Previous Article | Next Article 
Journal of Clinical Microbiology, October 2000, p. 3663-3669, Vol. 38, No. 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Pneumococcal pspA Sequence Types of
Prevalent Multiresistant Pneumococcal Strains in the United States and
of Internationally Disseminated Clones
Bernard
Beall,1,*
Giovanni
Gherardi,1,
Richard R.
Facklam,1 and
Susan K.
Hollingshead2
Respiratory Diseases Branch, Centers for
Disease Control and Prevention, Atlanta, Georgia
30333,1 and Department of
Microbiology, University of Alabama at Birmingham, Birmingham, Alabama
352052
Received 26 April 2000/Returned for modification 1 July
2000/Accepted 1 August 2000
 |
ABSTRACT |
In a recent genotypic survey of
-lactam-resistant pneumococci
recovered in different areas of United States during 1997, eight clonal
types that each represented 3 to 40 isolates accounted for 134 of 144 isolates (G. Gherardi, C. Whitney, R. Facklam, and B. Beall, J. Infect. Dis. 181:216-229, 2000). We determined the degree of
pspA gene diversity among these 134 isolates and for 11 previously characterized internationally disseminated multiresistant strains. Thirty-four different pspA restriction profiles
were determined for an amplicon encompassing the variable portion of the structural gene that encodes the surface-exposed domain of PspA and
a variable-length proline-rich putative cell wall-associated domain.
These restriction profiles closely correlated with those of 33 different pspA sequence types of an approximately
230-residue region corresponding to residues 182 to 410 of the strain
Rx1 PspA. These residues encompass a 100-residue clade-defining region known to contain cross-protective epitopes for which 17 sequence types were found. Distinct, conserved pspA sequence types
were found for the majority of strains within seven of the eight U.S. clonal types assessed, while one pulsed-field gel electrophoresis type
was represented by isolates of three distinct PspA clades. Sequence
typing of pspA provides an added level of specificity in
the subtyping of isolates and is a necessary first step in determining
the components needed in a PspA vaccine which could elicit effective
cross-protective coverage.
 |
INTRODUCTION |
Streptococcus pneumoniae
is a major cause of morbidity and mortality worldwide and is the
leading cause of bacterial pneumonia, meningitis, bacteremia, and
otitis media. Pneumococcal polyvalent purified capsular polysaccharide
vaccines are serotype specific in their protection, contain only 23 of
the 90 known capsular types, and are unable to elicit effective
immunologic responses in children younger than 2 years of age and many
elderly individuals (6, 13). Although conjugate vaccines
should be much more effective in these individuals, they are still
limited to offering protection against specific capsular types. For
these reasons, there is much interest in developing pneumococcal
protein vaccines. One protein vaccine candidate, PspA, is an
antigenically variable surface virulence factor (16)
that interferes with complement-mediated clearance of pneumococci
during bacteremia (1, 2). Antibodies to PspA protect mice
against lethal systemic infection, and this protection is often
cross-protective for strains of different capsular serotypes expressing
distinct PspA molecule types (1, 2, 17, 19). Immunization of
humans with a single recombinant PspA stimulated antibodies broadly
cross-reactive to heterologous PspA molecules (23). Although
it is known that PspA is broadly cross-reactive, cross-reactivity does
not necessarily correspond to cross-protection, and the total array of
common circulating PspA types should be determined before the degree of
cross-protection afforded by specific sequence types can be assessed.
It is particularly important to assess PspA variability among strains
with serotypes not targeted by impending conjugate vaccines and
circulating strains that have become highly resistant to antibiotics
used for treatment. Highlighting the importance of the latter group is
the recent report that high-level penicillin resistance was an
independent parameter of mortality in pneumococcal bacteremia in a
population with high human immunodeficiency virus seroprevalence
(27). For the study presented here, we examined the
pspA sequences of multiresistant, genetically characterized
U.S. isolates recovered in 1997 and 11 previously characterized
internationally disseminated multiresistant strains.
 |
MATERIALS AND METHODS |
Isolates.
Eight genetically related sets comprised 134 of
144 multiresistant isolates that were recovered in 1997 and that were
described previously (9). These isolates were obtained from
the Emerging Infections Program/Active Bacterial Core Surveillance
(available at http://www.cdc.gov/ncidod/dbmd/abcs) conducted in seven
states within the United States.
Previously characterized clones.
The following previously
genetically characterized strains were provided by L. McDougal and F. Tenover and were designated according to the Pneumococcal Molecular
Epidemiology Network (15). These included clones
Spain23F-1 (strain SP193, ATCC 700669) (4,
21), Spain6B-2 (GM17, SP194, ATCC 700670)
(22), France9V-3 (strain SP195, ATCC
700671; highly related to strain 665) (4, 24),
Tennessee23F-4 (strain SP196, ATCC 51916) (20,
24), England14-9 (strain SP200, ATCC 700676)
(10), Spain14-5 (strain VH14, SP197, ATCC
700672) (5), Hungary19A-6 (SP220, ATCC
700673) (21), South Africa19A-7 (SP198, strain
17619, ATCC 700674) (25), South Africa6B-8
(strain SP199, ATCC 700675) (24), Slovakia14-10
(strain 91-006571, SP221, ATCC 700677) (8), and
Slovakia19A-11 (strain 91-0006571, SP222, ATCC 700678)
(8).
PCR, restriction profiling, and sequencing.
Primers F
(GCCAGCGTCGCTATCTTAGGGGCTGG) and R
(GAACCATCAGTATTGTAGAAGTACCA) were used for PCR and were
derived by comparisons of conserved regions between the two sequences
corresponding to GenBank accession numbers U89711 (28) and A41971 (9).
Primer R was used to obtain the sequences of 550 to 780 bases used for analysis. Restriction analysis of the amplicon generated with primers F
and R was accomplished as described previously for penicillin-binding protein gene amplicons (9) following digestion of 10 µl of unpurified PCR products with 2 U each of the enzymes RsaI,
HinfI, and HaeIII. Amplicons showing identical
triple-digest patterns were additionally compared by DdeI
digestion in the same manner to ensure that there was true
representation of highly similar amplicons. Amplicons from each of the
11 internationally dispersed clones were also profiled by restriction
analysis and sequenced. Independent amplicons from at least two 1997 isolates from each identical restriction profile set were sequenced.
When possible, pspA amplicons from isolates that differed in
serotype, geographic source, and pulsed-field gel electrophoresis
(PFGE) profile from within each identical pspA restriction
profile set were used for sequence analysis.
DNA sequence analysis.
The translation of the primer
R-generated sequence complement was used for amino acid sequence
comparisons by using the Wisconsin Package, version 10.0, software
(Genetics Computer Group, Madison, Wis.).
Nucleotide sequence accession numbers.
The GenBank accession
numbers for the partial pspA sequences encompassing roughly
codons 180 to 410 of the RxA pspA gene (19) are
listed in Table 1.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
pspA RFLP types and sequence accession numbers
for 1997 multiresistant isolates and internationally disseminated
clones that were genotyped
|
|
 |
RESULTS AND DISCUSSION |
Primers were selected based upon sequences conserved between the
pspA DNA sequence of strain EF5668 (19) and the
PspA amino acid sequence of JY2008 (28), which were the only
two PspA sequences accessible from GenBank at the time that this study
was initiated. Two primers were selected for amplification based on
their ability to generate a single 1,000- to 1,500-bp amplicon from all
pneumococcal strains tested. Primer F annealed to the conserved signal
sequence codons 12 to 20, while primer R annealed to codons 411 to 419 and 465 to 473 of the strain EF5668 and strain JY2008 pspA
genes, respectively (Fig. 1). Thus, this
amplicon carries the sequence that encodes the
-helical
surface-exposed region with most antigenic epitopes and the closely
situated variable-length proline-alanine repeat region (VLP in Fig. 1)
(3, 11, 18, 28). The surface-exposed region encompasses the
100-residue pspA clade-defining region which includes
protection-eliciting epitopes (3, 11).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
General features of PspA and method used for sequence
typing of pspA amplicons. The pspA codon
positions are taken from references 3 and
11 and are based upon the Rx1 pspA
sequence (27). Abbreviations: SS, signal sequence; CDR,
clade-defining region containing cross-protective epitopes; VLP,
variable-length proline-rich repeat region.
|
|
Previously, sequence-based divisions among diverse PspA proteins
classified these proteins into three families that were further subdivided into six clades (3, 11). The clade-defining
regions of PspA proteins in different clades vary at >20% of amino
acid positions (3). Family 1 is composed of clades 1 and 2, and family 2 is composed of clades 3 to 5. Family 3 has only one highly divergent member. Although both clades and families are easily recognized sequence-based divisions of PspA proteins, it is the family-level division that appears to be the most important
serologically. Rabbit antisera made to recombinant PspA proteins could
reliably distinguish PspA families but could not always distinguish
PspA clades within the same family (23; S. Hollingshead and D. E. Briles, unpublished data).
Figure 1 summarizes the method of pspA amplicon-based
subtyping used. Table 1 summarizes the pspA amplicon
sequencing and restriction pattern results. The PspA sequences of only
families 1 and 2, consisting of clades 1 to 5, were found among the
multiresistant pneumococcal strains used for this study. Seventy-three
of the 134 1997 U.S. isolates (54%), representing five distinct PFGE types, were found to be of PspA clade 3, and the sequences of their
clade 3-defining regions diverged from those of previously sequenced
clade 3-defining regions by no more than 7.8%. Fifty-eight isolates
(43%), representing three PFGE types, were found to contain clade 1 PspA sequences, with their clade-defining regions having 92 to 100%
identity to previously sequenced clade 1-defining regions. Only one
clade 2 PspA sequence was found among these 1997 U.S. isolates, from
two independent PFGE type D isolates comprising two different serotypes
(subtypes D2 and D9 in Fig. 2). Only one clade 5 isolate was found among the 1997 U.S. isolates and consisted of
a PFGE type A isolate (subtype A4 in Fig. 2). The sequences of the
clade 5-defining regions of two internationally disseminated clones
(PFGE types N1 and O1 in Table 1) were found to have 95 to 99% amino
sequence identity to the clade-defining region of clade 5 strain ATCC
6303 (11). Finally, a single clade 4 PspA sequence was found
from the internationally disseminated strain South
Africa19A-7 (PFGE type P1 in Table 1). The relation of
clades 3 to 5 (family 2) compared to clades 1 and 2 (family 1) is
evident in Fig. 3, in which the
clade-defining regions representing all of the sequences examined in
this study are aligned.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 2.
PspA clades of previously determined PFGE types
(9) of multiresistant, invasive pneumococcal isolates. The
dendrogram gives underestimated Dice coefficients because closely
migrating bands could not be properly resolved with the program used.
Visually identical PFGE profiles gave average Dice coefficients of
~0.86 to 0.93. UPGMA, unweighted pair group method with arithmetic
averages. The strains with the closest matches in their PspA
clade-defining regions (11) are listed along with their
pspA GenBank accession numbers.
|
|

View larger version (96K):
[in this window]
[in a new window]
|
FIG. 3.
Alignment of the PspA clade-defining regions that
contain cross-protective epitopes from different pspA
amplicon RFLP types. BG6692 and DBL1 refer to PspA protein sequences
from reference 11. The PileUp program was used as
described previously (11). Positions shared by nine or more
PspA sequences are shaded.
|
|
As reported previously (3, 11), the 650- to 775-bp region of
pspA sequenced was remarkably variable, with the more
distantly related sequences (e.g., clade 1 versus clade 3) sharing only about 40% sequence identity at either the DNA or the protein level. For isolates of PFGE types A, B, C, H, and K, one specific
pspA amplicon restriction fragment length
polymorphism (RFLP) pattern represented the majority of
isolates (89 of 101 [88.1%]) obtained within a PFGE type
(Table 1). For isolates of PFGE types A, B, C, and K, the major
pspA sequence and RFLP type was additionally shared with
those of previously characterized internationally disseminated
antibiotic-resistant strains of the same PFGE types. With only three
exceptions, each specific RFLP type was associated with a specific
pspA sequence type. Closely related RFLP patterns b1 and b4
both corresponded to the GenBank accession number AF252286 sequence,
and similarly, RFLP patterns d1 and d2 both corresponded to the GenBank
accession number AF255547 sequence. One strain (Slovakia14-10) contained only one conservative
substitution in PspA relative to the other isolates of pspA
RFLP type c1. The sequence differences between sets of highly related
amplicons sharing the same clade-defining region were most often the
result of differences in the number of repetitive sequences in the
variable-length proline-rich domain. For example, the accession number
AF25429 and AF255542 sequences (corresponding to RFLP types a1 and a2,
respectively) differ only by the deletion of a PAPAPKPEQ direct
repeat (data not shown), and this 27-bp deletion appears to account for
the difference in the amplicon restriction profile (Fig.
4; compare lanes 2 and 3). Similarly, the
nine sequences corresponding to RFLP types e1 to e9, respectively,
shared identical clade-defining regions, and the principal difference
between them was in the number of proline-rich repeats in the
variable-length proline-rich region (Fig.
5).

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 4.
RFLP patterns of pspA amplicons. Amplicons
generated with primers F and R were subjected to triple digestion with
HaeIII, HinfI, and RsaI prior to
agarose gel electrophoresis. The RFLP type designations at the top are
from Table 1. Lanes 1, 17, and 31, size ladder (L); lanes 2 to 16 and
18 to 30, 1997 multiresistant U.S. isolates; lanes 32 to 42, internationally disseminated multiresistant strains: lane 32, Spain23F-1; lane 33, Spain6B-2; lane 34, France9V-3; lane 35, Tennessee23F-4; lane 36, Spain14-5; lane 37, S. Africa19A-7; lane 38, S. Africa6B-8; lane 39, England14-9; lane 40, Hungary19A-6; lane 41, Slovakia14-10; lane 42, Slovakia19A-11.
|
|
Only two pspA sequence types were shared among strains that
did not appear to be highly related according to the results of PFGE.
The PspA sequence with GenBank accession number AF253406 (768 bases)
was shared exclusively among PFGE type C clinical isolates: PFGE type C
isolate England14-9, PFGE type
isolate
Spain14-5, and a PFGE type B isolate. The GenBank accession
number AF255546 sequence, which differed from the GenBank accession
number AF253406 sequence by only one conservative substitution (data
not shown), was also found in the distinct PFGE type
strain
Slovakia14-10. It is interesting that all of these strains
with the pspA sequence corresponding to GenBank accession
number AF253406 (and the single strain with the GenBank accession
number AF255546 sequence), although they appeared to be nonrelated
according to the results of PFGE and penicillin-binding protein
gene-dhf restriction profiling (data not shown), were all
serotype 14 (Table 1). Further analysis of the degree of relatedness
between these strains should be facilitated by multilocus sequence
typing (7).
With the exceptions of PFGE type D isolates, the majority of isolates
within a given PFGE type exhibited identity or a high degree of
homology within their pspA sequences, which is evident in
the alignment of the approximately 100-residue clade-defining region
(Fig. 3). The PFGE type D isolates displayed the widest range of
variability in the pspA clade-defining region, with isolates found to be of clade 3 (four isolates), clade 1 (four isolates), and
clade 2 (two isolates). The clade 5 PspA protein from the isolate of
PFGE subtype A4 is quite divergent from the clade 3 PspA proteins
shared by the other 23 PFGE type A isolates (including Spain23F-1). This is consistent with the fact that PFGE
subtype A4 is the most divergent PFGE subtype within type A (Fig. 2).
This sequence (GenBank accession number AF25426 [RFLP type a5])
differed from the sequence found for Hungary19A-6 (RFLP
type o1) by only 2 codon substitutions over a 227-codon overlap and by
only 1 conservative substitution in the clade-defining region (Fig. 3).
Additionally, 1 of the 40 PFGE type B isolates had the major PFGE type
C pspA sequence (GenBank accession number AF253406) and RFLP
type c1 (Table 1).
Isolates of PFGE type D are a more broadly divergent group on the basis
of the deeper branching points in the dendrogram (Fig. 2), which is
consistent with PFGE type D having three different PspA clades. The
deeper branching points could possibly indicate an older age of that
clonal type, which would allow more time for horizontal pspA
transfer events. However, isolates of PFGE type B have deeper branch
points than isolates of the PFGE types other than D, and yet 39 of the
40 PFGE type B isolates (except for subtype B13) have very conserved
pspA sequences.
Comparisons of approximately 160- to 230-codon regions of
pspA consisting of the clade-defining region plus the
flanking sequence that includes 20 to 50 codons on the N-terminal side
and the variable-length proline-rich domain on the C-terminal side, in
combination with RFLP analysis of the pspA amplicon,
provides a potential tool for distinguishing between highly related
isolates (Fig. 3 and 4; Table 1). A total of 145 multiresistant
pneumococci were found to exhibit 34 pspA amplicon
restriction profiles that were predictive of specific sequence types.
In a similar manner, restriction profiling of pspA amplicons
was previously found to be useful in revealing related subsets of
pspA (A. Brooks-Walter, L. S. McDaniel, S. K. Hollingshead, M. J. Crain, and D. E. Briles, Abstr. 35th
Intersci. Conf. Antimicrob. Agents Chemother., abstr. B12, p. 28, 1995) and was used to assist in demonstrating the clonal origin of serotype 9L isolates from western Canada (26). All of the isolates in the present study were found to contain family 1 or family 2 pspA alleles that encoded PspA proteins primarily of clade 1 and clade 3, respectively. The most prevalent PFGE types of resistant
pneumococci from within the United States were found to have
pspA amplicons and sequence types identical to those for
highly related internationally dispersed multiresistant strains. PspA
has recently been shown to have a mosaic structure that presumably
results from extensive immunologic selection for intraspecies
recombination events (11, 12). Although different serotypes
and clonal backgrounds appear to vary in their degrees of virulence
(14), it is unknown if or how different PspA types affect
pneumococcal virulence. For epidemiologic studies and for PspA-based
vaccine considerations, it may possibly prove to be important to track
pneumococcal strains with regard to the sequence types of this variable protein.
 |
ACKNOWLEDGMENTS |
We thank the Georgia, California, Connecticut, Minnesota, Oregon,
Maryland, New York, and Tennessee Emerging Infections Program Network/Active Bacterial Core Surveillance for isolates. We are grateful to Linda McDougal and Fred Tenover for sharing characterized pneumococcal clones and information. Zhongya Li provided excellent technical assistance. We thank Ruth Franklin and Deloise Jackson for
the bulk of the serotyping results.
G.G. was a recipient of a career award from the Italian Fondazione
Cariverona Progetto Sanità.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centers for
Disease Control and Prevention, Mailstop C02, 1600 Clifton Rd., NE,
Atlanta, GA 30333. Phone: (404) 639-1237. Fax: (404) 639-3123. E-mail: beb0{at}cdc.gov.
Present address: Libera Università Campus Bio-Medico, 00155, Rome, Italy.
 |
REFERENCES |
| 1.
|
Briles, D. E.,
J. D. King,
M. L. Gray,
L. S. McDaniel,
E. Swialto, and K. A. Benton.
1996.
PspA, a protection-eliciting pneumococcal protein: immunogenicity of isolated native PspA in mice.
Vaccine
14:858-867[CrossRef][Medline].
|
| 2.
|
Briles, D. E.,
R. C. Tart,
H.-Y. Wu,
B. A. Ralph,
M. W. Russell, and L. S. McDaniel.
1996.
Systemic and mucosal protective immunity to pneumococcal surface protein A.
Ann. N. Y. Acad. Sci.
797:118-126[Medline].
|
| 3.
|
Briles, D. E.,
S. Hollingshead,
E. Swiatlo,
J. P. Dillard,
P. Smith,
K. A. Benton,
B. A. Ralph,
A. Brooks-Walter,
M. J. Crain,
S. K. Hollingshead, and L. S. McDaniel.
1997.
PspA and PspC: their potential for use as pneumococcal vaccines.
Microb. Drug. Resist.
3:401-408[Medline].
|
| 4.
|
Coffey, T. J.,
C. G. Dowson,
C. G. Daniels,
M. Zhou,
J. Martin,
C. Spratt,
B. G., and J. M. Musser.
1991.
Horizontal transfer of multiple penicillin-binding protein genes, and capsular biosynthetic genes, in natural populations of Streptococcus pneumoniae.
Mol. Microbiol.
5:2255-2260[Medline].
|
| 5.
|
Coffey, T. J.,
S. Berron,
M. Daniels,
M. E. Garcia-Leoni,
E. Cercenado,
E. Bouza,
A. Fenoll, and B. G. Spratt.
1996.
Multiply antibiotic-resistant Streptococcus pneumoniae recovered from Spanish hospitals (1988-1994): novel major clones of serotypes 14, 19F and 15F.
Microbiology
142:2747-2757[Abstract/Free Full Text].
|
| 6.
|
Cowan, M. J.,
A. J. Ammann,
D. W. Wara,
V. M. Howie,
L. Schultz,
N. Doyle, and M. Kaplan.
1978.
Pneumococcal polysaccharide immunization in infants and children.
Pediatrics
62:721-727[Abstract/Free Full Text].
|
| 7.
|
Enright, M. C., and B. G. Spratt.
1998.
A multilocus typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease.
Microbiology
144:3049-3060[Abstract/Free Full Text].
|
| 8.
|
Figueiredo, A. M.,
R. Austrian,
P. Urbaskova,
L. A. Teixeira, and A. Tomasz.
1995.
Novel penicillin-resistant clones of Streptococcus pneumoniae in the Czech Republic and in Slovakia.
Microb. Drug Resist.
1:71-78[Medline].
|
| 9.
|
Gherardi, G.,
C. Whitney,
R. Facklam, and B. Beall.
2000.
Major sets of genetically related -lactam resistant pneumococci in the United States based upon PFGE and pbp1a-pbp2b-pbp2x-dhf restriction profiles.
J. Infect. Dis.
181:216-229[CrossRef][Medline].
|
| 10.
|
Hall, L. M.,
R. A. Whiley,
B. Duke,
R. C. George, and A. Efstratiou.
1996.
Genetic relatedness within and between serotypes of Streptococcus pneumoniae from the United Kingdom: analysis of multilocus enzyme electrophoresis, pulsed-field gel electrophoresis, and antimicrobial resistance patterns.
J. Clin. Microbiol.
34:853-859[Abstract].
|
| 11.
|
Hollingshead, S. K.,
R. Becker, and D. E. Briles.
2000.
University of PspA: mosaic genes and evidence for past recombination in Streptococcus pneumoniae.
Infect. Immun.
68:5889-5900[Abstract/Free Full Text].
|
| 12.
|
Hollingshead, S. K.,
D. Bessen, and D. E. Briles.
1998.
Archeological footprints of horizontal gene transfer: mosaic cell surface proteins of Streptococcus pyogenes and Streptococcus pneumoniae. In C. Kado and M. Syvanen (ed.), Horizontal gene transfer: implications and consequences
Chapman & Hall, New York, N.Y.
|
| 13.
|
Jernigan, D. B.,
M. S. Cetron, and R. F. Breiman.
1996.
Defining the public health impact of drug resistant Streptococcus pneumoniae: report of a working group.
Morb. Mortal. Wkly. Rep.
45:1-20[Medline].
|
| 14.
|
Kelly, T.,
J. P. Dillard, and J. Yother.
1994.
Effect of genetic switching of capsular type on virulence of Streptococcus pneumoniae.
Infect. Immun.
62:1813-1819[Abstract/Free Full Text].
|
| 15.
|
Klugman, K.
1998.
Pneumococcal molecular epidemiology network.
ASM News
64:371.
|
| 16.
|
McDaniel, L. S.,
J. Yother,
M. Vijayakumar,
L. McGarry,
W. R. Guild, and D. E. Briles.
1987.
Use of insertional inactivation to facilitate studies of biological properties of pneumococcal surface protein A (PspA).
J. Exp. Med.
165:381-394[Abstract/Free Full Text].
|
| 17.
|
McDaniel, L. S.,
J. S. Sheffield,
P. Delucchi, and D. E. Briles.
1991.
PspA, a surface protein of Streptococcus pneumoniae, is capable of eliciting protection against pneumococci of more than one capsular type.
Infect. Immun.
59:222-228[Abstract/Free Full Text].
|
| 18.
|
McDaniel, L. S.,
B. A. Ralph,
D. O. McDaniel, and D. E. Briles.
1994.
Location of protection-eliciting epitopes on PspA of Streptococcus pneumoniae between amino acid residues 192 and 260.
Microb. Pathog.
17:323-337[CrossRef][Medline].
|
| 19.
|
McDaniel, L. S.,
D. O. McDaniel,
S. K. Hollingshead, and D. E. Briles.
1998.
Comparison of the PspA sequence from Streptococcus pneumoniae EF5668 to the previously identified PspA sequence from strain Rx1 and ability of PspA from EF5668 to elicit protection against pneumococci of different capsular types.
Infect. Immun.
66:4748-4754[Abstract/Free Full Text].
|
| 20.
|
McDougal, L. K.,
J. K. Rasheed,
J. W. Biddle, and F. C. Tenover.
1995.
Identification of multiple clones of extended-spectrum cephalosporin-resistant Streptococcus pneumoniae isolates in the United States.
Antimicrob. Agents Chemother.
39:2282-2288[Abstract].
|
| 21.
|
Muñoz, R.,
T. J. Coffey,
M. Daniels,
C. G. Dowson,
G. Laible,
J. Casal,
R. Hakenbeck,
M. Jacobs,
J. M. Musser, and B. G. Spratt.
1991.
Intercontinental spread of a multiresistant clone of serotype 23F Streptococcus pneumoniae.
J. Infect. Dis.
164:302-306[Medline].
|
| 22.
|
Munoz, R.,
J. M. Musser,
M. Crain,
D. E. Briles,
A. Morton,
A. J. Parkinson,
U. Sorenson, and A. Tomasz.
1992.
Geographic distribution of penicillin-resistant clones of Streptococcus pneumoniae: characterization by penicillin-binding protein profile, surface protein A typing, and multilocus enzyme analysis.
Clin. Infect. Dis.
15:112-118[Medline].
|
| 23.
|
Nabors, G. S.,
P. A. Braun,
D. J. Herrmann,
M. L. Heise,
D. J. Pyle,
S. Gravenstein,
M. Schilling,
L. M. Ferguson,
S. K. Hollingshead,
E. E. Briles, et al.
2000.
Immunization of healthy adults with a single recombinant pneumococcal surface protein A (PspA) stimulated cross-reactive antibodies to heterologous PspA molecules.
Vaccine
18:1743-1754[CrossRef][Medline].
|
| 24.
|
Sibold, C.,
J. Wang,
J. Henrichsen, and R. Hakenbeck.
1992.
Genetic relationships of penicillin-susceptible and -resistant Streptococcus pneumoniae strains isolated on different continents.
Infect. Immun.
60:4119-4126[Abstract/Free Full Text].
|
| 25.
|
Smith, A. M., and K. P. Klugman.
1997.
Three predominant clones identified within penicillin-resistant South African isolates of Streptococcus pneumoniae.
Microb. Drug Resist.
3:385-389[Medline].
|
| 26.
|
Swiatlo, E.,
M. J. Crain,
L. S. McDaniel,
A. Brooks-Walter,
T. J. Coffey,
B. G. Spratt,
D. A. Morrison, and D. E. Briles.
1996.
DNA polymorphisms and variant penicillin-binding proteins as evidence that relatively penicillin-resistant pneumococci in western Canada are clonally related.
J. Infect. Dis.
174:884-888[Medline].
|
| 27.
|
Turett, G. S.,
S. Blum,
B. A. Fazal,
J. E. Justman, and E. E. Telzak.
1999.
Penicillin resistance and other predictors of mortality in pneumococcal bacteremia in a population with high human immunodeficiency virus seroprevalence.
Clin. Infect. Dis.
29:321-327[Medline].
|
| 28.
|
Yother, J., and D. E. Briles.
1992.
Structural properties and evolutionary relationships of PspA, a surface protein of Streptococcus pneumoniae, as revealed by sequence analysis.
J. Bacteriol.
174:601-609[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, October 2000, p. 3663-3669, Vol. 38, No. 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Darrieux, M., Moreno, A. T., Ferreira, D. M., Pimenta, F. C., de Andrade, A. L. S. S., Lopes, A. P. Y., Leite, L. C. C., Miyaji, E. N.
(2008). Recognition of pneumococcal isolates by antisera raised against PspA fragments from different clades. J Med Microbiol
57: 273-278
[Abstract]
[Full Text]
-
Darrieux, M., Miyaji, E. N., Ferreira, D. M., Lopes, L. M., Lopes, A. P. Y., Ren, B., Briles, D. E., Hollingshead, S. K., Leite, L. C. C.
(2007). Fusion Proteins Containing Family 1 and Family 2 PspA Fragments Elicit Protection against Streptococcus pneumoniae That Correlates with Antibody-Mediated Enhancement of Complement Deposition. Infect. Immun.
75: 5930-5938
[Abstract]
[Full Text]
-
Pimenta, F. C., Ribeiro-Dias, F., Brandileone, M. C. C., Miyaji, E. N., Leite, L. C. C., Sgambatti de Andrade, A. L. S.
(2006). Genetic Diversity of PspA Types among Nasopharyngeal Isolates Collected during an Ongoing Surveillance Study of Children in Brazil.. J. Clin. Microbiol.
44: 2838-2843
[Abstract]
[Full Text]
-
Marimon, J. M., Perez-Trallero, E., Ercibengoa, M., Gonzalez, A., Fenoll, A., on behalf of the Spanish Pneumococcal Infection St,
(2006). Molecular epidemiology and variants of the multidrug-resistant Streptococcus pneumoniae Spain14-5 international clone among Spanish clinical isolates. J Antimicrob Chemother
57: 654-660
[Abstract]
[Full Text]
-
Hollingshead, S. K., Baril, L., Ferro, S., King, J., Coan, P., Briles, D. E., the Pneumococcal Proteins Epi Study Group,
(2006). Pneumococcal surface protein A (PspA) family distribution among clinical isolates from adults over 50 years of age collected in seven countries. J Med Microbiol
55: 215-221
[Abstract]
[Full Text]
-
Trzcinski, K., Thompson, C. M., Lipsitch, M.
(2003). Construction of Otherwise Isogenic Serotype 6B, 7F, 14, and 19F Capsular Variants of Streptococcus pneumoniae Strain TIGR4. Appl. Environ. Microbiol.
69: 7364-7370
[Abstract]
[Full Text]
-
Gherardi, G., Del Grosso, M., Scotto d'Abusco, A., D'Ambrosio, F., Dicuonzo, G., Pantosti, A.
(2003). Phenotypic and Genotypic Characterization of Two Penicillin-Susceptible Serotype 6B Streptococcus pneumoniae Clones Circulating in Italy. J. Clin. Microbiol.
41: 2855-2861
[Abstract]
[Full Text]
-
Areschoug, T., Linse, S., Stalhammar-Carlemalm, M., Heden, L.-O., Lindahl, G.
(2002). A Proline-Rich Region with a Highly Periodic Sequence in Streptococcal {beta} Protein Adopts the Polyproline II Structure and Is Exposed on the Bacterial Surface. J. Bacteriol.
184: 6376-6383
[Abstract]
[Full Text]
-
Dicuonzo, G., Gherardi, G., Gertz, R. E., D'Ambrosio, F., Goglio, A., Lorino, G., Recchia, S., Pantosti, A., Beall, B.
(2002). Genotypes of Invasive Pneumococcal Isolates Recently Recovered from Italian Patients. J. Clin. Microbiol.
40: 3660-3665
[Abstract]
[Full Text]