Previous Article | Next Article 
Journal of Clinical Microbiology, January 2000, p. 434-437, Vol. 38, No. 1
0095-1137/0/$04.00+0
Confirmation of psaA in All 90 Serotypes of
Streptococcus pneumoniae by PCR and Potential of This Assay
for Identification and Diagnosis
Katherine E.
Morrison,
Derrick
Lake,
Jennifer
Crook,
George M.
Carlone,
Edwin
Ades,
Richard
Facklam, and
Jacquelyn S.
Sampson*
Division of Bacterial and Mycotic Diseases,
National Center for Infectious Diseases, Centers for Disease
Control and Prevention, U.S. Department of Health and Human Services,
Atlanta, Georgia 30333
Received 11 June 1999/Returned for modification 7 September
1999/Accepted 8 October 1999
 |
ABSTRACT |
The gene encoding the pneumococcal surface adhesin A (PsaA)
protein, psaA, was confirmed in all Streptococcus
pneumoniae serotypes by a newly developed PCR (psaA
PCR) assay. Eighty-nine of the 90 serotypes amplified produced an
838-bp fragment; the exception was a serotype 16F strain acquired from
the American Type Culture Collection (ATCC). Analysis of 20 additional
16F strains from the United States and Brazil showed that the gene was
amplified in all 16F strains, implying that the serotype 16F ATCC
strain must be a variant. The specificity of the assay was verified by the lack of signal from analysis of heterologous bacterial species (n = 30) and genera (n = 14),
including viridans group streptococci. The potential of the assay for
clinical application was shown by its ability to detect pneumococci in
culture-positive nasopharyngeal specimens. Demonstration of
psaA in all 90 serotypes and lack of amplification of
heterologous organisms suggest that this assay could be a useful tool
for detection of pneumococci and diagnosis of disease.
| |
TEXT |
Streptococcus pneumoniae
is frequently isolated from the young, the elderly, and the
immunocompromised as the etiologic agent of a broad range of diseases,
including meningitis, community-acquired pneumonia, and otitis media
(2). A number of diagnostic assays have been developed and
are described in the literature, but none are used routinely because
they are not sufficiently definitive, reliable, or sensitive (3,
15). The existence of 90 different serotypes of pneumococci
increases the challenge of diagnosis and further complicates assay
development and vaccine development.
A major area of focus in pneumococcal disease research has been in
vaccine development. The failure of the licensed 23-valent polysaccharide vaccine to provide protection in young children (<2
years of age), the elderly, or the immunocompromised (4) led
to development of a second-generation protein-conjugate vaccine, soon
to be licensed. This vaccine, composed of the seven most frequent
invasive disease-causing capsular serotypes, may overcome the problems
of poor immunogenicity associated with the 23-valent vaccine. However,
there are indications that this protein-conjugate vaccine may not
prevent replacement carriage of serotypes not contained in the vaccine
(9). These concerns, along with reports of an increase in
antibiotic-resistant pneumococci (2), have shifted interest
towards the development of a vaccine based on immunogenic pneumococcal
species-common proteins of S. pneumoniae (5). The
most promising of these proteins include pneumolysin (10),
pneumococcal surface protein (PspA) (1), and of particular focus in this study, pneumococcal surface adhesin A (PsaA)
(13).
PsaA, a 37-kDa surface protein first identified by Russell et al.
(12), is under study both as a vaccine immunogen and as a
reagent for diagnostic assay development (15). Monoclonal antibody studies suggest that PsaA is expressed in all 90 serotypes of
S. pneumoniae (3), and PCR-restriction fragment
length polymorphism analysis of the 23 vaccine serotypes demonstrated
the conservation of the gene (psaA) (14). We
sought to genetically confirm that psaA is present and
detectable by PCR assay in all 90 S. pneumoniae serotypes
and to take the first steps in developing, evaluating, and
demonstrating the potential of this psaA PCR as a specific and sensitive species-specific diagnostic assay.
Bacterial strains.
The 90 S. pneumoniae serotypes
as outlined by Henrichsen (6) were previously obtained from
the Statens Seruminstitut, Copenhagen, Denmark, the American Type
Culture Collection (ATCC), and the Streptococcal Reference Laboratory,
Centers for Disease Control and Prevention (CDC), Atlanta, Ga. The
Streptococcal Reference Laboratory provided clinical isolates of the
heterologous species Streptococcus mitis, S. oralis, S. mitior, S. parasanguinis,
S. sanguinis, S. crista, S. gordonii,
S. vestibularis, S. salivarius, and various
B-hemolytic strains of S. pyogenes as well as 10 clinical isolates of S. pneumoniae serotype 16F. In addition,
heterologous genera, Staphylococcus aureus,
Enterococcus faecalis, Corynebacterium minutissimum, Corynebacterium pseudodiphtheriticum,
Corynebacterium xerosis, Corynebacterium
pseudotuberculosis, Staphylococcus epidermidis, Klebsiella pneumoniae, Escherichia coli,
Moraxella catarrhalis, and Haemophilus
influenzae, were also obtained from the Streptococcal Reference
Laboratory. An additional 10 clinical strains of serotype 16F were
provided by Maria Christina de C. Brandileone and Claudio Sacchi,
Instituto Adolfo Lutz, Sao Paulo, Brazil. Eleven multidrug-resistant strains of S. pneumoniae were provided by the Pneumococcal
Molecular Epidemiology Network. Mycobacterium fortuitum,
Norcardia farcinica, and Rhodococcus equi were
provided by the Actinomycetes Reference Laboratory, Meningitis and
Special Pathogens Branch, CDC; Chlamydia pneumoniae,
Pseudomonas aeruginosa, and Mycoplasma
pneumoniae were provided by the Respiratory Diseases
Laboratory, Respiratory Diseases Branch, CDC.
PCR.
Bacterial strains were grown for isolation on Trypticase
soy agar plates supplemented with 5% defibrinated sheep blood for 16 h at 37°C in CO2. For PCR amplification,
approximately 5 CFU were placed directly into the PCR mixture and
allowed to lyse in the thermocycler. If this method failed
to produce an amplified product, whole cells were boiled in 200 µl of filtered water for 10 min and then cooled on ice for at least 5 min. An aliquot of boiled lysate was then used in the PCR mixture.
We obtained nasopharyngeal secretions collected from children under 5 years of age attending a clinic or emergency room in the United States,
China, or Israel. These specimens had no identifiers and were unlinked.
The secretions had been inoculated into skim milk-tryptone-glucose-glycerol (STGG) transport medium and were prepared by placing a 10-µl aliquot of the specimen into 2.0 ml of
Todd-Hewitt broth and incubating the suspension in a tightly capped
test tube for 3.5 h in a 37°C water bath. The suspension was
then centrifuged at 14,000 × g for 10 min in a
microcentrifuge (Eppendorf model 5415C). The pellet was retained and
resuspended in 100 µl of ultrafiltered water, and the suspension was
centrifuged again. The final pellet was resuspended in 50 µl of
filtered water and boiled for 10 min. After boiling, the suspension was
cooled on ice for at least 5 min and then used in the psaA
PCR mixture as described below.
Primers.
The sequences of the primers used to amplify
psaA were as follows: 5'CTTTCTGCAATCATTCTTG3'
(P1) or 5'AGGATCTAATGAAAAAATTAG3' (P3) as the forward
primer and 3'GCCTTCTTTACCTTGTTCTGC5' (P2) as the reverse
primer. All primers were designed from the nucleic acid sequence data
from serotype 6B (GenBank accession no. U53509) (14).
Primers P1 and P2 yield a 838-bp fragment; primers P3 and P2
yield a 930-bp fragment. Broad-range PCR primers were
designed from bacterial 16S ribosomal DNA (rDNA) sequences. All
primers were prepared at the Biotechnology Core Facility, CDC.
The PCR mixture (100 µl) contained 100 ng of each primer (P1 and P2,
or P3 and P2), 2.0 µl of 10 mM deoxynucleoside triphosphates
(Boehringer Mannheim, Indianapolis, Ind.), 10.0 µl of 10 mM
MgCl
2,
50.0 µl of PCR Master Mix (Boehringer Mannheim),
and approximately
5 colonies of bacteria or 10 µl of boiled lysate.
Amplification
was performed in a Thermal Cycler 480 (Perkin-Elmer,
Norwalk,
Conn.) for 35 cycles (95°C for 0.5 min, 52°C for 0.5 min,
and
72°C for 2.0 min for denaturing, annealing, and extension,
respectively),
with a final extension at 72°C for 8.0 min. Negative
controls
contained the PCR mixture without the template DNA. The
positive
control contained serotype 6B DNA as the template
DNA.
Approximately 10 µl of each PCR amplicon was electrophoresed on
a 1.0% agarose gel and subsequently stained with ethidium
bromide and visualized with a UV transilluminator. Amplified product
size was determined by comparison with a 1-kb DNA ladder molecular
marker (Life Technologies, Rockville, Md.).
Assay results.
Initial assays showed that psaA in
89 of the 90 S. pneumoniae serotypes was amplified by using
primers P1 and P2 (Fig. 1). Amplification
resulted in an 838-bp fragment as expected. This fragment is slightly
smaller than that of the gene, which is 930 bp. However, for successful
amplification of a serotype 16F ATCC strain (ATCC 6316), a different
forward primer (P3) had to be used (Fig.
2). This primer was determined from a
very conserved region of the N terminus of the psaA sequence
(14). To determine if the inability of P1 and P2 primers to
amplify 16F was common to all strains of serotype 16F, 10 clinical
strains of serotype 16F from the United States and 10 clinical 16F
isolates from Brazil were tested with the primers. All 20 clinical
strains were amplified by using primers P1 and P2 (Fig.
3), indicating that lack of amplification of the one isolate was peculiar to that ATCC strain of serotype 16F and
not to all serotype 16F strains.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 1.
Amplification of 90 S. pneumoniae serotypes
using primers P1 and P2. Agarose gel electrophoresis of PCR-amplified
products from serotypes (838-bp fragment) is shown. Serotype
designations are indicated above the lanes. (A) Serotypes 1 to 10F; (B)
serotypes 11A to 18F; (C) serotypes 18C to 28F; (D) serotypes 29 to
41A; (E) serotypes 41F to 48.
|
|
View larger version (67K):
[in this window]
[in a new window]
|
FIG. 2.
Amplification of ATCC serotype 16F using primers P1 and
P2. Lane 1, DNA marker; lane 2, serotype 6B amplified with P3 and P2;
lane 3, serotype 6B amplified with P1 and P2; lane 4, negative control
P3 and P2; lane 5, negative control P1 and P2; lane 6, serotype 16F
with P2 and P3; lane 7, serotype 16F with P1 and P2.
|
|
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 3.
Amplification of 16F clinical isolates using P1 and P2.
Agarose gel electrophoresis of PCR-amplified products from S. pneumoniae serotype 16F clinical isolates is shown. Lane 1, DNA
marker; lanes 2 to 11, amplified clinical strains.
|
|
To ascertain if there were significant differences within the sequence
of the ATCC serotype 16F isolates compared with that
of serotype 6B,
the DNA sequence of the ATCC serotype 16F
psaA gene was
determined (B. De, unpublished data) and compared with
the sequences of
primers P1 and P2. There was a six-base region
of variability between
the 16F sequence and 6B sequence within
the 19-base P1 primer binding
site. Therefore, ATCC serotype 16F
may be a genetic variant which may
have acquired mutations within
the gene through recombination
with other species. This area of
mutation does not occur within the
known important functional
areas of the gene such as the three
monoclonal binding sites (epitopes)
previously mapped by Zeiler et al.
(J. Zeiler, J. S. Sampson,
G. M. Carlone, E. W. Ades, J. A. Tharpe, and M. A. J. Westerink,
1st
Internatl. Conf. on Emerg. Infect. Dis., slide session 7,
no. 4, 1998.)
and the metal binding region of the protein identified
by Paton
(
14).
Novak et al. (
8), who examined the effects of mutations in
psaA, suggested that PsaA is involved in autolysis and that
tolerance to penicillin may be related to loss of PsaA or PsaA
function. Therefore, we examined 11 multidrug-resistant strains
defined by the Pneumococcal Molecular Epidemiology Network (all
penicillin resistant) by the
psaA PCR assay. All
strains produced
the expected DNA fragment of 838 bp upon
amplification, indicating
that the gene was present in these
strains and that no major alterations
or deletions occurred
within the
gene.
The specificity of the primers used in the PCR assay was tested by
using various heterologous upper respiratory bacteria as
well as other
bacteria (Table
1). All bacteria tested
failed
to amplify with the
psaA primers. Broad-range
16S bacterial rDNA
primers were used to confirm that there was
DNA present in the
samples.
The sensitivity of the PCR was evaluated by using pneumococcal DNA as a
target in fivefold dilutions. The sensitivity was
about 1,400 fg, as
determined by visualization of the 838-bp band
in agarose gels (data
not
shown).
To evaluate the potential usefulness of the
psaA PCR assay
as a possible diagnostic method, clinical nasopharyngeal secretions
obtained in a blinded manner from children under 5 years of age
were
tested by both culture and the
psaA PCR assay. To improve
sensitivity because our specimen size was small (20 µl), we
incorporated
an enrichment step before the PCR assay and found that
positive
results could be obtained without purification of the DNA
template.
Three of four specimens were determined to be positive for
S. pneumoniae by culture. Of these three specimens, two were
amplified
by the
psaA PCR assay. These specimens contained
25 colonies
per 0.1 ml. The third specimen, determined by culture to
have
fewer than 25 organisms per 0.1 ml, was not detected by the
psaA PCR. The fourth specimen was negative by both culture
and the
psaA PCR. These results demonstrate the potential
usefulness of
this assay in epidemiologic studies to determine carriage
or to
confirm the presence of
S. pneumoniae. The use of this
short enrichment
step is ideal for maximal enhancement of potential
template when
a sample is limited and allows for testing without
performing
stringent DNA purification procedures. On the other hand,
many
pneumococcal disease patients have received antibiotics for
treatment
and any available specimens would contain only nonviable
organisms.
In this case, enrichment of sample would not be of value and
sample
preparation procedures via DNA extraction would be preferable
since it would make available DNA from both viable and nonviable
organisms. Future studies using different types of clinical samples
(ear fluid, sputum, and tracheal aspirates) will include investigation
of adequate sample sizes and the most effective methods for sample
preparation.
This study confirms by PCR analysis the genetic presence of
psaA in all 90
S. pneumoniae serotypes. It
supports and expands
on the previous immunoblot studies by Crook et al.
(
3), which
demonstrated the presence of PsaA epitopes among
the 90 serotypes
by using monoclonal antibodies. The generation of
amplified products
of comparable size implies similarity in the gene
size and, in
turn, gene product and is indicative of a common and
highly similar
protein.
A protein common to all 90 serotypes with genetic and immunologic
similarity has implications both for vaccine studies and
diagnostic
development. The use of an immunogenic common protein
as a vaccine
immunogen or carrier could eliminate the need for
multiple capsular
types in a pneumococcal vaccine and additionally
elicit a memory
response, which occurs only with protein-based
vaccines.
Amplification of the gene from all 90 serotypes also has clinical
significance because of the potential to design assays to
detect all
S. pneumoniae isolates regardless of serotype, eliminating
the need for assay reagents representing 90 different components
as are
used in serologic assays such as latex agglutination and
counterimmunoelectrophoresis. Pneumococcal diagnostic assays are
based
primarily on detection of pneumococci, pneumococcal antigens,
DNA, or
RNA in blood or body fluids. Although blood culture is
currently the
most accurate method by which to diagnose pneumococcal
disease, only
approximately 30% of specimens test positive with
this method
(
7). Conventional serologic methods lack uniform
diagnostic
sensitivity and specificity and are time-consuming
because they require
reagents in which all serotypes are represented.
Therefore, there is a
need for a highly sensitive and highly species-specific
method of
detection that will make diagnosis of pneumococcal disease
less
complicated. Our studies suggest that the
psaA PCR assay
is
highly specific, as indicated by the lack of amplification
of
heterologous bacteria, even viridans group streptococci. Other
PCRs
reported in the literature (
16) have not been widely adapted
for use in the clinical laboratory because they have not been
shown to
be consistently and uniformly sensitive. Toikka et al.
(
16),
for example, described the necessity of testing three
different blood
fractions to maximize sensitivity. They also suggested
that a
combination of other diagnostic methods is needed for diagnosis
of
invasive pneumococcal disease. The sensitivity (sensitivity,
1,400 fg
of purified DNA) of the
psaA PCR assay needs further
evaluation and improvement before use of the assay in broad clinical
applications (i.e., with blood or lung aspirates). Although we
have not
addressed the problems of specimen size, type, or preparation,
a more
sensitive assay should be achievable by making modifications
in
components and/or conditions of the assay and by definitively
determining the appropriate sample or specimen
type.
In conclusion, by demonstrating the presence of the gene
(
psaA) among the 90 serotypes, we offer an additional
candidate toward
which to direct development of assays. We also
illustrate the
potential of the
psaA PCR assay for use in
epidemiologic studies
for identification of
S. pneumoniae
and for diagnosis of pneumococcal
disease. Future studies will include
improvement of the sensitivity
of the assay as well as examination of
clinical samples (i.e.,
blood, sputum, and lung aspirates) to validate
diagnostic usefulness
of
psaA amplification. It should prove
to be a valuable method
of
S. pneumoniae identification and
diagnosis for use in clinical
and epidemiologic
studies.
| |
ACKNOWLEDGMENTS |
We thank Maria Christina de C. Brandileone and Claudio Sacchi of
the Bacteriology Department, Instituto Adolfo Lutz, and Melinda Brondson of the Navaho Study for providing strains, and the following laboratories at the Centers for Disease Control and Prevention: the
Streptococcal Reference Laboratory, the Actinomyces Laboratory, and the
Meningococcal Typing Laboratory. We also acknowledge the Centers for
Disease Control and Prevention Biotechnology Core Facility for making
the oligonucleotides that were used in the study.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Centers for
Disease Control and Prevention, 1600 Clifton Rd., NE, Mailstop G05,
Atlanta, GA 30333. Phone: (404) 639-3929. Fax: (404) 639-3115. E-mail: Jas5{at}cdc.gov.
| |
REFERENCES |
| 1.
|
Briles, D. E.,
J. Yother, and L. S. McDaniels.
1988.
Role of the pneumococcal surface protein A in the virulence of Streptococcus pneumoniae.
Rev. Infect. Dis.
10(Suppl. 2):372-374.
|
| 2.
|
Centers for Disease Control and Prevention.
1997.
Prevention of pneumococcal disease: recommendations of the Advisory Committee on Immunization Practices (ACIP).
Morbid. Mortal. Weekly Rep.
46:1-24[Medline].
|
| 3.
|
Crook, J.,
J. A. Tharpe,
S. E. Johnson,
D. B. Williams,
A. R. Stinson,
R. R. Facklam,
E. W. Ades,
G. M. Carlone, and J. S. Sampson.
1998.
Immunoreactivity of five monoclonal antibodies against the 37-kilodalton common cell wall protein (PsaA) of Streptococcus pneumoniae.
Clin. Diagn. Lab. Immunol.
5:205-210[Abstract/Free Full Text].
|
| 4.
|
Forrester, H. L.,
D. W. Jahnigen, and F. M. LaForce.
1987.
Inefficacy of pneumococcal vaccine in a high-risk population.
Am. J. Med.
83:425-430[CrossRef][Medline].
|
| 5.
|
Hammerschmidt, S.,
S. R. Talay,
P. Brandtzeg, and G. S. Chhatwal.
1997.
SpsA, a novel pneumococcal surface protein with specific binding to secretory immunoglobulin A and secretory component.
Mol. Microbiol.
25:1113-1124[CrossRef][Medline].
|
| 6.
|
Henrichsen, J.
1995.
Six newly recognized types of Streptococcus pneumoniae.
J. Clin. Microbiol.
33:2759-2762[Abstract].
|
| 7.
|
Kalin, M., and A. A. Lindberge.
1983.
Diagnosis of pneumococcal pneumonia: a comparison between microscopic examination of expectorate, antigen detection, and cultural procedures.
Scand. J. Infect. Dis.
15:247-255[Medline].
|
| 8.
|
Novak, R.,
J. S. Baun,
E. Charpentier, and E. Tuomanen.
1998.
Penicillin tolerance genes of Streptococcus pneumoniae: the ABC-type manganese permease complex Psa.
Mol. Microbiol.
29:1285-1296[CrossRef][Medline].
|
| 9.
|
Obaro, S. K.,
R. A. Adegbola,
W. A. S. Banya, and B. M. Greenwood.
1996.
Carriage of pneumococci after pneumococcal vaccination.
Lancet
348:271-272[Medline].
|
| 10.
|
Paton, J. C.
1996.
The contribution of pneumolysin to the pathogenicity of Streptococcus pneumoniae.
Trends Microbiol.
4:103-106[CrossRef][Medline].
|
| 11.
|
Rudolph, K. M.,
A. J. Parkinson,
C. M. Black, and L. W. Mayer.
1993.
Evaluation of polymerase chain reaction for diagnosis of pneumococcal pneumonia.
J. Clin. Microbiol.
31:2661-2666[Abstract/Free Full Text].
|
| 12.
|
Russell, H.,
J. A. Tharpe,
D. E. Wells,
E. H. White, and J. E. Johnson.
1990.
Monoclonal antibody recognizing a species-specific protein from Streptococcus pneumoniae.
J. Clin. Microbiol.
28:2192-2195.
|
| 13.
|
Sampson, J. S.,
S. P. O'Connor,
A. R. Stinson,
J. A. Tharpe, and H. Russell.
1994.
Cloning and nucleotide sequence analysis of psaA, the Streptococcus pneumoniae gene encoding a 37-kilodalton protein homologous to previously reported Streptococcus sp. adhesins.
Infect. Immun.
62:319-324[Abstract/Free Full Text].
|
| 14.
|
Sampson, J. S.,
Z. Furlow,
A. M. Whitney,
D. Williams,
R. Facklam, and G. M. Carlone.
1997.
Limited diversity of Streptococcus pneumoniae psaA among pneumococcal vaccine serotypes.
Infect. Immun.
65:1967-1971[Abstract].
|
| 15.
|
Tharpe, J. A.,
H. Russell,
M. Leionen,
B. D. Plikaytis,
R. F. Breiman,
G. M. Carlone,
E. W. Ades, and J. S. Sampson.
1998.
Comparison of a pneumococcal common protein (PsaA) antibody ELISA and a PsaA immune complex ELISA for detection of pneumococcal serum antibody.
Pathobiology
66:77-83[CrossRef][Medline].
|
| 16.
|
Toikka, P.,
S. Nikkari,
O. Ruuskanen,
M. Leinonen, and J. Mertsola.
1998.
Pneumolysin PCR-based diagnosis of invasive pneumococcal infection in children.
J. Clin. Microbiol.
37:633-637[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, January 2000, p. 434-437, Vol. 38, No. 1
0095-1137/0/$04.00+0
This article has been cited by other articles:
-
Brugger, S. D., Hathaway, L. J., Muhlemann, K.
(2009). Detection of Streptococcus pneumoniae Strain Cocolonization in the Nasopharynx. J. Clin. Microbiol.
47: 1750-1756
[Abstract]
[Full Text]
-
Lu, Y.-J., Forte, S., Thompson, C. M., Anderson, P. W., Malley, R.
(2009). Protection against Pneumococcal Colonization and Fatal Pneumonia by a Trivalent Conjugate of a Fusion Protein with the Cell Wall Polysaccharide. Infect. Immun.
77: 2076-2083
[Abstract]
[Full Text]
-
Azzari, C., Moriondo, M., Indolfi, G., Massai, C., Becciolini, L., de Martino, M., Resti, M.
(2008). Molecular detection methods and serotyping performed directly on clinical samples improve diagnostic sensitivity and reveal increased incidence of invasive disease by Streptococcus pneumoniae in Italian children. J Med Microbiol
57: 1205-1212
[Abstract]
[Full Text]
-
Cortes, P. R., Orio, A. G. A., Regueira, M., Pinas, G. E., Echenique, J.
(2008). Characterization of In Vitro-Generated and Clinical Optochin-Resistant Strains of Streptococcus pneumoniae Isolated from Argentina. J. Clin. Microbiol.
46: 1930-1934
[Abstract]
[Full Text]
-
Dias, C. A., Agnes, G., Frazzon, A. P. G., Kruger, F. D., d'Azevedo, P. A., Carvalho, M. d. G. S., Facklam, R. R., Teixeira, L. M.
(2007). Diversity of Mutations in the atpC Gene Coding for the c Subunit of F0F1 ATPase in Clinical Isolates of Optochin-Resistant Streptococcus pneumoniae from Brazil. J. Clin. Microbiol.
45: 3065-3067
[Abstract]
[Full Text]
-
Pimenta, F. C., Miyaji, E. N., Areas, A. P. M., Oliveira, M. L. S., de Andrade, A. L. S. S., Ho, P. L., Hollingshead, S. K., Leite, L. C. C.
(2006). Intranasal Immunization with the Cholera Toxin B Subunit-Pneumococcal Surface Antigen A Fusion Protein Induces Protection against Colonization with Streptococcus pneumoniae and Has Negligible Impact on the Nasopharyngeal and Oral Microbiota of Mice.. Infect. Immun.
74: 4939-4944
[Abstract]
[Full Text]
-
Suzuki, N., Yuyama, M., Maeda, S., Ogawa, H., Mashiko, K., Kiyoura, Y.
(2006). Genotypic identification of presumptive Streptococcus pneumoniae by PCR using four genes highly specific for S. pneumoniae. J Med Microbiol
55: 709-714
[Abstract]
[Full Text]
-
Whalan, R. H., Funnell, S. G. P., Bowler, L. D., Hudson, M. J., Robinson, A., Dowson, C. G.
(2006). Distribution and Genetic Diversity of the ABC Transporter Lipoproteins PiuA and PiaA within Streptococcus pneumoniae and Related Streptococci. J. Bacteriol.
188: 1031-1038
[Abstract]
[Full Text]
-
Sa-Leao, R., Simoes, A. S., Nunes, S., Sousa, N. G., Frazao, N., de Lencastre, H.
(2006). Identification, prevalence and population structure of non-typable Streptococcus pneumoniae in carriage samples isolated from preschoolers attending day-care centres. Microbiology
152: 367-376
[Abstract]
[Full Text]
-
Moreno, J., Hernandez, E., Sanabria, O., Castaneda, E.
(2005). Detection and Serotyping of Streptococcus pneumoniae from Nasopharyngeal Samples by PCR-Based Multiplex Assay. J. Clin. Microbiol.
43: 6152-6154
[Abstract]
[Full Text]
-
Scott, J. A. G., Mlacha, Z., Nyiro, J., Njenga, S., Lewa, P., Obiero, J., Otieno, H., Sampson, J. S., Carlone, G. M.
(2005). Diagnosis of Invasive Pneumococcal Disease among Children in Kenya with Enzyme-Linked Immunosorbent Assay for Immunoglobulin G Antibodies to Pneumococcal Surface Adhesin A. CVI
12: 1195-1201
[Abstract]
[Full Text]
-
Suzuki, N., Seki, M., Nakano, Y., Kiyoura, Y., Maeno, M., Yamashita, Y.
(2005). Discrimination of Streptococcus pneumoniae from Viridans Group Streptococci by Genomic Subtractive Hybridization. J. Clin. Microbiol.
43: 4528-4534
[Abstract]
[Full Text]
-
Palaniappan, R., Singh, S., Singh, U. P., Sakthivel, S. K. K., Ades, E. W., Briles, D. E., Hollingshead, S. K., Paton, J. C., Sampson, J. S., Lillard, J. W. Jr.
(2005). Differential PsaA-, PspA-, PspC-, and PdB-Specific Immune Responses in a Mouse Model of Pneumococcal Carriage. Infect. Immun.
73: 1006-1013
[Abstract]
[Full Text]
-
Drancourt, M., Roux, V., Fournier, P.-E., Raoult, D.
(2004). rpoB Gene Sequence-Based Identification of Aerobic Gram-Positive Cocci of the Genera Streptococcus, Enterococcus, Gemella, Abiotrophia, and Granulicatella. J. Clin. Microbiol.
42: 497-504
[Abstract]
[Full Text]
-
Kong, F., Gilbert, G. L.
(2003). Using cpsA-cpsB sequence polymorphisms and serotype-/group-specific PCR to predict 51 Streptococcus pneumoniae capsular serotypes. J Med Microbiol
52: 1047-1058
[Abstract]
[Full Text]
-
Verhelst, R., Kaijalainen, T., De Baere, T., Verschraegen, G., Claeys, G., Van Simaey, L., De Ganck, C., Vaneechoutte, M.
(2003). Comparison of Five Genotypic Techniques for Identification of Optochin-Resistant Pneumococcus-Like Isolates. J. Clin. Microbiol.
41: 3521-3525
[Abstract]
[Full Text]
-
Scott, J. A. G., Marston, E. L., Hall, A. J., Marsh, K.
(2003). Diagnosis of Pneumococcal Pneumonia by psaA PCR Analysis of Lung Aspirates from Adult Patients in Kenya. J. Clin. Microbiol.
41: 2554-2559
[Abstract]
[Full Text]
-
Romero-Steiner, S., Pilishvili, T., Sampson, J. S., Johnson, S. E., Stinson, A., Carlone, G. M., Ades, E. W.
(2003). Inhibition of Pneumococcal Adherence to Human Nasopharyngeal Epithelial Cells by Anti-PsaA Antibodies. CVI
10: 246-251
[Abstract]
[Full Text]
-
Zhang, Q., Choo, S., Finn, A.
(2002). Immune Responses to Novel Pneumococcal Proteins Pneumolysin, PspA, PsaA, and CbpA in Adenoidal B Cells from Children. Infect. Immun.
70: 5363-5369
[Abstract]
[Full Text]
-
Gor, D. O., Ding, X., Li, Q., Schreiber, J. R., Dubinsky, M., Greenspan, N. S.
(2002). Enhanced Immunogenicity of Pneumococcal Surface Adhesin A by Genetic Fusion to Cytokines and Evaluation of Protective Immunity in Mice. Infect. Immun.
70: 5589-5595
[Abstract]
[Full Text]
-
McAvin, J. C., Reilly, P. A., Roudabush, R. M., Barnes, W. J., Salmen, A., Jackson, G. W., Beninga, K. K., Astorga, A., McCleskey, F. K., Huff, W. B., Niemeyer, D., Lohman, K. L.
(2001). Sensitive and Specific Method for Rapid Identification of Streptococcus pneumoniae Using Real-Time Fluorescence PCR. J. Clin. Microbiol.
39: 3446-3451
[Abstract]
[Full Text]
-
Jado, I., Fenoll, A., Casal, J., Perez, A.
(2001). Identification of the psaA Gene, Coding for Pneumococcal Surface Adhesin A, in Viridans Group Streptococci other than Streptococcus pneumoniae. CVI
8: 895-898
[Abstract]
[Full Text]
-
Greiner, O., Day, P. J. R., Bosshard, P. P., Imeri, F., Altwegg, M., Nadal, D.
(2001). Quantitative Detection of Streptococcus pneumoniae in Nasopharyngeal Secretions by Real-Time PCR. J. Clin. Microbiol.
39: 3129-3134
[Abstract]
[Full Text]
Top
Abstract
Text
