Previous Article | Next Article ![]()
Journal of Clinical Microbiology, January 2000, p. 133-137, Vol. 38, No. 1
Infectious Diseases Laboratory, Department of
Pathology,1 and Department of
Microbiology,4 Universidad Peruana Cayetano
Heredia, Department of Transmissible Diseases, Instituto de
Ciencias Neurológicas,5 and
Department of Public Health, School of Veterinary Medicine,
Universidad Nacional Mayor de San Marcos,6 Lima,
Peru; Mount Sinai School of Medicine, New York, New
York2; and Department of International
Health, Johns Hopkins University School of Hygiene and Public
Health, Baltimore, Maryland3
Received 5 May 1999/Returned for modification 17 May 1999/Accepted 24 August 1999
Species-specific identification of human tapeworm infections is
important for public health purposes, because prompt identification of
Taenia solium carriers may prevent further human
cysticercosis infections (a major cause of acquired epilepsy). Two
practical methods for the differentiation of cestode proglottids, (i)
routine embedding, sectioning, and hematoxylin-eosin (HE) staining and (ii) PCR with restriction enzyme analysis (PCR-REA), were tested on
samples from 40 individuals infected with T. solium
(n = 34) or Taenia saginata
(n = 6). Microscopic examination of HE staining of
sections from 24 cases, in which conserved proglottids were recovered,
clearly revealed differences in the number of uterine branches.
Distinct restriction patterns for T. solium and T. saginata were observed when the PCR products containing the
ribosomal 5.8S gene plus internal transcribed spacer regions were
digested with either AluI, DdeI, or
MboI. Both HE histology and PCR-REA are useful techniques
for differentiating T. solium from T. saginata. Importantly, both techniques can be used in zones of endemicity. HE
histology is inexpensive and is currently available in most regions of
endemicity, and PCR-REA can be performed in most hospital centers
already performing PCR without additional equipment or the use of
radioactive material.
The life cycle of Taenia
solium involves the pig as the normal intermediate host (harboring
the larval vesicles, or cysticerci) and humans as the definitive host
(harboring the adult tapeworm). Eggs are shed into the environment via
human feces, and when ingested by pigs, they develop into tissue cysts,
causing cysticercosis (5). Humans can also be infected with
the larval stage after accidental ingestion of eggs excreted in their
own feces or in the feces of another tapeworm carrier (7,
12). Human cysticercosis is endemic in most developing countries
(7, 11). It often attacks the human central nervous system
(CNS), causing a variety of neurologic symptoms, most commonly epilepsy
(9, 11, 12).
Taenia saginata and T. solium are difficult to
differentiate by parasitological examination because their eggs are
indistinguishable (18). Correct identification is important
because the consequences of human infection by these two parasites are
very different. T. saginata is relatively innocuous, since
only the intestinal tapeworm phase occurs in man, whereas infection
with T. solium has major health effects due to
extraintestinal infection by the larval or cyst phase in the CNS.
Differentiation of the two human Taenia species is based on
the number of uterine branches present in well-preserved gravid
proglottids or on the absence or presence of hooks in the scolex of the
tapeworm. Obtaining well-preserved and intact gravid proglottids or the
scolex after treatment of the patient is often difficult due to the
partial destruction of gravid proglottids or the recovery of only
immature proglottids in the stool. In our experience with niclosamide
and a ricine oil purgative, only immature proglottids were obtained for
nearly half the patients. Other methods, such as biochemical analysis of total protein (6) or zymogram patterns (14,
15), have been explored but are difficult to interpret and
inconsistent in their results.
Recently, DNA hybridization techniques have been used to differentiate
between T. solium and T. saginata (13, 19,
20). However, hybridization is best performed with radioactive
probes, which are expensive, are difficult to handle, and require
special equipment. Simpler, more easily performed diagnostic assays for the diagnosis of these two cestodes are still needed, especially for
use in developing countries. In this study we examined the utility of
two methods for the differentiation of the two human taeniid species.
The first is the use of hematoxylin-eosin (HE) staining of histological
sections of whole gravid proglottids. The second is the use of PCR and
restriction enzyme analysis (REA), which can be used to identify these
tapeworms by using DNA from proglottids whether they are gravid or not,
or from eggs. The PCR-REA we describe here is based on the
amplification of ribosomal DNA (rDNA), which has been used to
characterize the Asian taenia and to differentiate between strains of
Echinococcus granulosus (2, 3, 23). For the
differentiation of T. solium and T. saginata, we
amplified the region spanning the 3' region of the 18S and the 5'
region of the 28S ribosomal gene (including the 5.8S ribosomal gene)
and then carried out REA of the PCR product. Typical restriction
patterns were observed after electrophoresis and ethidium bromide staining.
Taenia species proglottids and eggs.
Parasitological material was obtained from 40 individuals diagnosed by
detection of Taenia species eggs upon microscopic
examination of stool or by a coproantigen detection enzyme-linked
immunosorbent assay (1). Taenia proglottids were
recovered from stool samples before or after taenicide treatment with
2 g of niclosamide followed by a purge with ricine oil
(4). The proglottids were washed repeatedly with distilled
water, followed by a final wash in 0.01 M Tris-HCl (pH 8.0) to remove
all fecal material and debris. Samples obtained in the field were
stored in 70% ethanol. A portion of the proglottids was stored at
0095-1137/0/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Differentiating Taenia solium and
Taenia saginata Infections by Simple Hematoxylin-Eosin
Staining and PCR-Restriction Enzyme Analysis
![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
70°C for later DNA isolation. The remaining tapeworm segments were
stored at 4°C in 2.5% sodium dichromate. Eggs were obtained from the
sediment of the sodium dichromate solution containing the stored
tapeworm segments after centrifugation at 3,000 × g at
room temperature for 5 min.
70°C until needed.
Other tapeworms. Diphyllobothrium latum and Hymenolepis nana worms were recovered from infected patients treated with niclosamide and were processed as described above for Taenia species. E. granulosus scolices were obtained from hydatid cysts from naturally infected sheep.
Morphological identification. After trying, with poor results, to identify Taenia species by traditional methods in which a whole gravid proglottid is squashed between two glass plates and then injected with a carmine dye by using a 26-gauge needle (22), we developed a simpler and highly reliable method for Taenia identification. The method, which utilizes histological sections stained with HE to count the uterine branches, requires an intact gravid proglottid and follows the procedure used for processing biopsy samples with HE staining. The proglottid was fixed in neutral buffered 10% formalin, embedded in paraffin, and cut into longitudinal sections of 6 µm, which were stained and mounted; then uterine branches were counted under a light microscope at a magnification of ×40. Proglottids were identified as T. solium when 10 or fewer branches arose to each side from the central uterus and as T. saginata when there were 12 or more branches (10).
We define a gravid proglottid as one that contains uterine branches filled with eggs. An immature proglottid is defined as one that does not have a fully mature reproductive system and is without eggs. A mature worm is defined as one with gravid proglottids, while an immature worm is one that does not have gravid proglottids.DNA extraction.
Frozen proglottids or cysts were homogenized
manually in a glass tissue grinder in an ice bath. The homogenate was
incubated for 1 h at 37°C with 10 volumes of lysis buffer (10 mM
Tris-HCl, 100 mM EDTA, 0.5% sodium dodecyl sulfate [pH 8.0]) to
which was added 200 µg of proteinase K (Gibco, Life Technologies)/ml.
The sample was gently vortexed before incubation for 3 h at
50°C. The DNA was then extracted with phenol-chloroform-isoamyl
alcohol (25/24/1 [wt/vol]) followed by chloroform-isoamyl alcohol
(25/24/1 [wt/vol]) (21). The DNA was precipitated with
cold ethanol and 3 M ammonium acetate at
20°C overnight and then
pelleted by centrifugation at 12,000 × g. The pellet
was then reconstituted in PCR water.
Primers. rDNA is organized into units with very strongly conserved coding regions separated by relatively poorly conserved noncoding spacer regions (internal transcribed spacer 1 [ITS1] and ITS2). ITS regions have been widely used to differentiate between strains of E. granulosus (2, 3). Because ITS regions could be too variable for identification purposes, we included in the target DNA both ITS regions and the more conserved 5.8S gene.
Two primers were used. The first primer, BD1 (5' GTCGTAACAAGGTTTCCGTA 3') (2), was designed to hybridize with the 3' region of the 18S ribosomal gene. The second primer, TSS1 (5' ATATGCTTAAGTTCAGCGGGTAATC 3'), was designed to hybridize with the 5' region of the 28S ribosomal gene (as shown in Fig. 1).
|
PCR and REA. The PCR was performed on a Perkin-Elmer Cetus thermocycler system 2400, in a total volume of 50 µl by using 100 ng of total DNA. The amplification was performed in 1× PCR buffer (Gibco, Life Technologies) containing 2.5 mM MgCl2, 0.2 mM (each) dATP, dGTP, dCTP, and dTTP, 0.5 µM each primer, and 1 U of Taq polymerase (Perkin-Elmer Cetus). Cycles for PCR consisted of 5 min at 94°C followed by 30 cycles consisting of 94°C for 1 min (denaturation), 56°C for 1 min (annealing), and 72°C for 2 min (elongation). Ten microliters of PCR product was separated by electrophoresis on a 1.0% agarose gel containing 0.5 µg of ethidium bromide/ml to confirm the presence of amplification products. In initial experiments the band was further purified with the Qiaex kit (Qiagen Inc., Chatsworth Calif.), but since this did not give superior results compared with direct digestion of the PCR product, the latter method was used throughout the remaining experiments. Seventeen microliters of the PCR product was digested in 1× enzyme buffer, 1 U of enzyme (AluI, DdeI, or MboI). Tubes containing the reaction mixture were incubated for 3 h at 37°C. Fifteen microliters of the reaction mixture was separated by horizontal electrophoresis in a 2.5% agarose gel stained with ethidium bromide.
Investigators were blinded to the identities of both PCR and histology samples.| |
RESULTS |
|---|
|
|
|---|
Over a 1-year period we obtained specimens of Taenia species from 40 patients through area hospitals or field studies. In 60% (24 of 40) of the samples, well-preserved proglottids were recovered and identified by histology. Of the remaining 40%, no intact gravid proglottid was available for histology. All 40 samples were identifiable by PCR-REA.
Using HE-stained histological sections of gravid proglottids, we easily differentiated between T. solium and T. saginata by counting the number of uterine branches present. Of the 24 samples examined histologically, 18 were identified as T. solium and 6 as T. saginata (Fig. 2). Results were similar whether the proglottid was preserved in ethanol, formalin, or sodium dichromate.
|
PCR-REA differentiation of cestode species. Specimens that were preserved in ethanol or sodium dichromate were useful for PCR amplification, but those fixed in neutral buffered formalin were not. PCR amplification with primers DB1 and TSS1 resulted in the detection of a single band of approximately 1,300 bp for all cestodes studied, including E. granulosus, H. nana, and D. latum (Fig. 3). Furthermore, PCR amplification gave the same product regardless of the stage of the cestode tested (i.e., DNA from T. solium eggs, cysts, or immature worms or from T. saginata eggs, as well as from mature worms of both species).
|
| |
DISCUSSION |
|---|
|
|
|---|
The differentiation of Taenia species is important because of their very different clinical and epidemiological consequences. Patients with T. solium proglottids have a risk of developing cysticercosis, while those with T. saginata are not at risk for this disease. Proglottids obtained from stool samples, after treatment, could easily be identified by simple HE staining of histological sections of gravid proglottids and/or by a practical molecular technique (PCR-REA). The need for these tools became apparent when we were not able to obtain scolices for identification and when carmine staining of preparations of squashed proglottids gave equivocal or uncertain results. Frequently the proglottids were partially torn, or even after staining, not all the branches could be clearly noted. Both histology and PCR-REA gave clear and definitive identification of cestode species. PCR-REA was able to identify Taenia species even when examination by histology could not be performed, because this method does not rely on the availability of intact gravid proglottids.
Histologic identification is simple, useful, and inexpensive and can be performed in any pathology or histology laboratory. It does not require any extra procedures or equipment. A careful search of journals and textbooks concerning tropical medicine or parasitology failed to find any reference to the use of this method for identification. Moreover, the proglottids can be stored and transported fixed in either sodium dichromate, alcohol, or formalin. However, this method is practical only when gravid proglottids are available. For 16 (40%) of our patients, proglottids could not be analyzed by this method because they were damaged or immature.
When PCR is available and no gravid proglottid is available, specimen identification can be confirmed by DNA analysis. The DNA-based identification techniques described by Rishi and McManus (19), Flisser et al. (8), Harrison et al. (13), and Chapman et al. (6a) are all hybridization methods not easily performed in developing countries. Compared to previously described methodologies, the PCR-REA method described here has many advantages. It avoids the use of scarce and expensive radioactive reagents and special equipment. It enables the distinction between T. solium and T. saginata to be made in only two steps and only requires the use of agarose gels stained with ethidium bromide for the visualization of bands. Fresh worms or those fixed in either dichromate or ethanol are suitable for this assay; however, formalin-fixed material did not amplify (data not shown). In addition, although the PCR-REA method was able to amplify eggs from proglottids, it was not successful in amplifying eggs obtained from fixed or fresh stool specimens.
Although ITS regions are normally used to demonstrate intraspecific variations, in our studies only one pattern was observed for each cestode species. Whether there may be differences between isolates of T. solium or T. saginata obtained from different geographical regions is still uncertain. Because species identification of T. solium and T. saginata is important for clinical and epidemiological purposes, further studies are now under way to refine these techniques and permit the detection and distinction of taenia eggs directly from clinical stool samples.
| |
ACKNOWLEDGMENTS |
|---|
We appreciate the comments of Tracy Schmitz, Iskra Tuero, and Emily Speelmon and the technical support of J. B. Phu and D. Sara.
This study was funded in part by grant number 1-U01 A135894-01 from the National Institutes for Health (NIH) and an ITREID training grant from the Fogarty International Center, NIH.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of International Health, Johns Hopkins University School of Hygiene and Public Health, 615 North Wolfe St., Baltimore, MD 21205. Phone: (410) 614 3959. Fax: (410) 614 5050. E-mail: rgilman{at}jhsph.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Allan, J. C., P. S. Craig, J. Garcia-Noval, F. Menocos, D. Lui, Y. Wang, H. Wen, P. Zhou, R. Stringer, M. Rogan, and E. Zyhle. 1992. Coproantigen detection for immunodiagnosis of echinococcosis and taeniasis in dogs and humans. Parasitology 104:347-355. |
| 2. | Bowles, J., and D. P. McManus. 1993. Rapid discrimination of Echinococcus species and strains using a polymerase chain reaction-based RFLP method. Mol. Biochem. Parasitol. 53:231-240. |
| 3. | Bowles, J., and D. P. McManus. 1994. Molecular genetic characterization of the cervid strain ('northern form') of Echinococcus granulosus. Parasitology 109:215-221. |
| 4. | Brunton, L. L. 1990. Agents affecting gastrointestinal water flux, and motility digestants and bile acids, p. 922. In A. Goodman, T. W. Rall, A. S. Neis, and P. Taylor (ed.), The pharmacological basis of therapeutics, 8th ed. Pergamon Press, New York, N.Y. |
| 5. | Bryan, R. T. 1992. Current issues in cysticercosis: proteins, proglottids, pigs and prives, p. 181-203. In D. H. Walker (ed.), Global infectious diseases: prevention, control and eradication. Springer-Verlag, Vienna, Austria. |
| 6. | Bursey, C. C., J. A. McKenzie, and M. B. D. Burt. 1980. Polyacrylamide gel electrophoresis in the identification of Taenia (Cestoda) by total protein. Int. J. Parasitol. 10:167-174[Medline]. |
| 6a. | Chapman, A., V. Vallejo, K. G. Mossie, D. Ortiz, N. Agabian, and A. Flisser. 1995. Isolation and characterization of species-specific DNA probes from Taenia solium and Taenia saginota and their use in egg detection assay. J. Clin. Microbiol. 33:1283-1288[Abstract]. |
| 7. | Del Brutto, O. H., and J. Sotelo. 1988. Neurocysticercosis: an update. Rev. Infect. Dis. 10:1075-1087[Medline]. |
| 8. | Flisser, A., A. Reid, E. Garcia-Zepeda, and D. P. McManus. 1988. Specific detection of Taenia saginata eggs by DNA hybridization. Lancet ii:1429-1430. |
| 9. | Flisser, A. 1988. Neurocysticercosis in Mexico. Parasitol. Today 4:131-136. |
| 10. | Flisser, A. 1994. Taeniasis and cysticercosis due to Taenia solium. Prog. Clin. Parasitol. 4:77-116[Medline]. |
| 11. | Garcia, H. H., R. H. Gilman, M. Martinez, V. C. W. Tsang, J. B. Pilcher, G. Herrera, F. Diaz, M. Alvarado, E. Miranda, and the Cysticercosis Working Group in Peru. 1993. Cysticercosis as a major cause of epilepsy in Peru. Lancet 341:197-200[CrossRef][Medline]. |
| 12. | Garcia, H. H., R. H. Gilman, M. A. Tovar, E. Flores, R. Jo, V. C. W. Tsang, F. Diaz, P. Torres, E. Miranda, and the Cysticercosis Working Group in Peru. 1995. Factors associated with Taenia solium cysticercosis: analysis of nine hundred forty-six Peruvian neurologic patients. Am. J. Trop. Med. Hyg. 52:145-148. |
| 13. | Harrison, L. J. S., J. Delgado, and R. M. E. Parkhouse. 1990. Differential diagnosis of Taenia saginata and Taenia solium with DNA probes. Parasitology 100:459-461. |
| 14. | Le Rechie, P. D., and M. M. H. Sewell. 1977. Differentiation of Taenia saginata and Taenia solium by enzyme electrophoresis. Trans. R. Soc. Trop. Med. Hyg. 71:237-238. |
| 15. | Le Rechie, P. D., and M. M. H. Sewell. 1978. Differentiation of taeniid cestodes by enzyme electrophoresis. Int. J. Parasitol. 8:479-483[Medline]. |
| 16. | Letonja, T. 1975. The hamster (Mesocricetus auratus) as an experimental definitive host of Taenia solium. Bol. Chil. Parasitol. 30:32-33[Medline]. |
| 17. | Rajasekariah, G. R., M. D. Rickard, and G. F. Mitchell. 1980. Gradient separation of Taenia pisiformis oncospheres. J. Parasitol. 66:355-356[Medline]. |
| 18. | Rausch, R. L. 1985. Parasitology: retrospect and prospect. J. Parasitol. 53:484-491. |
| 19. | Rishi, A. K., and D. P. McManus. 1987. Genomic cloning of human Echinococcus granulosus DNA: isolation of recombinant plasmids and their use as genetic markers in strain characterization. Parasitology 94:369-383. |
| 20. | Rishi, A. K., and D. P. McManus. 1988. DNA probes which unambiguously distinguish Taenia solium from T. saginata. Lancet i:1275-1276. |
| 21. | Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 22. | Tantalean, V. M., and F. A. Huiza. 1983. Métodos y técnicas de estudio de los helmintos parásitos de vertebrados. Universidad Nacional Mayor de San Marcos, Lima, Perú. |
| 23. | Zarlenga, D. S. 1991. The differentiation of a newly described Asian taenia from Taenia saginata using enzymatically amplified non-transcribed ribosomal DNA repeat sequences. Southeast Asian J. Trop. Med. Public Health 22(Suppl.):251-255. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»