infections and superficial infections,
including white piedra (8, 28, 51). The majority of leukemia
and lymphoma patients with fatal disseminated fungemia are in a
profound neutropenic state when their infections develop. Recently, the
number of patients with illness caused by Trichosporon
species has been increasing (10, 14, 43, 44, 48, 50).
Deep-seated trichosporonosis has a high mortality
rate, and the prognosis for patients is very poor.
Trichosporon species are also responsible for summer-type hypersensitivity pneumonitis (1, 2, 33, 49).
In 1992, the taxonomy of the genus Trichosporon was
significantly revised by Guého et al. (5).
Subsequently, Sugita et al. (37, 42) proposed a new
classification that included new species, and 17 species and five
varieties are presently accepted in the genus. Recent taxonomic studies
indicate that trichosporonosis is caused by six species: T. asahii, T. asteroides, T. cutaneum, T. inkin, T. mucoides, and T. ovoides (4,
7, 40, 41). Moreover, it has been suggested that the major
causative agents of trichosporonosis differ in each type of infection.
T. asahii and T. mucoides are involved in
deep-seated infection. T. asteroides and T. cutaneum are associated with superficial infection. T. ovoides and T. inkin are involved in white piedra of
the head and genital area, respectively. T. pullulans is not
a major causative agent of trichosporonosis and is rarely isolated from
fungemia patients (16, 17).
On the other hand, at least four different serological types (I, II,
III, and I-III) of Trichosporon have been identified in
species by Ikeda et al. (9) and Nishiura et al.
(30). The six medically relevant species are serotype I or
II. Serotypes III and I-III do not seem to be responsible for infection.
Although we have developed a PCR-based identification system with
genus-specific and T. asahii species-specific primers
(38, 39), rapid identification of all
Trichosporon species is not yet possible.
In this study, we sequenced the internal transcribed spacer (ITS)
regions for all of the species in the genus Trichosporon and
developed an identification system for all of the species.
| |
MATERIALS AND METHODS |
Strains used.
The strains used in this study are shown in
Table 1. They included
stock strains and clinical and environmental isolates. Trichosporon sp. strain M 9481 was isolated from the soil in
Tokyo, Japan. Candida albicans, Candida famata,
Debaryomyces hansenii, and Saccharomyces
cerevisiae were also used.
Direct DNA sequencing.
Nuclear DNA was extracted by the
method of Makimura et al. (22). ITSs 1 and 2 and the
intervening 5.8S ribosomal DNA (rDNA) region were amplified with
primers pITS-F (GTCGTAACAAGGTTAACCTGCGG) and pITS-R
(TCCTCCGCTTATTGATATGC), which were designed from conserved regions of the 18S and 28S rRNA genes, respectively. The reactions were
performed in a final reaction mixture (50 µl) containing 10 pmol of
each primer; 200 mM (each) dATP, dTTP, dGTP, and dCTP; 2.5 mM
MgCl2; 0.5 U of Ex Taq polymerase (Takara,
Shiga, Japan); and 5 µl of 10× reaction buffer (Takara). The
amplification reactions were performed in a GeneAmp PCR System 9700 (Perkin-Elmer Applied Biosystems, Foster City, Calif.) with the
following cycling parameters: 94°C for 3 min, followed by 30 cycles
of 94°C for 30 s, 57°C for 30 s, and 72°C for 45 s, with a final extension at 72°C for 10 min. The amplified products
were purified with a NucleoSpin DNA purification kit (Macherey-Nagel
GmbH, Duren, Germany) according to the manufacturer's instructions.
Direct sequencing of the PCR product was performed with a PRISM Cycle
sequencing kit (Perkin-Elmer Applied Biosystems). Two external primers,
pITS-F and pITS-R, were used to determine the sequences.
Nucleotide sequence similarity.
The similarities of the
sequences were compared by using the nuclear DNA relatedness values
taken from the literature (11-13, 18, 19, 24-27, 29, 36, 37,
40-42) and the similarity of the ITS 1 and 2 sequences
separately. Sequence similarity was visually determined from pairwise
alignments. The nucleotide sequences of species other than those in the
genus Trichosporon included in this study were obtained from
GenBank, and their accession numbers are cited in Table 1.
Molecular phylogenetic analysis.
The sequences were aligned
with the computer program CLUSTAL W (45). For the
neighbor-joining analysis (32), the distances between the
sequences were calculated by using Kimura's two-parameter model
(15). Sites where gaps existed in any of the sequences were
excluded. The program DNAML in PHYLIP version 3.5c was used for the
maximum-likelihood analysis (3). T. pullulans was
used as the outgroup.
Identification of ubiquinone.
The ubiquinone study was
carried out only with the Trichosporon sp. strain M 9481 environmental isolate. The extraction of ubiquinone was performed
following a procedure of Yamada and Kondo (47) with a slight
modification. Ubiquinone was isolated by thin-layer chromatography (50 by 200 mm) (PK6F silica gel; Whatman, Clifton City, N.J.) in
hexane-diethyl ether (85:15 [vol/vol]) and detected with UV light
(254 nm). The type of ubiquinone was determined by high-performance
liquid chromatography under the following conditions: reverse-phase
column, Zorbax ODS (150 by 4.6 mm; Shimadzu, Kyoto, Japan); mobile
phase, ethanol-water (97:3 [vol/vol]); column temperature, 53°C;
flow rate, 1 ml/min; detection, 275 nm. Standard ubiquinones were used
as references.
Serotyping.
Serotyping was carried out only with the
Trichosporon sp. strain M 9481 environmental isolate. The
serotype of the isolate was determined by the cell slide agglutination
test with specific factor sera as described by Ikeda et al.
(9).
Nucleotide sequence accession numbers.
The nucleotide
sequences discussed in this paper have been deposited in the DNA Data
Bank of Japan (DDBJ), and their accession numbers are given in Table 1.
| |
RESULTS |
Sequences of the ITS regions.
Figures
1 and 2
show the nucleotide sequences of ITS 1, including the 3' end of 18S
rDNA, and ITS 2 of all the species in the genus
Trichosporon. With the exceptions of T. asahii
var. coremiformis, T. asahii var.
faecalis, T. brassicae, T. moniliiforme, and T. sporotrichoides, these are
consensus sequences built from the sequences of more than two strains
of each species. ITS 1 was from 115 to 123 bp long, while ITS 2 was
from 168 to 176 bp long. The within-species length variation in either
ITS 1 or ITS 2 was not remarkable.
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of the Trichosporon ITS 1 sequences, including the 3' end of 18S rDNA. Periods and asterisks are
used when the nucleotide at a particular position is identical to that
in T. cutaneum. Dashes represent deletions necessary for
alignment. T. cut, T. cutaneum; T. jir, T. jirovecii; T. mnl, T. moniliiforme; T. mcd, T. mucoides; T. aqt, T. aquatile; T. a. ash, T. asahii var. asahii; T. a. cor, T. asahii
var. coremiformis; T. a. fae, T. asahii var.
faecalis; T. ast, T. asteroides; T. ink, T. inkin; T. ovd, T. ovoides; T. bra, T. brassicae; T. mot, T. montevideense; T. dom, T. domesticum; T. dul, T. dulcitum; T. gra, T. gracile; T. l. lob, T. loubieri var.
loubieri; T. l. lab, T. loubieri var.
laibachii; T. spt, T. sporotrichoides; M 9481, Trichosporon sp. strain M 9481.
|
|
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of the Trichosporon ITS 2 sequences. For symbols and abbreviations, see the legend to Fig. 1.
|
|
Sequence similarity between strains of a single species.
Multiple strains of T. asahii, T. mucoides,
C. albicans, and S. cerevisiae were examined to
assess intraspecific variation (Table 2).
In nine strains of T. asahii, <1- and 2-base differences were found in ITS 1 and 2, respectively, with overall similarities of
99.3 to 100% for both ITS 1 and 2. Five strains of T. mucoides had overall similarities of 98.9 to 100% in both the ITS
1 and 2 regions. For C. albicans, the similarities of the
sequences were 99.7 to 100%. Although there were six different bases
in the S. cerevisiae sequences in ITSs 1 and 2, the overall
sequence similarity was 99.0%. Although strains in the same species do not necessarily have identical sequences, the overall sequence similarity of both ITSs 1 and 2 was 99% or more.
Relationship between the nuclear DNA relatedness value and ITS
sequence similarity.
Table 3 shows
the matrices of sequence similarity for ITSs 1 and 2 for all of the
species in the genus Trichosporon. The matrix for the
overall ITS sequence is shown in Table 4.
Fig. 3 shows the relationship between the
nuclear DNA relatedness value and the sequences' ITS 1 and 2 similarities. This figure is based on the results for 74 pairs. A
species concept has been defined on the basis of the nuclear DNA
relatedness value, which corresponds well with biological relatedness
(31). Within the same species (high-relatedness group), the
value is approximately 80% or more. Species with values of
approximately 40 to 80% are varieties of the same species or sibling
species (intermediate-relatedness group). The value is less than 40%
in different species (low-relatedness group). In the high-relatedness
group, the sequence similarities of ITSs 1 and 2 were more than 98.9 and 98.8%, respectively. In the intermediate-relatedness group, the
sequence similarities of ITSs 1 and 2 were more than 98.3 and 97.8%,
respectively. In the low-relatedness group, data for ITS sequences with
similarities of less than 90% were excluded from Figs. 3 and
4. The ITS similarities of the
low-relatedness group were lower than the values for the high and
intermediate groups. Exceptions were seen in T. asahii and
T. asteroides. Their ITS 2 sequences were identical, but
they had low nuclear DNA relatedness values of between 12 and 30%
(37).
View larger version (25K):
[in this window]
[in a new window]
|
FIG. 3.
Relationship between nuclear DNA relatedness value and
similarities of ITS 1 and 2 sequences considered separately.
|
|
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 4.
Relationship between nuclear DNA relatedness value and
similarity of combined ITS 1 and 2 sequences.
|
|
The relationship between the nuclear DNA relatedness value and the ITS
sequences is shown in Fig.
4. The high-relatedness
group had more than
99.0% similarity, while the intermediate-relatedness
group had more
than 97.9% similarity. In the intermediate group,
100% sequence
similarities were found between
T. domesticum and
T. montevideense and between the two varieties of
C. famata. The
low-relatedness group showed less than 99.3% sequence
similarity.
No identical sequences were found in the low-relatedness
group,
but the similarities between
T. asteroides and the
three varieties
of
T. asahii and between
T. dulcitum and
T. gracile exceeded 99%.
Species-specific sequences.
Table
5 shows the species-specific sequence
used to distinguish each species. These sequences do not depend on the
strain. The three varieties of T. asahii have identical
sequences, so the specific sequences do not differentiate among them.
T. domesticum and T. montevideense also have
identical sequences and cannot be distinguished by ITS sequences.
Serotype and ubiquinone of Trichosporon sp. strain M
9481.
The slide agglutination test with specific factor sera
demonstrated that environmental isolate M 9481 was serotype II. This isolate had Q9 as the major ubiquinone.
Molecular phylogenetic analysis based on the ITS sequences.
Figures 5 and
6 show the molecular phylogenetic trees
based on the ITS 1 and 2 sequences constructed by the neighbor-joining and maximum-likelihood methods, respectively. The serotypes of the
Trichosporon species are also shown in Fig. 5 and 6. The
overall topology of the neighbor-joining tree is slightly different
from that constructed by the maximum-likelihood method. This seems to
be due to bootstrap values and differences in the method of analysis.
However, the serotype correlated well with molecular phylogenetic
trees, regardless of the ITS region or method. In the T. sporotrichoides clade, the strain M 9481 has serotype II, while
T. sporotrichoides does not react with any factor sera.
View larger version (22K):
[in this window]
[in a new window]
|
FIG. 5.
Molecular phylogenetic trees based on the
Trichosporon ITS 1 (A) and 2 (B) sequences. The trees were
constructed by the neighbor-joining method. The numerals represent the
confidence level from 1,000 replicate bootstrap samplings (frequencies
less than 50% are not indicated). Knuc, Kimura's parameter
(15).
|
|
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 6.
Molecular phylogenetic trees based on the
Trichosporon ITS 1 (A) and 2 (B) sequences. The trees were
constructed by the maximum-likelihood method. The scale marker
indicates the distance in relative units that equals 5% of the total
branch length depicted.
|
|
| |
DISCUSSION |
To detect pathogenic fungi rapidly, oligonucleotide primers for
PCR have been designed, based on the sequences of 18S or 26S rDNA
(6, 46). These sequences have been determined for most pathogenic yeasts. The relatively high levels of sequence similarity observed among some species appears to limit the value of 18S or 26S
rDNA for differentiating species that are phylogenetically closely
related. The ITS region is located between the 18S and 26S rRNA genes
and is subdivided into the ITS 1 region, which separates the 18S and
5.8S rRNA genes, and the ITS 2 region, which is found between the 5.8S
and 26S rRNA genes. It is generally thought that the ITS regions have
higher rates of divergence than the 18S, 5.8S, or 26S rRNA genes. The
lengths of the 18S and 26S rRNA genes are essentially identical in all
species, while the lengths of the ITS regions depend on the species.
For example, the ITS 2 regions of Candida glabrata (U70498),
Candida kefyr (U70502), and S. cerevisiae
(Z75722) are approximately 230 to 240 bp long; those of Candida
guilliermondii (U70499) and C. famata (U70500) are
approximately 190 bp long; those of C. albicans (L07796), Candida tropicalis (L11349), Candida parapsilosis
(L11352), and Candida viswanathii (U70510) are approximately
130 to 140 bp long; and those of Candida lusitaniae (U70503)
and Candida rugosa (U70506) are only 70 to 90 bp long
(21). The clades in the molecular phylogenetic tree for
these species correspond well to the ITS sequence length. ITSs 1 and 2 in the Trichosporon species are essentially the same size.
With the exception of T. pullulans, the genus
Trichosporon is monophyletic (35). T. pullulans was phylogenetically distinct from the other taxa in the
genus, suggesting that this species does not belong in the genus. The
lengths of the ITS 1 and 2 regions of T. pullulans are 40 and 50 bp longer, respectively, than those of the other
Trichosporon species. As mentioned above, we believe that
highly species-specific sequences can be found in the ITS sequences. To
design highly specific oligonucleotide primers for PCR, sequence data
for both the pathogenic and nonpathogenic species are required.
Mannarelli and Kurtzman (23) developed a PCR-based
identification system for the 14 Candida species that are
human pathogens based on a ca. 600-nucleotide variable region (D1/D2)
at the 5'-end of the 26S rDNA. Prior to this research work, their group
determined the sequences of 204 Candida and related species,
including nonpathogenic species (20). Their PCR system can
clearly distinguish pathogenic species from species that are
phylogenetically closely related.
DNA sequence can be determined quite rapidly with an automated DNA
sequencer. Starting from DNA extraction from yeast cells, the ITS
sequence can be determined within a working day, or 24 h at the
most. Once an ITS sequence database has been constructed, rapid
identification can be made. Since this identification method is not
based on physiological characteristics, such as the carbon assimilation
pattern, the chance of misidentification is reduced.
In this study, we found that conspecific species have less than a 1%
overall nucleotide difference in both the ITS 1 and 2 regions. The
species that have an intermediate DNA relatedness value have ITS
sequences with 99% or more similarity, such as the three varieties of
T. asahii and the two varieties of C. famata. Although T. domesticum and T. montevideense are
distinct biological species, they have the same ITS sequences. They are
considered to share an intermediate DNA relatedness value
(42). With a few exceptions, the ITS sequence similarity
between different species is less than 99.0%. The ITS sequence of
T. asahii had two or three different bases from that of
T. asteroides (99.0 to 99.3% similarity). It is very
difficult to distinguish between these two species by using
physiological characteristics (4), but the former is
responsible for deep-seated infection while the latter is associated
with superficial infection (4, 7).
Strain M 9481, which was isolated from a soil sample, was serotype II
and had Q9 as the major ubiquinone. Although this strain is positioned
in the T. sporotrichoides clade on the phylogenetic tree,
its sequence similarity with the clade is only 95.1%. Strain M 9481 is
considered a new species in the genus Trichosporon. At
present, according to our data and a literature survey, the overall ITS
sequence similarity of identical species is more than 99.0%. The
accuracy of this value should be clarified as further data are
accumulated. Kurtzman and Robnett (20) found a similar result in their analysis of the D1/D2 region of the 26S rDNA: the same
species had fewer than 1% sequence differences.
The molecular phylogenetic trees of the genus Trichosporon
constructed from the 18S and 26S rDNA sequences have already been reported (34, 35). The topology of these trees differs from that of the trees constructed from the ITS 1 and 2 sequences. However,
the correlation between these trees depends on the molecular sequence
and the molecular phylogenetic method. Although the factor sera we made
are not species-specific, the serological groups correspond to the
molecular phylogeny. Serological typing gives useful information to
tentatively identify an isolate.
In conclusion, we constructed a readily used and accurate
identification system for all of the species in the genus
Trichosporon, including the six medically relevant species,
based on comparative sequence analysis of the ITS regions. We expect
that a sequence database will be constructed for other pathogenic fungi
and related species.
| |
ACKNOWLEDGMENTS |
We thank Tomoe Ichikawa and Hiromi Shinohara for their technical
skills in analyzing the ubiquinone.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Meiji Pharmaceutical University, 2-522-1 Noshio, Kiyose, Tokyo, 204-8588 Japan. Phone: 81-424-95-8761. Fax: 81-424-95-8761. E-mail: shinoda{at}my-pharm.ac.jp.
| |
REFERENCES |
| 1.
|
Ando, M.,
K. Arima,
R. Yoneda, and M. Tamura.
1991.
Japanese summer-type hypersensitivity pneumonitis: geographic distribution, home environment, and clinical characteristics of 621 cases.
Am. Rev. Respir. Dis.
144:765-769[Medline].
|
| 2.
|
Ando, M.,
T. Sakata, and K. Yoshida.
1990.
Serotype-related antigen of Trichosporon cutaneum in the induction of summer-type hypersensitivity pneumonitis: correlation between serotype of inhalation challenge-positive antigen and that of the isolates from patients' homes.
J. Allergy Clin. Immunol.
85:36-44[Medline].
|
| 3.
|
Felsenstein, J.
1985.
Confidence limits on phylogenies: an approach using the bootstrap.
Evolution
39:783-791.
|
| 4.
|
Guého, E.,
L. Improvisi,
G. S. de Hoog, and B. Dupont.
1994.
Trichosporon on humans: a practical account.
Mycoses
37:3-10[Medline].
|
| 5.
|
Guého, E.,
M. T. Smith,
G. S. de Hoog,
G. B. Grand,
R. Christen, and W. H. Batenburg-van der Vegte.
1992.
Contributions to a revision of the genus Trichosporon.
Antonie Leeuwenhoek
61:289-316.
|
| 6.
|
Haynes, K. A.,
T. J. Westerneng,
J. W. Fell, and W. Moens.
1995.
Rapid detection and identification of pathogenic fungi by polymerase chain reaction amplification of large subunit ribosomal DNA.
J. Med. Vet. Mycol.
33:319-325[Medline].
|
| 7.
|
Herbrecht, R.,
H. Koening,
K. Waller,
L. Liu, and E. Guého.
1993.
Trichosporon infections: clinical manifestations and treatment.
J. Mycol. Med.
3:129-136.
|
| 8.
|
Hoy, J.,
K. C. Hsu,
K. Rolston,
R. L. Hopfer,
M. Luna, and G. P. Bodey.
1986.
Trichosporon beigelii infection: a review.
Rev. Infect. Dis.
8:959-967[Medline].
|
| 9.
|
Ikeda, R.,
M. Yokota, and T. Shinoda.
1996.
Serological characterization of Trichosporon cutaneum and related species.
Microbiol. Immunol.
40:813-819[Medline].
|
| 10.
|
Itoh, T.,
H. Hosokawa,
U. Kohdera,
N. Toyazaki, and Y. Asada.
1996.
Disseminated infection with Trichosporon asahii.
Mycoses
39:195-199[Medline].
|
| 11.
|
James, S. A.,
M. D. Collins, and I. N. Roberts.
1996.
Use of an rRNA internal transcribed spacer region to distinguish phylogenetically closely related species of the genera Zygosaccharomyces and Torulaspora.
Int. J. Syst. Bacteriol.
46:189-194[Abstract/Free Full Text].
|
| 12.
|
James, S. A.,
I. N. Roberts, and M. D. Collins.
1998.
Phylogenetic heterogeneity of the genus Williopsis as revealed by 18S rRNA gene sequences.
Int. J. Syst. Bacteriol.
48:591-596[Abstract/Free Full Text].
|
| 13.
|
Kamiyama, A.,
M. Niimi,
M. Tokunaga, and H. Nakayama.
1989.
DNA homology between Candida albicans strains: evidence to justify the synonymous status of C. stellatoidea.
Mycopathologia
107:3-7[Medline].
|
| 14.
|
Kataoka-Nishimura, S.,
H. Akiyama,
K. Saku,
M. Kashiwa,
S. Mori,
S. Tanikawa,
H. Sakamaki, and Y. Onozawa.
1998.
Invasive infection due to Trichosporon cutaneum in patients with haematologic malignancies.
Cancer
82:484-487[Medline].
|
| 15.
|
Kimura, M.
1980.
A simple method for estimation of evolutionary rate of base substitutions through comparative studies of nucleotide sequences.
J. Mol. Evol.
16:111-120[Medline].
|
| 16.
|
Kunova, A.,
J. Godal,
J. Sufliarsky,
S. Spanik,
T. Kollar, and V. Krcmery, Jr.
1996.
Fatal Trichosporon pullulans breakthrough fungemia in cancer patients: report of three patients who failed on prophylaxis with itraconazole.
Infection
24:273-274[Medline].
|
| 17.
|
Kunova, A.,
D. Sorkovska,
J. Sufliarsky, and V. Krcmery, Jr.
1996.
First report of catheter associated Trichosporon pullulans breakthrough fungemia in a cancer patient.
J. Infect.
32:70-71[Medline].
|
| 18.
|
Kurtzman, C. P.
1990.
DNA relatedness among species of the genus Zygosaccharomyces.
Yeast
6:213-219[Medline].
|
| 19.
|
Kurtzman, C. P.
1991.
DNA relatedness among saturn-spored yeasts assigned to the genera Williopsis and Pichia.
Antonie Leeuwenhoek
60:13-19.
|
| 20.
|
Kurtzman, C. P., and C. J. Robnett.
1997.
Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene.
J. Clin. Microbiol.
35:1216-1223[Abstract].
|
| 21.
|
Lott, T. J.,
B. M. Burns,
R. Zancope-Oliveira,
C. M. Elie, and E. Reiss.
1998.
Sequence analysis of the internal transcribed spacer 2 (ITS2) from yeast species within the genus Candida.
Curr. Microbiol.
36:63-69[Medline].
|
| 22.
|
Makimura, K.,
Y. S. Murayama, and H. Yamaguchi.
1994.
Detection of a wide range of medically important fungal species by polymerase chain reaction (PCR).
J. Med. Microbiol.
40:358-364[Abstract/Free Full Text].
|
| 23.
|
Mannarelli, B. M., and C. P. Kurtzman.
1998.
Rapid identification of Candida albicans and other human pathogenic yeasts by using short oligonucleotides in a PCR.
J. Clin. Microbiol.
36:1634-1641[Abstract/Free Full Text].
|
| 24.
|
Martini, A. V.
1989.
Saccharomyces paradoxus comb. nov., a newly separated species of the Saccharomyces sensu stricto complex based upon nDNA/nDNA homologies.
Syst. Appl. Microbiol.
12:179-182.
|
| 25.
|
Martini, A. V., and C. P. Kurtzman.
1985.
Deoxyribonucleic acid relatedness among species of the genus Saccharomyces sensu stricto.
Int. J. Syst. Bacteriol.
35:508-511[Abstract/Free Full Text].
|
| 26.
|
Martini, A. V., and A. Martini.
1987.
Three newly delimited species of Saccharomyces sensu stricto.
Antonie Leeuwenhoek
53:77-84.
|
| 27.
|
Montrocher, R. M.,
C. Verner,
J. Briolay,
C. Gautier, and R. Marmeisse.
1998.
Phylogenetic analysis of the Saccharomyces cerevisiae group based on polymorphisms of rDNA spacer sequences.
Int. J. Syst. Bacteriol.
48:295-303[Abstract/Free Full Text].
|
| 28.
|
Nahass, G. T.,
S. P. Rosenberg,
C. L. Leonardi, and N. S. Penneys.
1993.
Disseminated infection with Trichosporon beigelii.
Arch. Dermatol.
129:1020-1023[Abstract/Free Full Text].
|
| 29.
|
Nishikawa, A.,
H. Tomomatsu,
T. Sugita,
R. Ikeda, and T. Shinoda.
1996.
Taxonomic position of clinical isolates of Candida famata.
J. Med. Vet. Mycol.
34:411-419[Medline].
|
| 30.
|
Nishiura, Y.,
K. Nakagawa-Yoshida,
M. Suga,
T. Shinoda,
E. Guého, and M. Ando.
1997.
Assignment and serotyping of Trichosporon species: the causative agents of summer-type hypersensitivity pneumonitis.
J. Med. Vet. Mycol.
35:45-52[Medline].
|
| 31.
|
Price, C. W.,
G. B. Fuson, and H. J. Phaff.
1978.
Genome comparison in yeast systematics: delimitation of species within the genera Schwanniomyces, Saccharomyces, Debaryomyces, and Pichia.
Microbiol. Rev.
42:161-193[Free Full Text].
|
| 32.
|
Saito, N., and M. Nei.
1987.
Neighbor-joining method: a new method for reconstructing phylogenetic trees.
Mol. Biol. Evol.
4:406-425[Abstract].
|
| 33.
|
Shimazu, K.,
M. Ando,
T. Sakata,
K. Yoshida, and S. Araki.
1984.
Hypersensitivity pneumonitis induced by Trichosporon cutaneum.
Am. Rev. Respir. Dis.
130:407-411[Medline].
|
| 34.
|
Sugita, T.,
K. Makimura,
A. Nishikawa,
K. Uchida,
H. Yamaguchi, and T. Shinoda.
1997.
Partial sequences of large subunit ribosomal DNA of a new yeast species, Trichosporon domesticum and related species.
Microbiol. Immunol.
41:571-573[Medline].
|
| 35.
|
Sugita, T., and T. Nakase.
1998.
Molecular phylogenetic study of the basidiomycetous anamorphic yeast genus Trichosporon and related taxa based on small subunit ribosomal DNA sequences.
Mycoscience
39:7-13.
|
| 36.
|
Sugita, T.,
A. Nishikawa,
R. Ikeda,
T. Shinoda,
H. Sakashita,
Y. Sakai, and Y. Yoshizawa.
1998.
First report of Trichosporon ovoides isolated from the home of a summer-type hypersensitivity pneumonitis patient.
Microbiol. Immunol.
42:475-478[Medline].
|
| 37.
|
Sugita, T.,
A. Nishikawa, and T. Shinoda.
1994.
Reclassification of Trichosporon cutaneum by DNA relatedness by using the spectrophotometric method and the chemiluminometric method.
J. Gen. Appl. Microbiol.
40:397-408.
|
| 38.
|
Sugita, T.,
A. Nishikawa, and T. Shinoda.
1998.
Rapid detection of species of the opportunistic yeast Trichosporon by PCR.
J. Clin. Microbiol.
36:1458-1460[Abstract/Free Full Text].
|
| 39.
|
Sugita, T.,
A. Nishikawa, and T. Shinoda.
1998.
Identification of Trichosporon asahii by PCR based on sequences of the internal transcribed spacer regions.
J. Clin. Microbiol.
42:475-478.
|
| 40.
|
Sugita, T.,
A. Nishikawa,
T. Shinoda, and H. Kume.
1995.
Taxonomic position of deep-seated, mucosa-associated, and superficial isolates of Trichosporon cutaneum from trichosporonosis patients.
J. Clin. Microbiol.
33:1368-1370[Abstract].
|
| 41.
|
Sugita, T.,
A. Nishikawa,
T. Shinoda, and T. Kusunoki.
1996.
Taxonomic studies on clinical isolates from superficial trichosporonosis patients by DNA relatedness.
Jpn. J. Med. Mycol.
37:107-110.
|
| 42.
|
Sugita, T.,
A. Nishikawa,
T. Shinoda,
K. Yoshida, and M. Ando.
1995.
A new species, Trichosporon domesticum, isolated from the house of a summer-type hypersensitivity pneumonitis patient in Japan.
J. Gen. Appl. Microbiol.
41:429-436.
|
| 43.
|
Tashiro, T.,
H. Nagai,
P. Kamberi,
Y. Goto,
H. Kikuchi,
M. Nasu, and S. Akizuki.
1994.
Disseminated Trichosporon beigelii infection in patients with malignant diseases: immunohistochemical study and review.
Eur. J. Clin. Microbiol. Infect. Dis.
13:218-224[Medline].
|
| 44.
|
Tashiro, T.,
H. Nagai,
T. Yamasaki,
Y. Goto,
S. Akizuki, and M. Nasu.
1993.
Disseminated Trichosporon beigelii infection: report of nine cases and review.
Jpn. J. Infect.
67:704-711.
|
| 45.
|
Thompson, J.,
J. D. Hompson,
D. G. Higgins, and T. J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680[Abstract/Free Full Text].
|
| 46.
|
van Deventer, A. J. M.,
W. H. F. Goessens,
A. van Belkum,
H. J. van Vliet,
E. W. M. van Etten, and H. A. Verbrugh.
1995.
Improved detection of Candida albicans by PCR in blood of neutropenic mice with systemic candidiasis.
J. Clin. Microbiol.
33:625-628[Abstract].
|
| 47.
|
Yamada, Y., and K. Kondo.
1973.
Coenzyme Q system in the classification of the yeast genera Rhodotorula and Cryptococcus, and the yeast like genera Sporobolomyces and Rhodosporidium.
J. Gen. Appl. Microbiol.
19:59-77.
|
| 48.
|
Yamakami, Y.,
T. Tashiro,
I. Tokimatsu,
H. Nagai,
H. Nagaoka,
A. Hashimoto,
Y. Goto,
M. Nasu,
T. Yamasaki, and M. Ito.
1995.
Microbiological and clinical study of fungemia between 1981 and 1992.
Kansenshogaku Zasshi
69:890-894[Medline].
|
| 49.
|
Yoshida, K.,
M. Ando,
T. Sakata, and S. Araki.
1988.
Environmental mycological studies on the causative agent of summer-type hypersensitivity pneumonitis.
J. Allergy Clin. Immunol.
81:475-483[Medline].
|
| 50.
|
Yoss, B. S.,
R. L. Sautter, and H. J. Brenker.
1997.
Trichosporon beigelii, a new neonatal pathogen.
Am. J. Perinatol.
14:113-117[Medline].
|
| 51.
|
Walsh, T. J.
1989.
Trichosporonosis.
Infect. Dis. Clin. N. Am.
3:43-52[Medline].
|
Journal of Clinical Microbiology, June 1999, p. 1985-1993, Vol. 37, No. 6
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Liou, G.-Y., Wei, Y.-H., Lin, S.-J., Wen, C.-Y., Lee, F.-L.
(2009). Pseudozyma pruni sp. nov., a novel ustilaginomycetous anamorphic fungus from flowers in Taiwan. Int. J. Syst. Evol. Microbiol.
59: 1813-1817
[Abstract]
[Full Text]
-
Taj-Aldeen, S. J., Al-Ansari, N., El Shafei, S., Meis, J. F., Curfs-Breuker, I., Theelen, B., Boekhout, T.
(2009). Molecular Identification and Susceptibility of Trichosporon Species Isolated from Clinical Specimens in Qatar: Isolation of Trichosporon dohaense Taj-Aldeen, Meis & Boekhout sp. nov.. J. Clin. Microbiol.
47: 1791-1799
[Abstract]
[Full Text]
-
Chen, B., Huang, X., Zheng, J.-W., Li, S.-P., He, J.
(2009). Candida mengyuniae sp. nov., a metsulfuron-methyl-resistant yeast. Int. J. Syst. Evol. Microbiol.
59: 1237-1241
[Abstract]
[Full Text]
-
Khan, Z. U., Ahmad, S., Brazda, A., Chandy, R.
(2009). Mucor circinelloides as a Cause of Invasive Maxillofacial Zygomycosis: an Emerging Dimorphic Pathogen with Reduced Susceptibility to Posaconazole. J. Clin. Microbiol.
47: 1244-1248
[Abstract]
[Full Text]
-
Takashima, M., Sugita, T., Toriumi, Y., Nakase, T.
(2009). Cryptococcus tepidarius sp. nov., a thermotolerant yeast species isolated from a stream from a hot-spring area in Japan. Int. J. Syst. Evol. Microbiol.
59: 181-185
[Abstract]
[Full Text]
-
Nagatsuka, Y., Kiyuna, T., Kigawa, R., Sano, C., Miura, S., Sugiyama, J.
(2009). Candida tumulicola sp. nov. and Candida takamatsuzukensis sp. nov., novel yeast species assignable to the Candida membranifaciens clade, isolated from the stone chamber of the Takamatsu-zuka tumulus. Int. J. Syst. Evol. Microbiol.
59: 186-194
[Abstract]
[Full Text]
-
Nisiotou, A. A., Nychas, G.-J. E.
(2008). Kazachstania hellenica sp. nov., a novel ascomycetous yeast from a Botrytis-affected grape must fermentation. Int. J. Syst. Evol. Microbiol.
58: 1263-1267
[Abstract]
[Full Text]
-
Wang, Q.-M., Li, J., Wang, S.-A., Bai, F.-Y.
(2008). Rapid Differentiation of Phenotypically Similar Yeast Species by Single-Strand Conformation Polymorphism Analysis of Ribosomal DNA. Appl. Environ. Microbiol.
74: 2604-2611
[Abstract]
[Full Text]
-
Leaw, S. N., Chang, H. C., Barton, R., Bouchara, J.-P., Chang, T. C.
(2007). Identification of Medically Important Candida and Non-Candida Yeast Species by an Oligonucleotide Array. J. Clin. Microbiol.
45: 2220-2229
[Abstract]
[Full Text]
-
Lau, A., Chen, S., Sorrell, T., Carter, D., Malik, R., Martin, P., Halliday, C.
(2007). Development and Clinical Application of a Panfungal PCR Assay To Detect and Identify Fungal DNA in Tissue Specimens. J. Clin. Microbiol.
45: 380-385
[Abstract]
[Full Text]
-
Li, J., Xu, Y.-C., Bai, F.-Y.
(2006). Candida pseudorugosa sp. nov., a Novel Yeast Species from Sputum. J. Clin. Microbiol.
44: 4486-4490
[Abstract]
[Full Text]
-
Leaw, S. N., Chang, H. C., Sun, H. F., Barton, R., Bouchara, J.-P., Chang, T. C.
(2006). Identification of medically important yeast species by sequence analysis of the internal transcribed spacer regions.. J. Clin. Microbiol.
44: 693-699
[Abstract]
[Full Text]
-
Gunn, S. R., Reveles, X. T., Hamlington, J. D., Sadkowski, L. C., Johnson-Pais, T. L., Jorgensen, J. H.
(2006). Use of DNA Sequencing Analysis To Confirm Fungemia Due to Trichosporon dermatis in a Pediatric Patient.. J. Clin. Microbiol.
44: 1175-1177
[Abstract]
[Full Text]
-
Sugita, T., Kikuchi, K., Makimura, K., Urata, K., Someya, T., Kamei, K., Niimi, M., Uehara, Y.
(2005). Trichosporon Species Isolated from Guano Samples Obtained from Bat-Inhabited Caves in Japan. Appl. Environ. Microbiol.
71: 7626-7629
[Abstract]
[Full Text]
-
Rodriguez-Tudela, J. L., Diaz-Guerra, T. M., Mellado, E., Cano, V., Tapia, C., Perkins, A., Gomez-Lopez, A., Rodero, L., Cuenca-Estrella, M.
(2005). Susceptibility Patterns and Molecular Identification of Trichosporon Species. Antimicrob. Agents Chemother.
49: 4026-4034
[Abstract]
[Full Text]
-
Rakeman, J. L., Bui, U., LaFe, K., Chen, Y.-C., Honeycutt, R. J., Cookson, B. T.
(2005). Multilocus DNA Sequence Comparisons Rapidly Identify Pathogenic Molds. J. Clin. Microbiol.
43: 3324-3333
[Abstract]
[Full Text]
-
Ahmad, S., Al-Mahmeed, M., Khan, Z. U
(2005). Characterization of Trichosporon species isolated from clinical specimens in Kuwait. J Med Microbiol
54: 639-646
[Abstract]
[Full Text]
-
Girmenia, C., Pagano, L., Martino, B., D'Antonio, D., Fanci, R., Specchia, G., Melillo, L., Buelli, M., Pizzarelli, G., Venditti, M., Martino, P., the GIMEMA Infection Program,
(2005). Invasive Infections Caused by Trichosporon Species and Geotrichum capitatum in Patients with Hematological Malignancies: a Retrospective Multicenter Study from Italy and Review of the Literature. J. Clin. Microbiol.
43: 1818-1828
[Abstract]
[Full Text]
-
Cabanes, F. J., Hernandez, J. J., Castella, G.
(2005). Molecular Analysis of Malassezia sympodialis-Related Strains from Domestic Animals. J. Clin. Microbiol.
43: 277-283
[Abstract]
[Full Text]
-
Sugita, T., Ikeda, R., Nishikawa, A.
(2004). Analysis of Trichosporon Isolates Obtained from the Houses of Patients with Summer-Type Hypersensitivity Pneumonitis. J. Clin. Microbiol.
42: 5467-5471
[Abstract]
[Full Text]
-
Diaz, M. R., Fell, J. W.
(2004). High-Throughput Detection of Pathogenic Yeasts of the Genus Trichosporon. J. Clin. Microbiol.
42: 3696-3706
[Abstract]
[Full Text]
-
Lu, H.-Z., Jia, J.-H., Wang, Q.-M., Bai, F.-Y.
(2004). Candida asparagi sp. nov., Candida diospyri sp. nov. and Candida qinlingensis sp. nov., novel anamorphic, ascomycetous yeast species. Int. J. Syst. Evol. Microbiol.
54: 1409-1414
[Abstract]
[Full Text]
-
Middelhoven, W. J., Scorzetti, G., Fell, J. W.
(2004). Systematics of the anamorphic basidiomycetous yeast genus Trichosporon Behrend with the description of five novel species: Trichosporon vadense, T. smithiae, T. dehoogii, T. scarabaeorum and T. gamsii. Int. J. Syst. Evol. Microbiol.
54: 975-986
[Abstract]
[Full Text]
-
Marty, F. M., Barouch, D. H., Coakley, E. P., Baden, L. R.
(2003). Disseminated Trichosporonosis Caused by Trichosporon loubieri. J. Clin. Microbiol.
41: 5317-5320
[Abstract]
[Full Text]
-
Sugita, T., Takashima, M., Kodama, M., Tsuboi, R., Nishikawa, A.
(2003). Description of a New Yeast Species, Malassezia japonica, and Its Detection in Patients with Atopic Dermatitis and Healthy Subjects. J. Clin. Microbiol.
41: 4695-4699
[Abstract]
[Full Text]
-
Takashima, M., Sugita, T., Shinoda, T., Nakase, T.
(2003). Three new combinations from the Cryptococcus laurentii complex: Cryptococcus aureus, Cryptococcus carnescens and Cryptococcus peneaus. Int. J. Syst. Evol. Microbiol.
53: 1187-1194
[Abstract]
[Full Text]
-
Sugita, T., Kodama, M., Saito, M., Ito, T., Kato, Y., Tsuboi, R., Nishikawa, A.
(2003). Sequence Diversity of the Intergenic Spacer Region of the rRNA Gene of Malassezia globosa Colonizing the Skin of Patients with Atopic Dermatitis and Healthy Individuals. J. Clin. Microbiol.
41: 3022-3027
[Abstract]
[Full Text]
-
Novicki, T. J., LaFe, K., Bui, L., Bui, U., Geise, R., Marr, K., Cookson, B. T.
(2003). Genetic Diversity among Clinical Isolates of Acremonium strictum Determined during an Investigation of a Fatal Mycosis. J. Clin. Microbiol.
41: 2623-2628
[Abstract]
[Full Text]
-
Abliz, P., Fukushima, K., Takizawa, K., Nieda, N., Miyaji, M., Nishimura, K.
(2003). Rapid Identification of the Genus Fonsecaea by PCR with Specific Oligonucleotide Primers. J. Clin. Microbiol.
41: 873-876
[Abstract]
[Full Text]
-
Padhye, A. A., Verghese, S., Ravichandran, P., Balamurugan, G., Hall, L., Padmaja, P., Fernandez, M. C.
(2003). Trichosporon loubieri Infection in a Patient with Adult Polycystic Kidney Disease. J. Clin. Microbiol.
41: 479-482
[Abstract]
[Full Text]
-
Sugita, T., Nakajima, M., Ikeda, R., Matsushima, T., Shinoda, T.
(2002). Sequence Analysis of the Ribosomal DNA Intergenic Spacer 1 Regions of Trichosporon Species. J. Clin. Microbiol.
40: 1826-1830
[Abstract]
[Full Text]
-
Sugita, T., Takashima, M., Shinoda, T., Suto, H., Unno, T., Tsuboi, R., Ogawa, H., Nishikawa, A.
(2002). New Yeast Species, Malassezia dermatis, Isolated from Patients with Atopic Dermatitis. J. Clin. Microbiol.
40: 1363-1367
[Abstract]
[Full Text]
-
Lopez, J. V., Peterson, C. L., Willoughby, R., Wright, A. E., Enright, E., Zoladz, S., Reed, J. K., Pomponi, S. A.
(2002). Characterization of Genetic Markers for In Vitro Cell Line Identification of the Marine Sponge Axinella corrugata. J Hered
93: 27-36
[Abstract]
[Full Text]
-
Wolf, D. G., Falk, R., Hacham, M., Theelen, B., Boekhout, T., Scorzetti, G., Shapiro, M., Block, C., Salkin, I. F., Polacheck, I.
(2001). Multidrug-Resistant Trichosporon asahii Infection of Nongranulocytopenic Patients in Three Intensive Care Units. J. Clin. Microbiol.
39: 4420-4425
[Abstract]
[Full Text]
-
Chen, Y.-C., Eisner, J. D., Kattar, M. M., Rassoulian-Barrett, S. L., Lafe, K., Bui, U., Limaye, A. P., Cookson, B. T.
(2001). Polymorphic Internal Transcribed Spacer Region 1 DNA Sequences Identify Medically Important Yeasts. J. Clin. Microbiol.
39: 4042-4051
[Abstract]
[Full Text]
-
Fujita, S.-I., Senda, Y., Nakaguchi, S., Hashimoto, T.
(2001). Multiplex PCR Using Internal Transcribed Spacer 1 and 2 Regions for Rapid Detection and Identification of Yeast Strains. J. Clin. Microbiol.
39: 3617-3622
[Abstract]
[Full Text]
-
Sugita, T., Ichikawa, T., Matsukura, M., Sueda, M., Takashima, M., Ikeda, R., Nishikawa, A., Shinoda, T.
(2001). Genetic Diversity and Biochemical Characteristics of Trichosporon asahii Isolated from Clinical Specimens, Houses of Patients with Summer-Type-Hypersensitivity Pneumonitis, and Environmental Materials. J. Clin. Microbiol.
39: 2405-2411
[Abstract]
[Full Text]
-
Ikeda, R., Sugita, T., Shinoda, T.
(2000). Serological Relationships of Cryptococcus spp.: Distribution of Antigenic Factors in Cryptococcus and Intraspecies Diversity. J. Clin. Microbiol.
38: 4021-4025
[Abstract]
[Full Text]
-
Chen, Y. C., Eisner, J. D., Kattar, M. M., Rassoulian-Barrett, S. L., LaFe, K., Yarfitz, S. L., Limaye, A. P., Cookson, B. T.
(2000). Identification of Medically Important Yeasts Using PCR-Based Detection of DNA Sequence Polymorphisms in the Internal Transcribed Spacer 2 Region of the rRNA Genes. J. Clin. Microbiol.
38: 2302-2310
[Abstract]
[Full Text]
-
Sugita, T., Takashima, M., Ikeda, R., Nakase, T., Shinoda, T.
(2000). Intraspecies Diversity of Cryptococcus laurentii as Revealed by Sequences of Internal Transcribed Spacer Regions and 28S rRNA Gene and Taxonomic Position of C. laurentii Clinical Isolates. J. Clin. Microbiol.
38: 1468-1471
[Abstract]
[Full Text]
-
Henry, T., Iwen, P. C., Hinrichs, S. H.
(2000). Identification of Aspergillus Species Using Internal Transcribed Spacer Regions 1 and 2. J. Clin. Microbiol.
38: 1510-1515
[Abstract]
[Full Text]
Top
Abstract
Introduction
