Previous Article | Next Article 
Journal of Clinical Microbiology, August 1999, p. 2461-2465, Vol. 37, No. 8
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Comparison of the Second-Generation Digene Hybrid
Capture Assay with the Branched-DNA Assay for Measurement of
Hepatitis B Virus DNA in Serum
Stephen K. N.
Ho,
Tak
Mao
Chan,*
Ignatius K. P.
Cheng, and
Kar Neng
Lai
Department of Medicine, Queen Mary Hospital,
The University of Hong Kong, Hong Kong, China
Received 22 December 1998/Returned for modification 4 March
1999/Accepted 27 April 1999
 |
ABSTRACT |
The optimal hepatitis B virus (HBV) DNA quantitative assay for
clinical use remains to be determined. We examined the sensitivity, linearity, and variability of a novel second-generation antibody capture solution hybridization assay, the Digene Hybrid Capture II
assay (HCII), and compared it with another widely used solution hybridization assay, the branched-DNA (bDNA) assay (Quantiplex; Chiron
Corp.). Our results showed similar and satisfactory assay linearity
values, as well as interassay and intra-assay variability values, for
both HCII and bDNA assays across different ranges of HBV DNA.
Ninety-one percent of 102 serum samples from hepatitis B surface
antigen-positive patients showed concordant results with the two
assays. The HCII assay was more sensitive than the bDNA assay by 1 dilution, with the lowest reading being 0.9 pg/ml (3.8 pg/ml by bDNA
assay). The HBV DNA seropositivity rates for the 102 samples were 58, 67, and 97% by bDNA, HCII, and nested PCR, respectively. While the
relationship between results obtained with the bDNA assay and those
with the HCII assay was nonlinear, with the bDNA assay yielding values
2.83 ± 0.92-fold higher than those of the HCII assay, especially at
high HBV DNA levels, a linear relationship was observed between the two
sets of data after logarithmic conversion. The formula for interassay
conversion of results was derived as follows: HBV DNA by HCII
(picograms per milliliter) = 3.19 × [HBV DNA by bDNA
(megaequivalents per milliliter)]0.866. The HCII assay was
technically less complex and required a shorter assay time (4 h) than
the bDNA assay (24 h). We conclude that the HCII assay compares
favorably with the bDNA assay and offers the additional advantages of
increased sensitivity and shorter assay time. The increased sensitivity
should be particularly useful in monitoring the efficacy of antiviral
therapies and detecting the emergence of drug-resistant HBV mutants.
 |
INTRODUCTION |
Hepatitis B virus (HBV) infection is
a major cause of chronic hepatitis, cirrhosis, and hepatocellular
carcinoma and accounts for 1 million deaths annually (5,
13). Information on the virus load and the replicative activity
of HBV is of paramount importance in the management of patients with
chronic HBV infection, especially after the recent advent of
medications which can effectively suppress HBV replication, such as the
nucleoside analogues. Serological parameters which have been used in
this regard include the hepatitis B e antigen (HBeAg) status, DNA
polymerase, HBV DNA status by qualitative methods such as PCR or
semiquantitative dot blot hybridization, and more recently HBV DNA
quantitation by solution hybridization (8, 11, 13). The
direct and quantitative nature of the latter makes it a useful clinical
test to monitor serially the efficacy of antiviral therapy (7, 12,
14).
Solution hybridization techniques for HBV DNA quantitation can utilize
radioactive (e.g., Genostics; Abbott Laboratories), antibody capture
(e.g., Hybrid-Capture; Murex Diagnostics Ltd.), or branched-DNA (bDNA)
signal detection systems (e.g., Quantiplex; Chiron Corp.). Comparisons
among these assays are complicated by variations in methodology,
standards, and units. The bDNA assay is the most sensitive and precise
among the three (1, 2, 16). Since a universal standard is
lacking and the bDNA assay both is technically intricate and requires a
long assay time, the optimal choice of quantitative HBV DNA assay for
clinical use remains to be defined.
Recently, a novel (second-generation) antibody capture solution
hybridization HBV DNA quantitative assay (Digene Hybrid Capture II
assay [HCII]; Digene Corp., Beltsville, Md.) has offered sensitivity improved over that of the bDNA assay. In this study, we evaluated the
sensitivity, specificity, linearity, and technical complexity of this
novel HCII assay and compared it with the bDNA assay. Correlations
between results obtained with the HCII and those with the bDNA assay
were examined, and an equation was derived for the conversion of
results between the two quantitative assays.
 |
MATERIALS AND METHODS |
Serum samples from 102 hepatitis B surface antigen
(HBsAg)-positive patients and 22 HBsAg-negative controls were assayed
for HBV DNA by (i) HCII assay, (ii) bDNA assay, and (iii) an in-house nested PCR (nPCR) assay. The patients were randomly included from known
chronic HBV carriers attending regular follow-up for serial monitoring
of their liver status. Blood samples were centrifuged within 4 h
to obtain the serum fractions, which were then aliquoted and kept at
80°C before assay.
HCII assay.
The Digene HCII (standard) assay (Digene Corp.)
quantitates HBV DNA by solution hybridization, followed by
immunocapture and chemiluminescent signal detection. The assay protocol
was according to the manufacturer's instructions. Briefly, 30 µl of
denaturing reagent was added to each microplate well containing 30 µl
of test samples or HBV DNA standards (0 to 6,000 pg/ml). The plate was
incubated at 65°C for 30 min for the lysis of HBV and DNA denaturation. RNA-DNA hybridization was achieved by adding 30 µl of
RNA probe (specific for HBV ad and ay strains) to
each well and incubating the wells at 65°C for 60 min. Seventy-five
microliters of the hybrid-containing solution was then transferred into
RNA-DNA capture wells and shaken (Thermolyne Maxi-Mix III) at 1,100 rpm at room temperature for 60 min. The solution in the wells was then
removed by aspiration. Seventy-five microliters of alkaline phosphatase-conjugated antibodies to RNA-DNA hybrids was added to each
well and incubated at room temperature for 30 min. After six washings,
75 µl of chemiluminescent substrate was added, and light emission
after 15 min was measured by a chemiluminometer (DML 2000 luminometer;
Digene Corp.). Results were expressed in picograms per milliliter
according to the plot of standards. The sensitivity according to the
manufacturer was 0.5 pg/ml or 0.142 × 106 copies/ml.
bDNA assay.
The bDNA assay (Quantiplex; Chiron Corp.) is a
sandwich nucleic acid hybridization assay. A set of oligonucleotide
probes bind single-stranded HBV DNA to a solid phase, which is detected by a second set of oligonucleotide probes. bDNA then serves to amplify
the signal, which is generated by adding alkaline
phosphatase-conjugated probes for bDNA and dioxetane as substrate
(6). The assay protocol was according to the manufacturer's
instructions. Briefly, 10 µl of test samples or HBV DNA-positive
standards (0.5 to 4,400 MEq/ml) was added to 10 µl of lysis reagent
on a microwell plate coated with oligonucleotide probes and incubated
for 30 min at 63°C to release HBV DNA from the viral particles. Ten
microliters of the second set of probes in denaturing buffer was then
added to the wells and incubated for 30 min at 63°C. Ten microliters of neutralizing reagent was then added, and the hybridization process
continued for 16 h. After washing, 40 µl of bDNA amplifiers was
added and incubated for 30 min at 53°C. Forty microliters of alkaline
phosphatase-conjugated probes was then added to each well and incubated
for 15 min at 53°C. After washing, 30 µl of dioxetane substrate was
added. The plate was incubated for 25 min at 37°C in the Chiron
luminometer, and light emission was measured for each well. The result
of HBV DNA level, expressed as megaequivalents per milliliter, was
generated by software supplied by the manufacturer. The sensitivity
according to the manufacturer was 0.7 MEq/ml (0.7 × 106 copies/ml) or 2.5 pg/ml (1 MEq/ml = 3.53 pg/ml
[9]).
nPCR assay.
The nPCR was performed according to a previously
published protocol (3). The primer sets for the HBV core
region were GGAGTGTGGATTCGCACTCCTCC (map positions 2269 to
2288) and ATACTAACATTGAGATTCCC (2457 to 2438) for the
first-round PCR and AGACCACCAAATGCCCCTAT (2299 to 2318) and
GATCTTCTGCGACGCGGCGA (2429 to 2410) for the second round. Briefly, 10 µl of serum was mixed with 8 µl of 0.2 M NaOH solution and incubated at 37°C for 1 h and then at 98°C for 5 min. Two microliters of 0.5 M Tris-HCl was added to bring the pH to 8. Eighty
microliters of the PCR solution, with 10 mM Tris-HCl (pH 8.3), 1.5 mM
MgCl2, 50 mM KCl, 200 µM (each) deoxyribonucleoside triphosphate, 1 µM (each) first-round primers, and 1.25 µl of Taq polymerase, was then added. The mixture was heated to
95°C for 5 min, followed by 30 PCR cycles of 95°C for 1 min, 55°C
for 1 min, and 72°C for 1 min in a thermal cycler (PTC-100; MJ
Research, Watertown, Mass.). For the second-round PCR, 5 µl of the
first-round PCR product was added to 40 µl of the second-round
reaction mixture prepared as described above except that the second set
of primers was used. The nPCR product was electrophoresed in a
polyacrylamide gel and visualized under UV light after staining with
ethidium bromide. Detection of a DNA band of 130 bp denoted positivity. All the samples were tested in duplicate, and positive and negative controls were included in each run. Our in-house nPCR assay had a
sensitivity of 1 fg/ml (300 copies/ml).
Statistics.
Correlation between HBV DNA results obtained
with the HCII and those with bDNA assays was examined by Pearson's method.
 |
RESULTS |
A serum sample with a high HBV DNA concentration (7,081 pg/ml by
bDNA assay and 2,164 pg/ml by HCII assay) was tested upon serial
dilution with normal human serum at 1/10, 1/100, 1/1,000, and 1/2,000
dilutions in order to determine and compare the sensitivity and
performance linearity values of the bDNA and HCII assays. Repeated
testing of this dilution series three times yielded consistent results.
The sensitivity limit for the bDNA assay was at a 1/1,000 dilution,
giving an assay result of 3.8 pg/ml, while that for the HCII assay was
at a dilution of 1/2,000, yielding an assay result of 0.9 pg/ml.
Linearity values of the two assays were similar (Fig.
1).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Graph showing the linearity of the HCII and bDNA assay
results as determined by testing a standard serum sample with a high
HBV DNA concentration at serial dilutions.
|
|
To compare the precision of the bDNA and HCII assays, three serum
samples with HBV DNA levels previously determined to be at the low (L)
(2.5 to <40 pg/ml), medium (M) (40 to 3,900 pg/ml), and high (H)
(>3,900 to 17,000 pg/ml) levels according to the standard ranges of
bDNA assay (actual readings of 37.5, 909.2, and 10,525.3 pg/ml,
respectively) were tested six times with both assays. The bDNA assay
yielded HBV DNA levels 1.7 to 3.6 times higher than those obtained with
the HCII assay (Table 1). The intra-assay
and interassay coefficients of variation (CV) were similar for the two
assays (P value not significant).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Comparison of corresponding values and intra- and
interassay variations when identical serum samples with L, M, and H
levels of HBV DNA were tested with the HCII and the bDNA assays
|
|
The prevalence of HBV DNA as determined by bDNA, HCII, and nPCR methods
in the 102 HBsAg-positive samples and 22 HBsAg-negative samples is
given in Table 2. The HBV DNA
seropositivity rate was highest with the nPCR assay, followed by the
HCII assay and then the bDNA assay, irrespective of the HBeAg-antibody
status. The two quantitative (bDNA and HCII) assays gave 59 concordant positive and 34 concordant negative results, giving an overall concordance rate of 91% (93 of 102). All the bDNA-positive samples tested positive with the HCII assay. In contrast, nine samples were
HCII positive but bDNA negative, giving a sensitivity gain of 13% (9 of 68) for the HCII assay. The HBV DNA concentration of the nine serum
samples was 3.8 ± 4.9 pg/ml (range, 0.9 to 14.9 pg/ml). None of
the three assays detected HBV DNA in the 22 HBsAg-negative serum
samples.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Prevalence of HBV DNA as detected by bDNA, HCII, and nPCR
methods in relation to their HBeAg and anti-HBe status in 102 HBsAg-positive samples and in 22 HBsAg-negative samples
|
|
HBV DNA levels measured with the HCII assay were compared to
corresponding values determined with the bDNA assay in 55 of the 59 concordant positive samples (Fig. 2).
Four samples yielded readings higher than the detection range of both
assays and were not included in this comparison. The bDNA assay yielded
increasingly higher values relative to the HCII readings as the HBV DNA
concentration increased. The ratio of corresponding bDNA to HCII
results (in picograms per milliliter) was 2.83 ± 0.92 (range,
0.65 to 4.31). A good linear relationship was observed when the
logarithmic conversions of HBV DNA levels determined by the two assays
were plotted against each other (r2 = 0.985, slope = 1.155) (Fig. 3).
The following formulae were derived accordingly for the interassay
conversion of results: log [HBV DNA by bDNA
(picograms per milliliter)] = 1.155 × log [HBV DNA by HCII
(picograms per milliliter)]
0.0337 or simplified as HBV DNA by bDNA (megaequivalents per milliliter) = (1) 0.262 × [HBV DNA by HCII (picograms per
milliliter)]1.155 HBV DNA by HCII (picograms
per milliliter) = 3.19 × (2)[HBV DNA by bDNA
(megaequivalents per milliliter)]0.866

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
Comparison of corresponding HBV DNA levels as determined
by the HCII or the bDNA assay in 55 concordant positive serum
samples.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
A log-log plot of HBV DNA concentrations in 55 concordant positive serum samples as determined by the bDNA and HCII
assays.
|
|
With regard to the complexity of assay procedures, the
HCII assay was technically simpler and yielded results faster than the
bDNA assay since it involved fewer steps and did not require many
freshly prepared agents (Table 3).
 |
DISCUSSION |
Although the novel HCII assay claimed to offer improved
sensitivity compared to other quantitative solution hybridization HBV
DNA assays currently in use, these assays have not been directly compared against one other. Due to the lack of a universal HBV DNA
standard (1, 2, 16), the identical blood sample can yield
markedly different HBV DNA levels when tested by different assays. This
represents a major difficulty in the interpretation of data in the
literature. In this study, we not only examined the reliability of the
HCII assay but also compared its results with those obtained by the
bDNA assay and derived formulae for interconversion. In addition, the
technical aspects and the assay duration of these two quantitative
assays were compared, since these properties have a major bearing on
their usefulness in the clinical management of patients. Our results
showed satisfactory and similar linearity, intra-assay variability, and
interassay variability values for the HCII and bDNA assays, which were
applicable across different ranges of HBV DNA.
We demonstrated an increase in the sensitivity for HBV DNA detection
for the HCII assay compared to the bDNA assay, from a 1/1,000 to a
1/2,000 dilution, with corresponding HBV DNA levels going down from 3.8 to 0.9 pg/ml. The increased sensitivity may relate to the higher
starting sample volume used in the HCII assay, which was 30 µl
compared to the 10 µl used in the bDNA assay. Despite the apparently
small (twofold) difference in sensitivity, testing of serum samples
from HBsAg-positive patients showed a 13% gain in HBV DNA detection
rate with the HCII assay. The difference in HBV DNA detection rates
between the two assays is influenced by the proportion of tested
samples with low viremia levels, which may test positive by the HCII
assay but negative by the bDNA assay. In this regard, our study
population was randomly chosen from HBsAg-positive patients being
monitored for serial liver status. From a clinical perspective, the
increased sensitivity of the HCII assay at low HBV DNA levels would be
a significant advantage in monitoring patients to confirm efficacy of
antiviral therapy and to detect the emergence of drug-resistant mutants.
Although the nPCR assay is most sensitive, its nonquantitative nature
and the technical complexity hinder its routine clinical use. Another
commercially available HBV DNA assay, the Amplicor HBV Monitor (Roche
Diagnostic Systems, Basel, Switzerland), quantitates serum HBV DNA by
competitive PCR with a quantitation standard and a microwell plate
nonradioactive hybridization and detection system. The Amplicor assay
has been reported to be reliable and sensitive, with a detection limit
of 102 to 103 copies of HBV DNA per ml (4,
10). We have not included the Amplicor assay in the present study
since our main objective was to compare the solution hybridization
quantitative assays with regard to their assay performance and clinical
utility. In this context, the Amplicor assay is also more
labor-intensive, with a longer assay duration, and about three times
more expensive than the HCII assay. In view of the inherent technical
and financial implications, it would be difficult to establish the
Amplicor assay as a routine test in clinical practice.
Comparison of concordant samples showed that the bDNA assay yielded
higher values compared to corresponding readings with the HCII assay.
The difference was more marked at high HBV DNA levels. This nonlinear
relationship between the two sets of readings was exemplified by the
conversion factors ranging from 0.65 to 4.31. We observed a good linear
correlation when the results by the two assays were plotted against
each other after logarithmic conversion. The ensuing formulae for
interconversion of results should be helpful in the interpretation and
comparison of data generated with these assays.
Apart from precision and reliability, the cost, technical complexity,
and result turnaround time have important bearings on the usefulness of
an assay in the clinical management of patients. In this regard, the
HCII assay offers the advantages of being technically simpler and
faster in yielding results than the bDNA assay. In conclusion, our
results show that the new HCII assay is a sensitive and reliable assay
for HBV DNA quantitation. Its enhanced sensitivity, reduced technical
complexity, and shortened assay time compared to other quantitative HBV
DNA assays make it a useful test in the management of patients with HBV infection.
 |
ACKNOWLEDGMENTS |
This study was supported by the CRCG Research Grant
(10202135/20428/20600/323/01) and the Lee Wing Tat Renal Research Fund of The University of Hong Kong.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Medicine, Queen Mary Hospital, Pokfulam Rd., Hong Kong, China. Phone: 852 2855 4041. Fax: 852 2872 5828. E-mail: dtmchan{at}hku.hk.
 |
REFERENCES |
| 1.
|
Aspinall, S.,
M. J. Mphahlele,
I. Peenze, and A. D. Steele.
1995.
Detection and quantitation of hepatitis B virus DNA: comparison of two commercial hybridization assays with polymerase chain reaction.
J. Viral Hepatitis
2:107-111[Medline].
|
| 2.
|
Butterworth, L. A.,
S. L. Prior,
P. J. Buda,
J. L. Faoagali, and W. G. E. Cooksley.
1996.
Comparison of four methods for quantitative measurement of hepatitis B viral DNA.
J. Hepatol.
24:686-691[Medline].
|
| 3.
|
Chung, H. T.,
A. S. F. Lok, and C. L. Lai.
1993.
Re-evaluation of -interferon treatment of chronic hepatitis B using polymerase chain reaction.
J. Hepatol.
17:208-214[Medline].
|
| 4.
|
Gerken, G.,
J. Gomes,
P. Lampertico,
M. Colombo,
T. Rothaar,
M. Trippler, and G. Colucci.
1998.
Clinical evaluation and applications of the Amplicor HBV Monitor test, a quantitative HBV DNA PCR assay.
J. Virol. Methods
74:155-165[Medline].
|
| 5.
|
Gitlin, N.
1997.
Hepatitis B: diagnosis, prevention, and treatment.
Clin. Chem.
43:1500-1506[Abstract/Free Full Text].
|
| 6.
|
Hendricks, D. A.,
B. J. Stowe,
B. S. Hoo,
J. Kolberg,
B. D. Irvine,
P. D. Neuwald,
M. S. Urdea, and R. P. Perillo.
1995.
Quantitation of HBV DNA in human serum using a branched DNA (bDNA) signal amplification assay.
Am. J. Clin. Pathol.
104:537-546[Medline].
|
| 7.
|
Hoofnagle, J. H.
1990.
Alpha-interferon therapy of chronic hepatitis B. Current status and recommendations.
J. Hepatol.
11:S100-S107.
|
| 8.
|
Kaneko, S.,
R. H. Miller,
A. M. Di Bisceglie,
S. M. Feinstone,
J. H. Hoofnagle, and R. H. Purcell.
1990.
Detection of hepatitis B virus DNA in serum by polymerase chain reaction. Application for clinical diagnosis.
Gastroenterology
99:799-804[Medline].
|
| 9.
|
Kapke, G. F.,
G. Watson,
S. Sheffler,
D. Hunt, and C. Frederick.
1997.
Comparison of the Chiron Quantiplex branched DNA (bDNA) assay and the Abbott Genostics solution hybridization assay for quantification of hepatitis B viral DNA.
J. Viral Hepatitis
4:67-75[Medline].
|
| 10.
|
Kessler, H. H.,
K. Pierer,
E. Dragon,
H. Lackner,
B. Santner,
D. Stunzner,
E. Stelzl,
B. Waitzl, and E. Marth.
1998.
Evaluation of a new assay for HBV DNA quantitation in patients with chronic hepatitis B.
Clin. Diagn. Virol.
9:37-43[Medline].
|
| 11.
|
Kuhns, M. C.,
A. L. McNamara,
R. P. Perrillo,
C. M. Cabal, and C. R. Campbell.
1989.
Quantitation of hepatitis B viral DNA by solution hybridization: comparison with DNA polymerase and hepatitis B antigen during antiviral therapy.
J. Med. Virol.
27:274-281[Medline].
|
| 12.
|
Lai, C. L.,
R. N. Chien,
N. W. Leung,
T. T. Chang,
R. Guan,
D. I. Tai,
K. Y. Ng,
P. C. Wu,
J. C. Dent,
J. Barber,
S. L. Stephenson, and D. F. Gray.
1998.
A one-year trial of lamivudine for chronic hepatitis B. Asia hepatitis lamivudine study group.
N. Engl. J. Med.
339:61-68[Abstract/Free Full Text].
|
| 13.
|
Lee, W. M.
1997.
Hepatitis B virus infection.
N. Engl. J. Med.
337:1733-1745[Free Full Text].
|
| 14.
|
Lok, A. S. F.,
C. L. Lai,
P. C. Wu, and E. K. Y. Leung.
1988.
Long-term follow-up in a randomized controlled trial of recombinant 2-interferon in Chinese patients with chronic hepatitis B infection.
Lancet
ii:298-302.
|
| 15.
|
Scotto, J.,
M. Hadchouel,
C. Hery,
J. Yvart,
P. Tiollais, and C. Brechot.
1983.
Detection of hepatitis B virus DNA in serum by a simple spot hybridization technique: comparison with results for other viral markers.
Hepatology
3:279-284[Medline].
|
| 16.
|
Zaaijer, H. L.,
F. ter-Borg,
H. T. Cuypers,
M. C. Hermus, and P. N. Lelie.
1994.
Comparison of methods for detection of hepatitis B virus DNA.
J. Clin. Microbiol.
32:2088-2091[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, August 1999, p. 2461-2465, Vol. 37, No. 8
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Konnick, E. Q., Erali, M., Ashwood, E. R., Hillyard, D. R.
(2005). Evaluation of the COBAS Amplicor HBV Monitor Assay and Comparison with the Ultrasensitive HBV Hybrid Capture 2 Assay for Quantification of Hepatitis B Virus DNA. J. Clin. Microbiol.
43: 596-603
[Abstract]
[Full Text]
-
Yuan, H.-J., Yuen, M.-F., Wong, D. K.-H., Sum, S. S.-M., Lai, C.-L.
(2004). Clinical Evaluation of the Digene Hybrid Capture II Test and the COBAS AMPLICOR Monitor Test for Determination of Hepatitis B Virus DNA Levels. J. Clin. Microbiol.
42: 3513-3517
[Abstract]
[Full Text]
-
Dai, C-Y, Yu, M-L, Chen, S-C, Lin, Z-Y, Hsieh, M-Y, Wang, L-Y, Tsai, J-F, Chuang, W-L, Chang, W-Y
(2004). Clinical evaluation of the COBAS Amplicor HBV monitor test for measuring serum HBV DNA and comparison with the Quantiplex branched DNA signal amplification assay in Taiwan. J. Clin. Pathol.
57: 141-145
[Abstract]
[Full Text]
-
Ho, S. K.N., Yam, W.-C., Leung, E. T.K., Wong, L.-P., Leung, J. K.H., Lai, K.-N., Chan, T.-M.
(2003). Rapid quantification of hepatitis B virus DNA by real-time PCR using fluorescent hybridization probes. J Med Microbiol
52: 397-402
[Abstract]
[Full Text]
-
Kawaguchi, K., Kaneko, S., Honda, M., Kawai, H. F., Shirota, Y., Kobayashi, K.
(2003). Detection of Hepatitis B Virus DNA in Sera from Patients with Chronic Hepatitis B Virus Infection by DNA Microarray Method. J. Clin. Microbiol.
41: 1701-1704
[Abstract]
[Full Text]
-
Marin, I. J., Poljak, M., Seme, K., Meglic-Volkar, J., Maticic, M., Lesnicar, G., Brinovec, V.
(2001). Comparative Evaluation of Semiautomated COBAS AMPLICOR Hepatitis B Virus (HBV) MONITOR Test and Manual Microwell Plate-Based AMPLICOR HBV MONITOR Test. J. Clin. Microbiol.
39: 758-761
[Abstract]
[Full Text]