This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghosh, S.
Right arrow Articles by Samuelson, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghosh, S.
Right arrow Articles by Samuelson, J.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, October 2000, p. 3815-3821, Vol. 38, No. 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Molecular Epidemiology of Entamoeba spp.: Evidence of a Bottleneck (Demographic Sweep) and Transcontinental Spread of Diploid Parasites

Sudip Ghosh,1 Marta Frisardi,1 Lynn Ramirez-Avila,1 Steven Descoteaux,1 Katherine Sturm-Ramirez,1 Oscar Alberto Newton-Sanchez,2 Jose Ignacio Santos-Preciado,2,dagger Chaiti Ganguly,3 Anuradha Lohia,3 Sharon Reed,4 and John Samuelson1,*

Department of Immunology and Infectious Diseases, Harvard School of Public Health, Boston, Massachusetts1; Division of Infectious Disease, Hospital Infantil, Mexico City, D.F., Mexico2; Department of Biochemistry, Bose Institute, Calcutta, India3; and Department of Medicine and Pathology, UCSD Medical Center, San Diego, California4

Received 21 December 1999/Returned for modification 25 May 2000/Accepted 9 June 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Entamoeba histolytica causes amebic colitis and liver abscess in developing countries such as Mexico and India. Entamoeba dispar is morphologically identical but is not associated with disease. Here we determined the ploidy of E. histolytica and developed PCR-based methods for distinguishing field isolates of E. histolytica or E. dispar. Fluorescence in situ hybridization showed that E. histolytica trophozoites are diploid for five "single-copy" probes tested. Intergenic sequences between superoxide dismutase and actin 3 genes of clinical isolates of E. histolytica from the New and Old Worlds were identical, as were those of E. dispar. These results suggest a bottleneck or demographic sweep in entamoebae which infect humans. In contrast, E. histolytica and E. dispar genes encoding repeat antigens on the surface of trophozoites (Ser-rich protein) or encysting parasites (chitinase) were highly polymorphic. chitinase alleles suggested that the early axenized strains of E. histolytica, HM-1 from Mexico City, Mexico, and NIH-200 from Calcutta, India, are still present and that similar E. dispar parasites can be identified in both the New and Old Worlds. Ser-rich protein alleles, which suggested the presence of the HM-1 strain in Mexico City, included some E. histolytica genes that predicted Ser-rich proteins with very few repeats. These results, which suggest diversifying selection at chitinase and Ser-rich protein loci, demonstrate the usefulness of these alleles for distinguishing clinical isolates of E. histolytica and E. dispar.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Entamoeba histolytica is a protozoan parasite that causes amebic colitis and liver abscess in developing countries such as Mexico, India, and Bangladesh (6, 17, 24, 32). The HM-1 strain of E. histolytica, which was isolated from a dysenteric patient in Mexico more than 30 years ago, still causes disease in experimental animals and has been used for nearly all immunological, biochemical, and molecular biological studies of amebae (14). E. histolytica is morphologically indistinguishable from Entamoeba dispar, which remains in the colonic lumen and so does not cause disease (8, 39, 44). Sequences of E. histolytica and E. dispar small-subunit rRNA genes differ by 1.7%, suggesting that the parasites diverged from each other tens of millions of years ago (9, 29, 40).

The haploid genome of E. histolytica contains 14 chromosomes and totals ~20 Mb (47). Homologous chromosomes vary in length and number (from one to four), suggesting that parasites may be polyploid (47). E. histolytica coding regions are AT rich, contain few introns, and are separated by relatively short intergenic regions (4, 22, 43). 5' untranslated regions of amebic genes contain conserved TATA, CAAT, GAAC, and initiation sequences (5, 41). Two palindromic copies of each rRNA gene are present on 24-kb episomal plasmids, which are present in 100 to 200 copies per nucleus (40).

The relationships between different clinical isolates of E. histolytica are not known. No monoclonal antibodies have been able to distinguish isolates of E. histolytica (17). Isoenzyme groups or zymodemes have not proven useful for differentiating strains of E. histolytica, as the majority of strains fall into two main zymodeme groups (3, 39). In addition, sequences of the genes encoding hexokinase and phosphoglucomutase, which were used to distinguish parasites, failed to reveal any heterogeneity among E. histolytica and E. dispar isolates, respectively (30, 31). Although sequences of internal transcribed spacers (ITS) between rRNA genes discriminate bacterial isolates and strains of Leishmania spp., ITS sequences failed to distinguish isolates of E. histolytica or isolates of E. dispar from Mexico City, Mexico (11, 21, 28). In contrast, axenic strains of E. histolytica have been distinguished by restriction fragment length polymorphisms of PCR products of the genes encoding the Ser-rich E. histolytica protein, also known as the K2 protein (10, 20, 42). The Ser-rich protein, which is present on the surface of amebae, is composed of an N-terminal signal sequence and a hydrophobic C-terminal anchor, surrounding a series of tetrapeptide and octapeptide repeats of hydrophilic and acidic amino acids. The Ser-rich protein is an important amebic vaccine candidate, and antibodies to the Ser-rich protein correlate with infection (27, 46, 49). The amebic chitinase, which is expressed only by cysts, also contains a series of acidic and antigenic repeats between a putative N-terminal lectin domain and a C-terminal half catalytic domain (12).

While little is known about the molecular epidemiology of amebae, much has been learned from numerous excellent molecular epidemiological studies of Plasmodium falciparum, the cause of severe malaria. First, there was apparently a recent bottleneck in the evolution of P. falciparum infecting humans, such that parasites from all over the world are identical in sequences of genes encoding housekeeping proteins (34). This bottleneck may have occurred as recently as 7,000 years ago. Second, malaria genes encoding repeat antigens on the parasite surface (e.g., circumsporozoite protein, merozoite surface protein 2, or merozoite S antigen) are extraordinarily polymorphic (2, 16, 26). Third, most of the diversity of circumsporozoite protein genes is secondary to DNA slippage rather than meiotic recombination, while maintenance of variation is likely caused by immune selection (33).

To better understand the genetics and molecular epidemiology of E. histolytica and E. dispar, we asked three questions in these studies. First, what is the ploidy of E. histolytica? Second, can intergenic sequences between superoxide dismutase and actin 3 (sod-actin) genes be used to distinguish isolates of E. histolytica and E. dispar from Mexico City, San Diego, Calif., and Calcutta, India? Third, can isolates of E. histolytica and E. dispar be distinguished by sequences of genes that encode chitinase and the Ser-rich protein?


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Fluorescence in situ hybridization (FISH) of E. histolytica trophozoites. The HM-1 strain of E. histolytica was grown axenically at 37°C in TYI medium. For production of parasites with condensed chromosomes, amebae were incubated in 7 mg of colchicine per ml for 12 h, fixed in methanol-acetic acid (3:1), treated with 20 µg of RNase per ml for 30 min, and stained with 0.3 µg of propidium iodide per ml in Antifade (Oncor). For FISH, parasites were washed in phosphate-buffered saline, swelled in 70 mM potassium chloride, fixed in methanol-acetic acid, and dropped onto uncoated slides. DNA was denatured by dipping slides in 70% formamide at 70°C. E. histolytica genes encoding chitinase, pyruvate:ferredoxin oxidoreductase, nicotinamide nucleotide transhydrogenase, plasma membrane calcium-transporting ATPase, cysteine proteinase 5, and P-glycoprotein 6 genes were labeled by nick translation with biotin using an Oncor kit (12, 13, 15, 18, 37, 48). A negative control was pBluescript without an insert. Hybridizations were performed with 4 µg of each biotinylated probe per ml in 30% formamide and 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) at 37°C for 16 h (25). Slides were washed in the same buffer, 2× SSC, and phosphate buffer plus detergent (Oncor). Probes were detected with fluorescein isothiocyanate-avidin and amplified with antiavidin antibody, followed by a second incubation with fluorescein isothiocyanate-avidin. Parasite nuclei were counterstained with propidium iodide, and slides were examined with a Leitz Orthoplan epifluorescence microscope or a Leica confocal microscope.

Isolation of amebic DNA from clinical isolates of E. histolytica and E. dispar. Stools containing amebae as shown by light microscopy came from patients presenting to (i) the Hospital Infantil in Mexico City or a neighborhood clinic in Netzahualcoyotl, which is a barrio of 100,000 persons outside Mexico City; (ii) the Kothari Medical Center in Calcutta; or (iii) the University of California at San Diego. Other parasite DNA came from axenized E. histolytica (HM-1, HK-9, and NIH-200) and E. dispar (SAW 760) strains. For the most part, amebae from clinical isolates were cultured in Robinson's medium, concentrated by low-speed centrifugation, washed in phosphate-buffered saline, and lysed in 1% sodium dodecyl sulfate-50 mM EDTA-50 mM Tris, pH 8 (1, 35). Amebic DNA was then extracted with glass milk (Elutip; Schleicher and Schuell) (36). On some occasions, DNA was isolated directly from stool parasites, which were enriched by low-speed centrifugation and lysed in the same buffer (19). Identification of isolates as E. histolytica or E. dispar was made by restriction fragment length polymorphism analysis of PCR products using primers that spanned the ITS between rRNA genes (28). The E. histolytica rRNA ITS PCR product was cut with RsaI, while E. dispar rRNA ITS PCR products were cut with EcoRV.

PCR amplification and sequencing of sod-actin, chitinase, and Ser-rich protein genes. The intergenic regions between amebic sod-actin genes of E. histolytica and E. dispar were amplified using PCR and the same set of primers (see Fig. 1) (4). A sense PCR primer (TTGGTGGAATGTAGTCAACTG) was located at the 3' end of the coding region of the superoxide dismutase gene. An antisense primer (AAATCCGGCTTTACACATTCC) bound to a sequence located at the 5' end of the coding region of the actin 3 gene. The amebic chitinase gene repeats were amplified using PCR and the same antisense primer (TCTGTATTGTGCCCAATT) for both E. histolytica and E. dispar (12). An E. histolytica chitinase-specific sense primer was GGAACACCAGGTAAATGTATA. An E. dispar chitinase-specific sense primer was GGAACACCAGGTAAATGCCTT. The amebic Ser-rich protein gene repeats were amplified using PCR and primers specific for E. histolytica and E. dispar, respectively. An E. histolytica Ser-rich protein-specific sense primer was GCTAGTCCTGAAAAGCTTGAAGAAGCTG, while an E. histolytica Ser-rich protein-specific antisense primer was GGACTTGATGCAGCATCAAGGT (20, 42). An E. dispar Ser-rich protein-specific sense primer was AGATACTAAGATTTCAGTC, while an E. dispar-specific Ser-rich protein antisense primer was CATAATGAAAGCAAAGAG (20).

The PCR products of cultured parasites were identified on agarose gels and sequenced without cloning, using Taq polymerase and cycle sequencing. For some Ser-rich protein gene analyses, DNA was extracted with glass milk from children's stools at the Hospital Infantil, and PCR was performed with the E. histolytica Ser-rich protein primers described above. A second PCR was performed with the E. histolytica Ser-rich protein-specific nested primers (sense, GTAGCTCAGCAAAACCAGAATC; antisense, TATCGTTATCTGAACTACTTC) (42). The nested E. histolytica Ser-rich protein PCR product was cloned into the TA vector (Invitrogen) and sequenced by dideoxy methods. PCR products were named for the species (E. histolytica [Eh] or E. dispar [Ed]), the source (Hospital Infantil [HI], San Diego [SD], or Kothari [K]), and the isolate number.

Methods for alignments of Ser-rich protein and chitinase gene repeats. Common algorithms for aligning sequences are not adequate for sequences containing numerous degenerate repeats. Therefore, amebic chitinase and Ser-rich protein repeat sequences were coded by methods used to compare P. falciparum circumsporozoite gene sequences (33). Briefly, each repeat that predicted a unique amino acid sequence was given a number. Silent changes in nucleotide sequences of each repeat were identified, and the numbers (names) of each repeat were modified by a unique underbar. Sequences were then assembled from these repeats, using two assumptions. First, only identical or nearly identical repeats were aligned. Second, gaps (indicated by dashes) were added wherever needed.


    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Condensed chromosomes of E. histolytica trophozoites number 28, suggesting that amebae are diploid. E. histolytica trophozoites form condensed chromosomes, which are rare in untreated amebae and frequent in amebae treated with 7 mg of colchicine per ml (Fig. 1). Each trophozoite averaged 22 ± 5, with a maximum of 28 and a minimum of 15. Assuming 14 chromosomes in haploid parasites (47) and assuming some inefficiency in counting closely opposed or small chromosomes, E. histolytica trophozoites appear to be diploid. Diploidy is consistent with the presence of two E. histolytica Ser-rich protein genes and two E. dispar Ser-rich protein genes in cDNA libraries of each parasite and the presence of two Ser-rich protein PCR products in numerous axenized strains of E. histolytica (10, 20). In contrast, the presence of as many as four bands within a linkage group on Southern blots of pulsed-field gels of E. histolytica chromosomes suggests the possibility that amebae are tetraploid for some chromosomes (47).


View larger version (78K):
[in this window]
[in a new window]
 
FIG. 1.   Fluorescence micrograph of a colchicine-treated E. histolytica trophozoite stained with propidium iodide. Condensed chromosomes number 28, which is twice the number of chromosomes (14) identified on pulsed-field gels.

E. histolytica is also diploid for five "single-copy" genes. To determine the ploidy of amebae by an independent method, we performed FISH with an arbitrary set of amebic genes, which appear to be present in a single copy as shown by Southern blotting or by repetitive probing of cDNA or genomic DNA libraries. These E. histolytica genes encoded a diverse set of proteins involved in cyst wall destruction (chitinase), fermentation (pyruvate:ferredoxin oxidoreductase), exchange of electrons (nicotinamide nucleotide transhydrogenase), ion transport (plasma membrane calcium-transporting ATPase), or host tissue destruction (cysteine proteinase 5) (12, 15, 18, 37, 48). With all five E. histolytica genes, FISH showed a mixture of diploid and tetraploid parasites (Fig. 2A through E). Diploid parasites were presumably in G1 prior to DNA synthesis, while tetraploid parasites were presumably in G2 prior to mitosis. Negative controls with vector sequences alone showed no staining. FISH was also performed with E. histolytica p-glycoprotein genes, which are present in at least six copies and encode proteins associated with emetine resistance (13). As expected, p-glycoprotein gene probes bound numerous times to amebic trophozoites (Fig. 2F). These results suggest that the basic ploidy of E. histolytica is diploid, although these results do not rule out the possibility that some amebic genes will be present in more than two copies (if genes or portions of chromosomes are duplicated) or once (if a copy of the gene is deleted).


View larger version (47K):
[in this window]
[in a new window]
 
FIG. 2.   Confocal micrographs of FISH of E. histolytica with single-copy genes encoding chitinase (A), pyruvate:ferredoxin oxidoreductase (B), nicotinamide nucleotide transhydrogenase (C), plasma membrane calcium-transporting ATPase (D), and cysteine proteinase 5 (E), which bind twice (yellow) to each nucleus. In contrast, FISH with p-glycoprotein genes (F), which are in multiple copies, shows numerous spots.

Evidence for bottlenecks or demographic sweeps in populations of E. histolytica and E. dispar. Previously, we found no differences among ITS among rRNA genes of 10 E. histolytica isolates (28). Here the intergenic sequences between superoxide dismutase and actin 3 genes of E. histolytica were sequenced, because these sequences are single copy and are longer (380 nucleotides) than ITS between rRNA genes (165 nucleotides total) (4, 28). The sod-actin intergenic sequences of three isolates of E. histolytica from Mexico City, San Diego, and Calcutta were each the same as that of the HM-1 strain (Fig. 3), even though these E. histolytica isolates differed at chitinase or Ser-rich protein loci (see below). The sod-actin intergenic sequences of five isolates of E. dispar, which came from two continents and differed from each other at chitinase or Ser-rich protein loci, were also identical to each other. The E. dispar sod-actin intergenic sequences differed in 83 nucleotides (22%) from those of E. histolytica. Conserved in the E. histolytica and E. dispar sequences was a TATA-like box upstream from the actin 3 coding region (5, 41). These results, which are consistent with the idea of a bottleneck or demographic sweep like that described previously for P. falciparum (34), indicate that human infections with each Entamoeba species derived from a single organism or from an identical group of organisms. Although these amebic bottlenecks were recent relative to the divergence of E. histolytica and E. dispar, how recent is not clear. With a great deal more sequence data available for P. falciparum, a bottleneck as recent as 7,000 years ago has been argued for (34).


View larger version (24K):
[in this window]
[in a new window]
 
FIG. 3.   Alignment of the intergenic sequences between superoxide dismutase and actin 3 genes of E. histolytica and E. dispar. Periods indicate identity of E. dispar with E. histolytica, and dashes indicate gaps. Unshaded boxes indicate superoxide dismutase and actin gene coding regions, and the dotted box indicates the TATA-like sequence upstream of the start codon of actin 3, while arrows indicate locations of PCR primers. The E. histolytica sequence was identical to that reported previously with GenBank accession no. X70852 (40).

chitinase alleles tentatively identify E. histolytica HM-1 strain amebae in Mexico City and NIH-200 strain amebae in Calcutta. Primers flanking the E. histolytica chitinase gene repeats produced a single PCR product from each clinical isolate (data not shown). This result suggests that the amebic chitinase genes are homozygous, as parasites are diploid at this locus (Fig. 2A). The chitinase PCR products were sequenced without cloning, and the sequences of the repeats were coded by methods used to compare P. falciparum circumsporozoite protein gene sequences (Fig. 4) (33). The E. histolytica chitinase gene repeats ranged from 84 to 252 nucleotides and so predicted chitinases with four heptapeptide repeats (28 amino acids) to 12 heptapeptide repeats (84 amino acids). The 168-nucleotide chitinase gene repeat of a San Diego isolate (Eh SD1) was identical to that of the HM-1 strain, while the 84-nucleotide chitinase gene repeat of a Calcutta isolate (Eh K1) was the same as those of NIH-200 amebae (12). These results, which suggest that the original axenized strains of E. histolytica may still be located in the New and Old Worlds, should be reassuring to bench scientists, who study these amebae. Because the amebae for the present studies came from individuals with amebic cysts in their stools, it is likely that E. histolytica chitinases with varying numbers of heptapeptide repeats are equally functional. This conclusion is consistent with the idea that heptapeptide repeats are spacers between lectin and catalytic domains of amebic chitinases (12).


View larger version (21K):
[in this window]
[in a new window]
 
FIG. 4.   Patterns of E. histolytica and E. dispar chitinase repeats. (A) Building blocks of chitinase repeats. Each 21-nucleotide sequence, which encodes a unique heptapeptide repeat, is given a number. The numbers are marked to indicate silent nucleotide changes, which are underlined. (B) Patterns of chitinase repeats. Shown are the chitinase PCR products from clinical isolates of E. histolytica (Eh) and E. dispar (Ed) in Mexico City (HI), San Diego (SD), and Calcutta (K). Each PCR product is coded using the numbers in panel A, while gaps are indicated by dashes.

The E. histolytica chitinase gene repeats were remarkable for the paucity of different heptapeptide sequences encoded (four) and their rigid and idiosyncratic codon usage (Fig. 4). For example, each heptapeptide repeat started with Glu, contained a Lys residue, and ended with two Ser residues. Heptapeptide EIKPDSS differed from EVKPDSS by a single, nonsilent point mutation. Glu was encoded by GAG in the first heptapeptide repeat of each chitinase repeat, while Glu was encoded by GAA in all other heptapeptide repeats. Ser in all heptapeptide repeats was encoded by TCT, which is used in only 23% of Ser residues in nonrepeat sequences of the E. histolytica chitinase gene (12). Similarly, Asp was encoded by GAC, which is infrequent in nonrepeat portions of the amebic chitinase gene and in other amebic coding sequences (43). In the absence of flanking sequences, it cannot be determined whether the chitinase gene diversity was generated by meiotic recombination or by DNA slippage, as shown previously for P. falciparum circumsporozoite protein genes (33).

E. dispar chitinase gene polymorphisms suggest transcontinental spread of parasites. Primers flanking the E. dispar chitinase gene repeats produced a single PCR product from each clinical isolate (data not shown). Eleven different E. dispar chitinase gene alleles were found in 25 clinical isolates of E. dispar from Mexico City, San Diego, and Calcutta (Fig. 4). The average number of E. dispar chitinase gene repeats (16 ± 2) was greater than those of E. histolytica (8 ± 4; P < 0.01). This result suggests that forces which cause diversifying selection at the chitinase locus are at least as active against E. dispar parasites. Five different chitinase gene repeats, which predicted 12 to 18 heptapeptides, were identified among PCR products of 10 E. dispar isolates from Mexico City. Interestingly, one of these Mexican E. dispar chitinase alleles (Ed HI1) was also identified in an E. dispar isolate from San Diego, the E. dispar cDNA library made by Egbert Tannich (SAW 760), and the strain of E. dispar axenized by Graham Clark (SAW 1734) (7, 44). These results suggest that this E. dispar strain may have traveled between the New World and the Old World, as both SAW 760 and SAW 1734 were isolated from Ethiopian Jews in Israel (David Mirelman, personal communication). A second E. dispar Mexican chitinase gene allele (Ed HI5) was identified six times in PCR products of 10 E. dispar isolates from Calcutta (Ed K1), suggesting the transcontinental movement of this E. dispar strain as well. These studies, however, cannot determine the direction of travel of the parasites.

The major difference between the predicted chitinase repeats of the North American E. dispar isolates was in the number of EIKPDSS blocks, while the major difference between predicted chitinase repeats of the Asian E. dispar isolates was in the number of EVKDSS blocks (Fig. 4). A second DTKPDSS repeat present in North American E. dispar chitinase sequences was absent from Asian E. dispar chitinase sequences. These results suggest the possibility that strains may be tentatively identified as North American type or Asian type by the patterns of their chitinase gene repeats.

Ser-rich protein gene polymorphisms among clinical isolates of E. histolytica suggest the persistence of the early axenized strain in Mexico City. Primers flanking the E. histolytica and E. dispar Ser-rich protein gene repeats frequently produced two PCR products on agarose gels from one clinical isolate (data not shown). This result suggests that the amebae are often heterozygous at the Ser-rich protein locus, as has been shown previously for axenic strains of E. histolytica and the SAW 760 strain used to make the E. dispar cDNA library (10, 20). Because only one Ser-rich protein PCR product was usually obtained from each clinical isolate (indicating that one Ser-rich protein PCR product was lost), we were unable to determine the linkage between chitinase gene and Ser-rich protein gene polymorphisms. The Ser-rich protein PCR product from one Mexican E. histolytica isolate (Eh HI1) matched one of the cloned Ser-rich protein genes of HM-1 parasites (Fig. 5). Two other isolates of E. histolytica from stools of children in Mexico City showed Ser-rich protein alleles, which encoded proteins with few (four to six) tetrapeptide and octapeptide repeats.


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 5.   Patterns of E. histolytica and E. dispar Ser-rich protein repeats. (A) Building blocks of Ser-rich protein repeats. Each 24-nucleotide sequence, which encodes a unique octapeptide repeat, or 12-nucleotide sequence, which encodes a unique tetrapeptide repeat, is given a number. The numbers are marked to indicate silent nucleotide changes, which are underlined. (B) Patterns of Ser-rich protein repeats. Shown are Ser-rich protein PCR products from clinical isolates of E. histolytica (Eh) and E. dispar (Ed) in Mexico City (HI) and Calcutta (K). Each PCR product is coded using the numbers in panel A, while gaps are indicated by dashes.

Multiple clinical isolates of E. dispar contained varying patterns of Ser-rich protein repeats, consistent with diversifying selection at this locus in noninvasive parasites (Fig. 5). These Ser-rich protein repeats differed from each other according to rules which were not quite so rigid as those of chitinase repeats. As was the case with chitinase gene repeats, the average number of Ser-rich protein repeats of E. dispar strains (21 ± 2) was greater than that of E. histolytica strains (8 ± 5; P < 0.01). Because the function of the Ser-rich protein is not known, the significance of these differences in Ser-rich protein repeat number is not clear.

It is possible that diversifying selection of Ser-rich proteins is immunologically mediated, as has been argued previously for malaria surface antigens (2, 16, 26). The tetrapeptide and octapeptide repeats of the Ser-rich protein are targets of human B-cell activation and anti-amebic antibody production, and animals immunized with the Ser-rich protein are subsequently resistant to amebic challenge of the liver (27, 46, 49). Other evidence for human immunity to E. histolytica parasites is the correlation between noninvasive disease and antibodies to certain epitopes of the Gal/GalNAc lectin, which is another important amebic vaccine candidate (23).

Implications of these data for genetic and molecular epidemiological studies of amebae. The data here are too fragmentary for us to make any strong conclusions concerning populations of amebae which infect humans. This is particularly the case for E. histolytica clinical isolates. Still, a few implications of this data are worth noting. First, the E. histolytica genome appears to be diploid like those of most other eukaryotes. Whether amebae have a cryptic haploid stage and sex or reproduce clonally remains to be determined (45). Second, the HM-1 strain, which is the E. histolytica genome sequencing project strain, is likely identical in most aspects to other E. histolytica strains (sod-actin data). Although there is no guarantee that genes have not been lost from the HM-1 strain, it is reassuring that these parasites still cause lesions in animal models (23, 49). A possible explanation for the demographic sweep or bottleneck in human populations of E. histolytica is that amebae, like P. falciparum, predominantly infect humans and do not infect other mammalian hosts. Third, it appears that Ser-rich protein and chitinase alleles may be used to discriminate isolates of E. histolytica or E. dispar, at least in big cities, where these studies were performed (38). As parasites were homozygous at the chitinase locus, chitinase alleles may be easier to work with than Ser-rich protein alleles. Fourth, it appears that the HM-1 strain of E. histolytica, which was isolated more than 30 years ago from Mexico City, is still there and in San Diego (chitinase and Ser-rich protein data) (14). Previously, the pattern of the Ser-rich protein repeats was shown to remain constant during 30-plus years of culture (10). Fifth, chitinase gene alleles suggest that some E. dispar parasites have spread between the Old and New Worlds, although the direction of spread cannot be determined.


    ACKNOWLEDGMENTS

This work was supported in part by grants from the NIH (AI-33492 and GM-31818 [J.S.] and AI-28035 and DK-35108 [S.R.]), the US-Mexico Foundation for Science (J.S.), the US-India Fund (J.S. and A.L.), CONACYT (J.I.S.P.) and CSIR (A.L.).

We thank K. N. Jalan of the Kothari Institute in Calcutta for cultures of E. histolytica and E. dispar. We thank Graham Clark of the London School of Tropical Medicine and Hygiene for frozen pellets of axenized amebae. We acknowledge the expert technical support of Jean Lai of the Harvard School of Public Health for confocal microscopy.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Immunology and Infectious Diseases, Harvard School of Public Health, 665 Huntington Ave., Boston, MA 02115. Phone: (617) 432-4670. Fax: (617) 738-4914. E-mail: jsamuels{at}hsph.harvard.edu.

dagger Present address: The National Immunization Council and The National Child Health Program, CONAVA, Mexico City, D.F., Mexico.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

1. Acuna-Soto, R., J. Samuelson, P. de Gerolami, L. Zarate, G. Schoolnik, F. Millan-Velasco, and D. Wirth. 1992. Application of polymerase chain reaction to the epidemiology of pathogenic and nonpathogenic Entamoeba histolytica. Am. J. Trop. Med. Hyg. 48:58-70.
2. Anders, R. F., D. J. McColl, and R. L. Coppel. 1993. Molecular variation in Plasmodium falciparum: polymorphic antigens of asexual erythrocyte stages. Acta Trop. 53:239-253[CrossRef][Medline].
3. Blanc, D., and P. G. Sargeaunt. 1991. Entamoeba histolytica zymodemes: exhibition of delta  and gamma  bands only of glucose phosphate isomerase and phosphoglucomutase may be influenced by starch content in the medium. Exp. Parasitol. 72:87-90[CrossRef][Medline].
4. Bruchhaus, I., M. Leippe, C. Lioutas, and E. Tannich. 1994. Unusual gene organization in the protozoan parasite Entamoeba histolytica. DNA Cell Biol. 12:925-933.
5. Bub, H., C. Lioutas, S. Dobinsky, R. Nickel, and E. Tannich. 1995. Analysis of the 170-kDa lectin gene promoter of Entamoeba histolytica. Mol. Biochem. Parasitol. 72:1-10[CrossRef][Medline].
6. Caballero-Salcedo, A., M. Viveros-Rogel, B. Salvatierra, R. Tapia-Conyer, J. Sepulveda-Amor, G. Gutierrez, and L. Ortiz-Ortiz. 1994. Seroepidemiology of amebiasis in Mexico. Am. J. Trop. Med. Hyg. 50:412-419.
7. Clark, C. G. 1995. Axenic cultivation of Entamoeba dispar Brumpt 1925, Entamoeba insolita Geiman and Wichterman 1937 and Entamoeba ranarum Grassi 1879. J. Eukaryot. Microbiol. 42:590-593[Medline].
8. Clark, C. G. 1998. Amoebic disease. Entamoeba dispar, an organism reborn. Trans. R. Soc. Trop. Med. Hyg. 92:361-364[CrossRef][Medline].
9. Clark, C. G., and L. S. Diamond. 1991. Ribosomal RNA genes of `pathogenic' and `nonpathogenic' Entamoeba histolytica are distinct. Mol. Biochem. Parasitol. 49:297-302[CrossRef][Medline].
10. Clark, C. G., and L. S. Diamond. 1993. Entamoeba histolytica: a method for isolate identification. Exp. Parasitol. 77:450-455[CrossRef][Medline].
11. Cupolillo, E., G. Grimaldi, Jr., H. Momen, and S. M. Beverley. 1995. Intergenic region typing (IRT): a rapid molecular approach to the characterization and evolution of Leishmania. Mol. Biochem. Parasitol. 73:145-155[CrossRef][Medline].
12. de la Vega, H., C. A. Specht, C. E. Semino, P. W. Robbins, D. Eichinger, D. Caplivski, S. Ghosh, and J. Samuelson. 1997. Cloning and expression of chitinases of Entamoebae. Mol. Biochem. Parasitol. 85:139-147[CrossRef][Medline].
13. Descoteaux, S., P. Ayala, J. Samuelson, and E. Orozco. 1995. Increase in mRNA of multiple Eh pgp genes encoding P-glycoprotein homologues in emetine-resistant Entamoeba histolytica parasites. Gene 164:179-184[CrossRef][Medline].
14. Diamond, L. S., and C. G. Clark. 1993. A redescription of Entamoeba histolytica Schaudinn, 1903 (emended Walker, 1911) separating it from Entamoeba dispar Brumpt, 1925. J. Eukaryot. Microbiol. 40:340-344[Medline].
15. Ghosh, S. K., B. Rosenthal, R. Rogers, and J. Samuelson. 2000. Vacuolar localization of an Entamoeba histolytica homologue of the plasma membrane calcium-transporting ATPase (PMCA). Mol. Biochem. Parasitol. 108:125-130[CrossRef][Medline].
16. Gupta, S., K. Treenholme, R. M. Anderson, and K. P. Day. 1994. Antigenic diversity and the transmission dynamics of Plasmodium falciparum. Science 263:961-963[Abstract/Free Full Text].
17. Haque, R., A. S. Faruque, P. Hahn, D. M. Lyerly, and W. A. Petri, Jr. 1997. Entamoeba histolytica and Entamoeba dispar infection in children in Bangladesh. J. Infect. Dis. 175:734-736[Medline].
18. Jacobs, T., I. Bruchhaus, T. Dandekar, E. Tannich, and M. Leippe. 1998. Isolation and molecular characterization of a surface-bound proteinase of Entamoeba histolytica. Mol. Microbiol. 27:269-276[CrossRef][Medline].
19. Katzwinkel-Wladarsch, S., T. Loscher, and H. Rinder. 1994. Direct amplification and differentiation of pathogenic and nonpathogenic Entamoeba histolytica DNA from stool specimens. Am. J. Trop. Med. Hyg. 51:115-118.
20. Kohler, S., and E. Tannich. 1993. A family of transcripts (K2) of Entamoeba histolytica contains polymorphic repetitive regions with highly conserved elements. Mol. Biochem. Parasitol. 59:49-58[CrossRef][Medline].
21. Kostman, J. R., M. B. Alden, M. Mair, T. D. Edlind, J. J. LiPuma, and T. L. Stull. 1995. A universal approach to bacterial molecular epidemiology by polymerase chain reaction ribotyping. J. Infect. Dis. 171:204-208[Medline].
22. Lohia, A., and J. Samuelson. 1993. Cloning of the Eh cdc2 gene from Entamoeba histolytica encoding a protein kinase p34cdc2 homologue. Gene 127:203-207[CrossRef][Medline].
23. Lotter, H., T. Zhang, K. B. Seydel, S. L. Stanley, Jr., and E. Tannich. 1997. Identification of an epitope on the Entamoeba histolytica 170-kD lectin conferring antibody-mediated protection against invasive amebiasis. J. Exp. Med. 185:1793-1801[Abstract/Free Full Text].
24. Martinez-Palomo, A., and M. Martinez-Baez. 1983. Selective primary health care: strategies for control of disease in the developing world. X. Amebiasis. Rev. Infect. Dis. 5:1093-1102[Medline].
25. McNeil, J. A., C. V. Johnson, K. C. Carter, R. H. Singer, and J. B. Lawrence. 1991. Localizing DNA and RNA within nuclei and chromosomes by fluorescence in situ hybridization. Genet. Anal. Tech. Appl. 8:41-58[Medline].
26. Miller, L. H., T. Roberts, M. Shahabuddin, and T. McCutchan. 1993. Analysis of sequence diversity in the Plasmodium falciparum merozoite surface protein-1 (MSP-1). Mol. Biochem. Parasitol. 59:1-14[CrossRef][Medline].
27. Myung, K., D. Burch, T. F. H. G. Jackson, and S. L. Stanley, Jr. 1992. Serodiagnosis of invasive amebiasis using a recombinant Entamoeba histolytica antigen-based ELISA. Arch. Med. Res. 23:285-288[Medline].
28. Newton-Sanchez, O., K. Sturm-Ramirez, J. L. Romero-Zamora, J. I. Santos-Preciado, and J. Samuelson. 1997. High rate of occult infection with Entamoeba histolytica among non-dysenteric Mexican children. Arch. Med. Res. 28S:311-313.
29. Novati, S., M. Sironi, S. Granata, A. Bruno, S. Gatti, M. Scaglia, and C. Bandi. 1996. Direct sequencing of the PCR amplified SSU rRNA gene of Entamoeba dispar and the design of primers for rapid differentiation from Entamoeba histolytica. Parasitology 112:363-369.
30. Ortner, S., M. Binder, O. Scheiner, G. Wiedermann, and M. Duchene. 1997. Molecular and biochemical characterization of phosphoglucomutases from Entamoeba histolytica and Entamoeba dispar. Mol. Biochem. Parasitol. 90:121-129[CrossRef][Medline].
31. Ortner, S., C. G. Clark, M. Binder, O. Scheiner, G. Wiedermann, and M. Duchene. 1997. Molecular biology of the hexokinase isoenzyme pattern that distinguishes pathogenic Entamoeba histolytica from nonpathogenic Entamoeba dispar. Mol. Biochem. Parasitol. 86:85-94[Medline].
32. Ravdin, J. I. 1995. Amebiasis. State-of-the-art clinical article. Clin. Infect. Dis. 20:1453-1466[Medline].
33. Rich, S. M., R. R. Hudson, and F. J. Ayala. 1997. Plasmodium falciparum antigenic diversity: evidence of clonal population structure. Proc. Natl. Acad. Sci. USA 94:13040-13045[Abstract/Free Full Text].
34. Rich, S. M., M. C. Licht, R. R. Hudson, and F. J. Ayala. 1998. Malaria's Eve: evidence of a recent population bottleneck throughout the world populations of Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 95:4425-4430[Abstract/Free Full Text].
35. Robinson, G. 1968. The laboratory identification of human parasitic amoebae. Trans. R. Soc. Trop. Med. Hyg. 62:285-294[CrossRef][Medline].
36. Romero, J. L., S. Reed, E. Orozco, J. I. Santos, and J. Samuelson. 1992. Use of the polymerase chain reaction and nonradioactive DNA probes to diagnose Entamoeba histolytica in clinical samples. Arch. Med. Res. 23:277-279[Medline].
37. Rosenthal, B., Z. Mai, D. Caplivski, S. Ghosh, H. de la Vega, T. Graf, and J. Samuelson. 1997. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica. J. Bacteriol. 179:3736-3745[Abstract/Free Full Text].
38. Samuelson, J., D. Caplivski, K. Sturm-Ramirez, K. Kretsinger, S. Descoteaux, G. Hernandez, G. Vargas, R. Mammo, O. Newton, J. Santos, J. H. de la Vega, P. Robbins, C. Ganguly, and A. Lohia. 1997. A proposal for a molecular biologic system for classifying isolates of Entamoeba histolytica and Entamoeba dispar. Arch. Med. Res. 28:274-275.
39. Sargeaunt, P. G., J. E. Williams, and J. D. Greene. 1978. The differentiation of invasive and non-invasive E. histolytica by isoenzyme electrophoresis. Trans. R. Soc. Trop. Med. Hyg. 72:519-521[CrossRef][Medline].
40. Sehgal, D., V. Mittel, S. Ramachandran, S. K. Dhar, A. Bhattacharya, and S. Bhattacharya. 1994. Nucleotide sequence organization and analysis of the nuclear ribosomal DNA circle of the protozoan parasite Entamoeba histolytica. Mol. Biochem. Parasitol. 67:205-214[CrossRef][Medline].
41. Singh, U., J. B. Rogers, B. J. Mann, and W. A. Petri, Jr. 1997. Transcription initiation is controlled by three core promoter elements in the hgl5 gene of the protozoan parasite Entamoeba histolytica. Proc. Natl. Acad. Sci. USA 94:8812-8817[Abstract/Free Full Text].
42. Stanley, S. L., Jr., A. Becker, C. Kunz-Jenkins, L. Foster, and E. Li. 1990. Cloning and expression of a membrane antigen of Entamoeba histolytica possessing multiple tandem repeats. Proc. Natl. Acad. Sci. USA 87:4976-4980[Abstract/Free Full Text].
43. Tannich, E., and R. D. Horstmann. 1992. Codon usage in pathogenic Entamoeba histolytica. J. Mol. Evol. 34:272-273[CrossRef][Medline].
44. Tannich, E., R. D. Horstmann, J. Knobloch, and H. H. Arnold. 1989. Genomic DNA differences between pathogenic and nonpathogenic Entamoeba histolytica. Proc. Natl. Acad. Sci. USA 86:5118-5122[Abstract/Free Full Text].
45. Tibayrenc, M., F. Kjellberg, J. Arnaud, B. Oury, S. F. Breniere, M.-L. Darde, and F. J. Ayala. 1991. Are eukaryotic microorganisms clonal or sexual? A population genetics vantage. Proc. Natl. Acad. Sci. USA 88:5129-5133[Abstract/Free Full Text].
46. Wang, L., J. Calderon, and S. L. Stanley, Jr. 1997. Short report: identification of B-cell epitopes in the serine-rich Entamoeba histolytica protein. Am. J. Trop. Med. Hyg. 57:723-726.
47. Willhoeft, U., and E. Tannich. 1999. The electrophoretic karyotype of Entamoeba histolytica. Mol. Biochem. Parasitol. 99:41-53[CrossRef][Medline].
48. Yu, Y., and J. Samuelson. 1994. Primary structure of Entamoeba histolytica nicotinamide nucleotide transhydrogenase. Mol. Biochem. Parasitol. 68:323-328[CrossRef][Medline].
49. Zhang, T., P. R. Cieslak, and S. L. Stanley, Jr. 1994. Protection of gerbils from amebic liver abscess by immunization with a recombinant Entamoeba histolytica antigen. Infect. Immun. 62:1166-1170[Abstract/Free Full Text].


Journal of Clinical Microbiology, October 2000, p. 3815-3821, Vol. 38, No. 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Pritham, E. J. (2009). Transposable Elements and Factors Influencing their Success in Eukaryotes. J Hered 100: 648-655 [Abstract] [Full Text]  
  • Pal, D., Banerjee, S., Cui, J., Schwartz, A., Ghosh, S. K., Samuelson, J. (2009). Giardia, Entamoeba, and Trichomonas Enzymes Activate Metronidazole (Nitroreductases) and Inactivate Metronidazole (Nitroimidazole Reductases). Antimicrob. Agents Chemother. 53: 458-464 [Abstract] [Full Text]  
  • Valenzuela, O., Moran, P., Ramos, F., Cardoza, J. I., Garcia, G., Valadez, A., Rojas, L., Garibay, A., Gonzalez, E., Ximenez, C. (2009). Two Different Chitinase Genotypes in a Patient with an Amebic Liver Abscess: A Case Report. Am J Trop Med Hyg 80: 51-54 [Abstract] [Full Text]  
  • Fotedar, R., Stark, D., Beebe, N., Marriott, D., Ellis, J., Harkness, J. (2007). Laboratory Diagnostic Techniques for Entamoeba Species. Clin. Microbiol. Rev. 20: 511-532 [Abstract] [Full Text]  
  • Ali, I. K. M., Zaki, M., Clark, C. G. (2005). Use of PCR Amplification of tRNA Gene-Linked Short Tandem Repeats for Genotyping Entamoeba histolytica. J. Clin. Microbiol. 43: 5842-5847 [Abstract] [Full Text]  
  • Bhattacharya, D., Haque, R., Singh, U. (2005). Coding and Noncoding Genomic Regions of Entamoeba histolytica Have Significantly Different Rates of Sequence Polymorphisms: Implications for Epidemiological Studies. J. Clin. Microbiol. 43: 4815-4819 [Abstract] [Full Text]  
  • Pritham, E. J., Feschotte, C., Wessler, S. R. (2005). Unexpected Diversity and Differential Success of DNA Transposons in Four Species of Entamoeba Protozoans. Mol Biol Evol 22: 1751-1763 [Abstract] [Full Text]  
  • MORAN, P., RAMOS, F., RAMIRO, M., CURIEL, O., GONZALEZ, E., VALADEZ, A., GOMEZ, A., GARCIA, G., MELENDRO, E. I., XIMENEZ, C. (2005). INFECTION BY HUMAN IMMUNODEFICIENCY VIRUS-1 IS NOT A RISK FACTOR FOR AMEBIASIS. Am J Trop Med Hyg 73: 296-300 [Abstract] [Full Text]  
  • Shah, P. H., MacFarlane, R. C., Bhattacharya, D., Matese, J. C., Demeter, J., Stroup, S. E., Singh, U. (2005). Comparative Genomic Hybridizations of Entamoeba Strains Reveal Unique Genetic Fingerprints That Correlate with Virulence. Eukaryot Cell 4: 504-515 [Abstract] [Full Text]  
  • Rich, S. M. (2004). The unpredictable past of Plasmodium vivax revealed in its genome. Proc. Natl. Acad. Sci. USA 101: 15547-15548 [Full Text]  
  • Haghighi, A., Kobayashi, S., Takeuchi, T., Thammapalerd, N., Nozaki, T. (2003). Geographic Diversity among Genotypes of Entamoeba histolytica Field Isolates. J. Clin. Microbiol. 41: 3748-3756 [Abstract] [Full Text]  
  • Haque, R., Huston, C. D., Hughes, M., Houpt, E., Petri, W. A. Jr. (2003). Amebiasis. NEJM 348: 1565-1573 [Full Text]  
  • Haghighi, A., Kobayashi, S., Takeuchi, T., Masuda, G., Nozaki, T. (2002). Remarkable Genetic Polymorphism among Entamoeba histolytica Isolates from a Limited Geographic Area. J. Clin. Microbiol. 40: 4081-4090 [Abstract] [Full Text]  
  • Van Dellen, K., Ghosh, S. K., Robbins, P. W., Loftus, B., Samuelson, J. (2002). Entamoeba histolytica Lectins Contain Unique 6-Cys or 8-Cys Chitin-Binding Domains. Infect. Immun. 70: 3259-3263 [Abstract] [Full Text]  
  • Zaki, M., Clark, C. G. (2001). Isolation and Characterization of Polymorphic DNA from Entamoeba histolytica. J. Clin. Microbiol. 39: 897-905 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ghosh, S.
Right arrow Articles by Samuelson, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ghosh, S.
Right arrow Articles by Samuelson, J.