Previous Article | Next Article ![]()
Journal of Clinical Microbiology, September 1999, p. 3025-3028, Vol. 37, No. 9
Department of Medical Microbiology, Academic
Medical Centre, University of Amsterdam, 1105 AZ Amsterdam, The
Netherlands
Received 17 November 1998/Returned for modification 28 January
1999/Accepted 28 May 1999
Borrelia burgdorferi sensu lato A14S was cultured from
a skin biopsy specimen of a patient with erythema migrans in The
Netherlands. This isolate had a unique DNA fingerprint pattern compared
to 135 other B. burgdorferi sensu lato isolates. In this
study, the isolate A14S was further characterized by protein analysis
with sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE) and reactivity with various monoclonal antibodies. In
addition, the 16S rRNA, ospA, and ospC genes,
as well as the 5S-23S rRNA intergenic spacer DNA, were amplified by
PCR, cloned, and sequenced. SDS-PAGE protein profiles and phylogenetic
analysis based on all of the analyzed genes confirmed that B. burgdorferi sensu lato A14S was phenotypically and genetically
different from the three human pathogenic species B. burgdorferi sensu stricto, Borrelia garinii, and
Borrelia afzelii, as well as from other B. burgdorferi sensu lato species. Our findings indicate that
Borrelia genomic groups or isolates other than the three
well-known human pathogenic species may also cause human Lyme borreliosis.
Lyme borreliosis (LB) is a worldwide
multisystemic infection transmitted to humans by the bite of an
infected tick of the genus Ixodes. Erythema migrans, an
early characteristic skin lesion, is relatively consistent and is found
in about 50% of LB cases (17). Borrelia
burgdorferi sensu lato, the causative bacterium of LB, is
genetically divergent and has been divided into several species or
genomic groups. These include B. burgdorferi sensu stricto,
Borrelia garinii, Borrelia afzelii (1,
2), Borrelia japonica (6), Borrelia
valaisiana (21), Borrelia lusitaniae (8), Borrelia andersonii (10),
Borrelia tanukii, Borrelia turdi (5),
and Borrelia bissettii (formerly genomic group DN127) (14). B. burgdorferi sensu stricto, B. garinii, and B. afzelii have been cultured from
patients and are thought to be responsible for human LB. Recently,
Picken et al. (12, 18) reported that nine B. burgdorferi isolates from patients in Slovenia were closely related to the North American isolate 25015, a member of B. bissettii. Thus, strains belonging to B. bissettii may
also cause human disease.
In 1992, we cultured a B. burgdorferi sensu lato isolate,
A14S, from the skin biopsy specimen of a Dutch patient with erythema migrans who had contracted the disease in The Netherlands. This isolate
could not be typed based on its reactivity with various monoclonal
antibodies (MAbs) against B. burgdorferi sensu lato (20). Also, it showed a unique pattern in ribotyping,
differing from B. burgdorferi sensu stricto, B. garinii, and B. afzelii (20). In addition, a
striking genetic difference between this isolate and 135 other
LB-related Borrelia isolates was noted in the randomly
amplified polymorphic DNA (RAPD) fingerprinting analysis (22). Therefore, Borrelia isolate A14S could well
represent a novel B. burgdorferi sensu lato strain causing
human LB.
In the present study, isolate A14S at low passage (passages 5 to 10)
was further analyzed by protein profiling with sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and reactivity
with MAbs against different outer surface proteins of B. burgdorferi sensu lato. The 16S rRNA, ospA, and
ospC genes, as well as the 5S-23S rRNA intergenic spacer
from this isolate, were amplified by PCR, sequenced, and compared to
those from B. burgdorferi sensu stricto, B. garinii, and B. afzelii, the three pathogenic
Borrelia species for humans, and other species in the B. burgdorferi sensu lato complex.
SDS-PAGE was performed as described previously (20). The
protein profile of isolate A14S was clearly different from those of the
representative isolates of B. burgdorferi sensu stricto, B. garinii, B. afzelii, and B. valaisiana (Fig. 1). For example, isolate A14S contained at least three unique protein bands with molecular masses of 37, 49, and 72 kDa (Fig. 1, asterisks). Apart from
its reactivity with B. burgdorferi sensu stricto-specific MAb H3TS (20), this isolate reacted with the OspA-specific
MAb LA26, which recognizes both B. burgdorferi sensu stricto
and B. afzelii. No reactivity was observed to the
OspB-specific MAb 84C and the OspC-specific MAb L22 C11, two MAbs
reactive with OspB and OspC proteins, respectively, from B. burgdorferi sensu stricto, B. garinii, and B. afzelii (data not shown).
0095-1137/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Phenotypic and Genetic Characterization of a Novel
Borrelia burgdorferi Sensu Lato Isolate from a Patient with
Lyme Borreliosis
![]()
ABSTRACT
Top
Abstract
Text
References
![]()
TEXT
Top
Abstract
Text
References

View larger version (85K):
[in a new window]
FIG. 1.
Silver-stained SDS-PAGE gel of whole-cell lysates of
B. burgdorferi sensu lato strains. Lanes 1 to 5, B. burgdorferi sensu stricto B31, B. garinii 20047, B. afzelii VS461, B. valaisiana AR-2, and
Borrelia isolate A14S, respectively. The positions of
flagellin (Fla), OspA, OspB, and OspC are indicated by arrows. The
unique protein bands of isolate A14S are marked with asterisks.
Molecular mass standards (Pharmacia) are shown on the right.
The 5S-23S spacer PCR-restriction fragment length polymorphism (RFLP) analysis has been widely applied to assess the genetic diversity of B. burgdorferi sensu lato strains and to identify Borrelia genomic groups (13). In our study, a 225-bp 5S-23S intergenic spacer from Borrelia isolate A14S was amplified by PCR. The size of this spacer was notably different in comparison to those of other European isolates from five different Borrelia species, which ranged from 246 to 257 bp (13). The PCR amplicon of isolate A14S was sequenced directly as described previously (21). Digestion of this amplicon with MseI resulted in three fragments with sizes of 106, 68, and 51 bp, respectively (data not shown). This MseI restriction pattern was different from previously reported patterns A to Q from other LB-related Borrelia species (11, 13) and was designated pattern R. Sequence analysis of the 5S-23S intergenic spacer DNA of isolate A14S showed only 91.6, 92.9, 92.4, and 93.3% identity to the type strains of B. burgdorferi sensu stricto B31, B. garinii 20047, B. afzelii VS461, and B. bissettii DN127, respectively. At 10 positions, nucleotides differing between all type strains of these B. burgdorferi sensu lato species and isolate A14S could be identified (Fig. 2).
|
For further evaluation of the phylogeny of Borrelia isolate A14S, the highly conserved 16S rRNA gene from this isolate was amplified by PCR with primer BRNA8 (5' ACGCTGGCAGTCGTCTTA 3', positions 33 to 55, B. burgdorferi B31 numbering [3]) (22) and primer UniB (5' T[A/C]AAGGAGGTGATCCAGC 3', positions 1540 to 1522) as described previously (22). The PCR amplicon was cloned directly into the PCR2.1 vector and transformed into Escherichia coli INV"F' cells by following the manufacturer's instructions (Invitrogen BV, Leek, The Netherlands). Subsequently, plasmid DNA from three recombinant colonies containing the amplified fragment was prepared by using a plasmid minipreparation kit (Qiagen GmbH, Hilden, Germany). DNA sequence was determined by the dideoxy chain-termination technique in an ABI 373A sequencer by using either the Dye terminator or the Dye primer cycle sequencing kit (Applied Biosystems, Inc., Foster City, Calif.) with additional custom-synthesized primers. A phylogenetic tree was constructed by using a neighbor-joining method with Kimura's two-parameter distance algorithm in the MEGA program (7).
A nearly complete (1,503-bp) 16S cDNA was amplified from isolate A14S by PCR. Sequence analysis showed that it possessed more than 98.5% similarity with the five LB Borrelia species occurring in Europe, B. burgdorferi sensu stricto (B31, 98.9%), B. garinii (20047, 99.2%). B. afzelii (DK1, 99.0%), B. valaisiana (VS116, 98.7%), and B. lusitaniae (99.1%), but less than 97% similarity with B. japonica (HO14, 95.5%), B. andersonii (19857, 96.6%), and B. bissettii (DN127, 96.3%), which have been isolated mainly in Japan (B. japonica) and North America (B. andersonii and B. bissettii). This finding suggested that Borrelia isolate A14S was closely related to the European Borrelia species. Only 13, 11, and 17 nucleotide substitutions in Borrelia isolate A14S were identified when its 16S rRNA gene was compared to the corresponding genes from B. burgdorferi sensu stricto (B31), B. garinii (20047), and B. afzelii (DK1), respectively. It is noteworthy that some of these nucleotide substitutions in the 16S rRNA gene of Borrelia isolate A14S occurred in the BfaI restriction site, which would allow easy distinction of A14S from the three Borrelia species causing human LB (8). Like other newly described Borrelia species such as B. lusitaniae (8), B. tanukii, and B. turdi (5), isolate A14S constituted an independent branch in the phylogenetic tree based on its 16S rRNA gene sequence (Fig. 3), indicating that isolate A14S represents a new Borrelia genomic group in the B. burgdorferi sensu lato complex.
|
The ospA gene of Borrelia isolate A14S was
amplified from genomic DNA by PCR with primer OspA1 (5'
GGAGAATATATTATGAAA 3', positions
12 to 6) and OspA2 (5'
CTCCTTATTTTAAAGCG 3', positions 826 to 809) as described by
Dykhuizen et al. (3). Five recombinant colonies were
selected and sequenced. An open reading frame of 822 bp was identified
from each of the recombinants. No sequence discrepancy was found among
these colonies. The nucleotide sequence of the ospA gene of
isolate A14S had 87.6, 88.0, 88.6, and 87.3% identity to the
ospA sequences of B. burgdorferi sensu stricto B31, B. garinii PBi, B. afzelii VS461, and
B. bissettii 25015, respectively. The protein in isolate
A14S encoded by this gene contained 273 amino acids and had a deduced
molecular mass of 29.5 kDa. Phylogenetic analysis based on the deduced
amino acid sequences of the OspA proteins of isolate A14S and isolates
from other B. burgdorferi sensu lato species was well in
accordance with results from 16S rRNA gene sequence analysis (data not
shown). Borrelia isolate A14S constituted a separate branch
in both phylogenetic trees. Each of the other clusters in these
phylogenetic trees corresponded to one of the earlier-defined
Borrelia species.
Previous studies showed that among Borrelia strains ospC is more polymorphic than ospA and could be divided into at least 35 different ospC RFLP patterns (9). Despite the high genetic heterogeneity of ospC, however, a species-specific motif has been identified in the deduced amino acid sequences of OspC from a number of B. burgdorferi sensu lato strains (4, 9). In this study, the ospC gene from Borrelia isolate A14S was amplified by PCR with primer OspC-N (5' CACAAATTAATGAAAAAGAATACA 3') and primer OspC-C (5' CCAGTTACTTTTTTAAAACAAATTA 3'), which were predicted to yield an approximately 650-bp amplicon (9). Unexpectedly, a predominant large fragment with a size between 1.0 and 1.1 kb was obtained in our PCR, while a very weak band at 0.65 kb was also observed. Cloning and sequencing of the larger fragment confirmed that it consisted of a 633-bp complete ospC gene as well as a 403-bp flanking sequence at the 3' end. An 8-bp deletion occurring at the original primer binding site in the flanking sequence of ospC caused a mismatch of primer OspC-C with the sequence of the ospC gene of A14S. The nucleotide sequence of the ospC gene of isolate A14S showed 83.1, 83.3, 82.9, and 78.6% identity to the ospC sequences of B. burgdorferi sensu stricto B31, B. garinii 20047, B. afzelii VS461, and B. bissettii 25015, respectively. Digestion of the ospC gene from Borrelia isolate A14S with DraI yielded two fragments with sizes of 154 and 479 bp. This RFLP pattern, as well as the RFLP pattern after DpnII digestion, differed from all of the ospC RFLP patterns from B. burgdorferi sensu stricto, B. garinii, and B. afzelii reported by Livey et al. (9).
The deduced translation product (OspC) from the 633-bp ospC gene of Borrelia isolate A14S contained 210 amino acids and had a molecular mass of 22.2 kDa. Its amino acid sequence from positions 23 to 34 of Borrelia isolate A14S differed from that of the species-specific motifs described for other Borrelia species or genomic groups. A nucleotide T-to-G conversion at position 90 of the ospC gene of isolate A14S would result in an amino acid change from an Asn to a Lys residue. Such a conversion has been reported previously for only one B. garinii isolate from Denmark (strain DK35) (19), but the difference in amino acids at positions 29 and 35 distinguishes the two strains.
It seems unlikely that the Borrelia isolate A14S is a mixture of multiple Borrelia species, since this isolate possessed some unique nucleotides in its 16S rRNA and ospC genes which were definitely different from those of Borrelia species in the B. burgdorferi sensu lato complex. It is also highly unlikely that the differences between isolate A14S and other Borrelia species are a result of in vitro passage. In vitro passage of B. burgdorferi can lead to plasmid loss, as well as changes in antigenic expression, and subsequently to differences in SDS-PAGE patterns and reactivities with MAbs (15, 16). However, the 16S rRNA, ospA, and ospC genes, as well as the 5S-23S intergenic spacer sequences, are not subject to major alteration by in vitro passage. On the basis of our present study, as well as of findings obtained by ribotyping (20) and RAPD fingerprinting analysis (22), we conclude that Borrelia isolate A14S does not belong to B. burgdorferi sensu stricto, B. garinii, and B. afzelii, the three Borrelia species pathogenic to humans. Based on the ospA, ospC, and 16S rRNA gene sequence analysis, 5S-23S rRNA intergenic spacer RFLP pattern (this study), and RAPD fingerprinting (22), isolate A14S also clearly differs from B. bissettii, the fourth genomic group recently shown to be able to cause human LB, as well as from other LB-associated Borrelia species. Therefore, this isolate most likely represents a new Borrelia genomic group, which is the fifth Borrelia genomic group with culture-confirmed pathogenic potential for causing human LB, besides B. burgdorferi sensu stricto, B. garinii, B. afzelii, and B. bissettii.
Nucleotide sequence accession numbers. The 16S rRNA, ospA, ospC, and 5S-23S intergenic spacer sequences of isolate A14S that we determined in this study have been assigned GenBank accession no. AF102056, AF102057, AF102058, and U76616, respectively.
| |
ACKNOWLEDGMENTS |
|---|
We thank Erol Fikrig for critical reading of the manuscript and Wim van Est for photography.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Medical Microbiology, L1-163, Academic Medical Centre, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands. Phone: 31-20-5664863. Fax: 31-20-6979271. E-mail: A.P.vanDam{at}amc.uva.nl.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Baranton, G.,
D. Postic,
I. Saint Girons,
P. Boerlin,
J. C. Piffaretti,
M. Assous, and P. A. Grimont.
1992.
Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461 associated with Lyme borreliosis.
Int. J. Syst. Bacteriol.
42:378-383 |
| 2. | Canica, M. M., F. Nato, L. du Merle, J. C. Mazie, G. Baranton, and D. Postic. 1993. Monoclonal antibodies for identification of Borrelia afzelii sp. nov. associated with late cutaneous manifestations of Lyme borreliosis. Scand. J. Infect. Dis. 25:441-448[Medline]. |
| 3. |
Dykhuizen, D. E.,
D. S. Polin,
J. J. Dunn,
B. Wilske,
V. Preac-Mursic,
R. J. Dattwyler, and B. J. Luft.
1993.
Borrelia burgdorferi is clonal: implications for taxonomy and vaccine development.
Proc. Natl. Acad. Sci. USA
90:10163-10167 |
| 4. | Fukunaga, M., A. Hamase, K. Okada, H. Inoue, Y. Tsuruta, K. Miyamoto, and M. Nakao. 1996. Characterization of spirochetes isolated from ticks (Ixodes tanuki, Ixodes turdus, and Ixodes columnae) and comparison of the sequences with those of Borrelia burgdorferi sensu lato strains. Appl. Environ. Microbiol. 62:2338-2344[Abstract]. |
| 5. | Fukunaga, M., A. Hamase, K. Okada, and M. Nakao. 1996. Borrelia tanukii sp. nov. and Borrelia turdae sp. nov. found from ixodid ticks in Japan: rapid species identification by 16S rRNA gene-targeted PCR analysis. Microbiol. Immunol. 40:877-881[Medline]. |
| 6. | Kawabata, H., T. Masuzawa, and Y. Yanagihara. 1993. Genomic analysis of Borrelia japonica sp. nov. isolated from Ixodes ovatus in Japan. Microbiol. Immunol. 37:843-848[Medline]. |
| 7. | Kumar, S., K. Tamura, and N. Masatoshi. 1993. MEGA: molecular evolutionary genetics analysis, version 1.01. Pennsylvania State University, University Park, Pa. |
| 8. |
Le Fleche, A.,
D. Postic,
K. Girardet,
O. Peter, and G. Baranton.
1997.
Characterization of Borrelia lusitaniae sp. nov. by 16S ribosomal DNA sequence analysis.
Int. J. Syst. Bacteriol.
47:921-925 |
| 9. | Livey, I., C. P. Gibbs, R. Schuster, and F. Dorner. 1995. Evidence for lateral transfer and recombination in OspC variation in Lyme disease Borrelia. Mol. Microbiol. 18:257-269[Medline]. |
| 10. | Marconi, R. T., D. Liveris, and I. Schwartz. 1995. Identification of novel insertion elements, restriction fragment length polymorphism patterns, and discontinuous 23S rRNA in Lyme disease spirochetes: phylogenetic analyses of rRNA genes and their intergenic spacers in Borrelia japonica sp. nov. and genomic group 21038 (Borrelia andersonii sp. nov.) isolates. J. Clin. Microbiol. 33:2427-2434[Abstract]. |
| 11. | Masuzawa, T., T. Komikado, A. Iwaki, H. Suzuki, K. Kaneda, and Y. Yanagihara. 1996. Characterization of Borrelia sp. isolated from Ixodes tanuki, I. turdus, and I. columnae in Japan by restriction fragment length polymorphism of rrf (5S)-rrl (23S) intergenic spacer amplicons. FEMS Microbiol. Lett. 142:77-83[Medline]. |
| 12. | Picken, R. N., Y. Cheng, F. Strle, and M. M. Picken. 1996. Patient isolates of Borrelia burgdorferi sensu lato with genotypic and phenotypic similarities of strain 25015. J. Infect. Dis. 174:1112-1115[Medline]. |
| 13. |
Postic, D.,
M. V. Assous,
P. A. D. Grimont, and G. Baranton.
1994.
Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length polymorphism of rrf (5S)- rrl (23S) intergenic spacer amplicons.
Int. J. Syst. Bacteriol.
44:743-752 |
| 14. |
Postic, D.,
N. M. Ras,
R. S. Lane,
M. Hendson, and G. Baranton.
1998.
Expanded diversity among Californian Borrelia isolates and description of Borrelia bissettii sp. nov. (formerly Borrelia group DN127).
J. Clin. Microbiol.
36:3497-3504 |
| 15. | Schwan, T. G., and W. Burgdorfer. 1987. Antigenic changes of Borrelia burgdorferi as a result of in vitro cultivation. J. Infect. Dis. 156:852-853[Medline]. |
| 16. |
Schwan, T. G.,
W. Burgdorfer, and C. F. Garon.
1988.
Changes in infectivity and plasmid profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro cultivation.
Infect. Immun.
56:1831-1836 |
| 17. | Steere, A. C. 1989. Lyme disease. N. Engl. J. Med. 263:201-205. |
| 18. | Strle, F., R. N. Picken, Y. Cheng, J. Cimperman, V. Maraspin, S. Lotric-Furlan, E. Ruzic-Sabljic, and M. M. Picken. 1997. Clinical findings for patients with Lyme borreliosis caused by Borrelia burgdorferi sensu lato with genotypic and phenotypic similarities to strain 25015. Clin. Infect. Dis. 25:273-280[Medline]. |
| 19. |
Theisen, M.,
M. Borre,
M. J. Mathiesen,
B. Mikkelsen,
A. M. Lebech, and K. Hansen.
1995.
Evolution of the Borrelia burgdorferi outer surface protein OspC.
J. Bacteriol.
177:3036-3044 |
| 20. | van Dam, A. P., H. Kuiper, K. Vos, A. Widjojokusumo, B. M. de Jongh, L. Spanjaard, A. C. Ramselaar, M. D. Kramer, and J. Dankert. 1993. Different genospecies of Borrelia burgdorferi are associated with distinct clinical manifestations of Lyme borreliosis. Clin. Infect. Dis. 17:708-717[Medline]. |
| 21. |
Wang, G.,
A. P. van Dam,
A. Le Fleche,
D. Postic,
O. Peter,
G. Baranton,
R. de Boer,
L. Spanjaard, and J. Dankert.
1997.
Genetic and phenotypic analysis of Borrelia valaisiana sp. nov. (Borrelia genomic groups VS116 and M19).
Int. J. Syst. Bacteriol.
47:926-932 |
| 22. |
Wang, G.,
A. P. van Dam,
L. Spanjaard, and J. Dankert.
1998.
Molecular typing of Borrelia burgdorferi sensu lato by randomly amplified polymorphic DNA fingerprinting analysis.
J. Clin. Microbiol.
36:768-776 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»