This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vaneechoutte, M.
Right arrow Articles by Verschraegen, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vaneechoutte, M.
Right arrow Articles by Verschraegen, G.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, October 2000, p. 3870-3871, Vol. 38, No. 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Isolation of Moraxella canis from an Ulcerated Metastatic Lymph Node

Mario Vaneechoutte,1,* Geert Claeys,1 Sophia Steyaert,1 Thierry De Baere,1 Renaat Peleman,2 and Gerda Verschraegen1

Department of Chemistry, Microbiology and Immunology1 and Department of Pulmonology,2 Ghent University Hospital, Ghent, Belgium

Received 15 May 2000/Returned for modification 21 July 2000/Accepted 9 August 2000


    ABSTRACT
Top
Abstract
Text
References

Moraxella canis was isolated in large numbers from an ulcerated supraclavicular lymph node of a terminal patient, who died a few days later. Although the patient presented with septic symptoms and with a heavy growth of gram-negative diplococci in the lymph node, blood cultures remained negative. M. canis is an upper-airway commensal from dogs and cats and is considered nonpathogenic for humans, although this is the third reported human isolate of this species.


    TEXT
Top
Abstract
Text
References

Case report. A 51-year-old patient who was a 55-pack-per-year smoker and who had a long history of serious, chronic obstructive pulmonary disease was sent to the hospital in October 1998 because of dyspnea. A primary bronchial carcinoma was diagnosed. Biopsy of the left supraclavicular lymph node revealed a moderately differentiated adenocarcinoma. Palliative radiotherapy was started but was stopped in December 1998, and the patient was sent home during the first week of January.

The patient was in a cachectic, immunodepressed condition, presented with fever and chills, and had a large ulcer at the left supraclavicular lymph node. A differential diagnosis of sepsis and tumor was made. Computed tomography of the thorax showed a large necrotic nodus at the left supraclavicular lymph node and a tumor at the right lower lobe in association with pleural fluid effusion and a diffuse metastasized bronchial carcinoma. Staphylococcus aureus in small numbers and Moraxella canis in large numbers were isolated from the ulcer wound. Blood cultures remained negative. The patient was discharged 2 days later and died shortly thereafter at home.

The oxidase-positive gram-negative diplococci were given a preliminary identification as M. canis after observation of brown pigmentation of the Mueller-Hinton II agar (MHAII; BBL Becton Dickinson, Cockeysville, Md.), used routinely for disk diffusion susceptibility testing. This characteristic was present in 15 of the 16 previously described isolates of M. canis, while absent in all other Moraxella species (2). Further differentiation from other Moraxella species was possible on the basis of a positive DNase reaction, acetate assimilation positivity, and a positive gamma glutamyl aminopeptidase reaction (2).

The isolate (LBV436) was resistant to ampicillin and susceptible to co-trimoxazole, doxycycline, fucidic acid, vancomycin, rifampin, gentamicin, and quinolones. Production of beta -lactamase has been demonstrated in some strains of M. canis (2), and this strain was also beta -lactamase positive.

M. canis, together with Moraxella catarrhalis, Moraxella cuniculi, Moraxella caviae, Moraxella ovis, and Moraxella sp. incertae sedis strain NCTC 4103 belong to the coccal moraxellae, which, in contrast to the bacillary moraxellae, all exhibit DNase activity. M. canis and strain NCTC 4103 differ from all other coccoid moraxellae by the production of gamma glutamyl aminopeptidase and the ability to grow on MHAII at room temperature. Moreover, M. canis and, to a weaker extent, strain NCTC 4103 produce a brownish pigment on this growth medium, which is a feature not shown by any other moraxellae.

To our knowledge, this is the third isolation of M. canis from humans. The first isolate (N7T, CCUG 8415AT) was from a dog bite wound in a Swedish female in 1979, for which no further clinical data are available (2). Wüst et al. (7) described a blood culture isolate (U33, BLU8387) obtained in 1988 from a 61-year-old alcoholic Swiss male with bleeding esophageal varices who was hospitalized for symptoms suggesting pneumonia. The cachectic immunodepressed condition of our patient is comparable to that of the Swiss patient (7). All other known isolates of this species are commensals isolated from dog saliva (P37, Paris) (2) or swabs from dog muzzles (one was from a cat muzzle) (2), from which M. canis could be cultured only after suppression of other commensal bacteria with a selective medium (4).

Sequence determination of the first 450 to 700 bp of the PCR-amplified 16S rRNA gene was carried out for isolate LBV436, for four of the previously collected M. canis strains (O18, P37, U33, and W4), for strain NCTC 4103, for an unidentified gram-negative diplococcus isolated from a dog bite (MOR32), and for a Moraxella strain producing yellowish pigment on MHAII (LBV438). The complete sequence was determined for the M. canis type strain N7. Amplification was done by PCR with the primers 5'-AGT TTG ATC CTG GCT CAG and 5'-TAC CTT GTT ACG ACT TCG TCC CA. The reactions were performed in a final reaction mixture of 50 µl containing 25 µl of Master Mix (Qiagen, Hilden, Germany), a 0.2-µM concentration of each primer, and 5 µl of a DNA suspension obtained by alkaline lysis. Alkaline lysis was done by suspending one colony in 20 µl of 0.25% sodium dodecyl sulfate-0.05 N NaOH and heating at 95°C for 15 min, followed by a final dilution with 180 µl of distilled water. The amplification reactions were performed in a GeneAmp PCR System 9600 (Applied Biosystems, Foster City, Calif.) with the following cycling parameters: 94°C for 5 min, followed by 3 cycles of 45 s at 94°C, 2 min at 50°C, 1 min at 72°C, and 30 cycles of 20 s at 94°C, 1 min at 50°C, 1 min at 72°C, with a final extension at 72°C for 7 min. The presence of amplification products was checked by electrophoresis on 2% agarose gels stained with ethidium bromide. The amplification products were then purified with the Concert PCR purification kit (Gibco BRL Life Technologies, Merelbeke, Belgium), used according to the manufacturer's instructions. Sequencing was done using the ABI Big Dye cycle sequencing reaction kit with AmpliTaq FS DNA polymerase (Applied Biosystems) with the following primers: 5' AGT TTG ATC CTG GCT CAG (Escherichia coli 16S rRNA gene sequence position 8 to 27), 5'CTCCTACGGGAGGCAGCAGT (339 to 358 bp), 5'CAGCAGCCGCGGTAATAC (519 to 536), 5'AACTCAAAGGAATTGACGG (908 to 926), 5'AGTCCCGCAACGAGCGCAAC (1093 to 1112), and 5'GCTACACACGTGCTACAATG (1222 to 1241) (1). Electrophoresis was performed on an ABI 310 analyzer. Analysis of the sequences and clustering was done by GeneCompar, version 2.0 (Applied Maths, Kortrijk, Belgium).

The clinical isolate reported here revealed 100% 16S rDNA sequence identity with U33 (the clinical isolate described by Wüst et al. [7]) and above 99% identity with the other four M. canis strains sequenced and with strain NCTC 4103. Less than 96% identity was observed with the 16S rDNA sequences of other Moraxella species (3). The dog bite isolate MOR32 was identified as Neisseria weaveri, and the Moraxella isolate which produced yellow pigmentation on MHAII (LBV438) was identified as M. osloensis (Fig. 1).


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1.   Dendrogram based on clustering by means of the unweighted pair groups method using arithmetic averages (open gap penalty, 100%; unit gap penalty, 0%) of 16S rDNA sequences published for the genus Moraxella and obtained in this study.

M. canis can also be differentiated from all other Moraxella species by amplification of the tRNA intergenic spacers (6) and determination of the tRNA intergenic-spacer lengths by means of capillary electrophoresis (5). M. canis and M. catarrhalis had tRNA spacer fragments with lengths of 66, 81, and 215 bp in common, which were absent in M. caviae, M. cuniculi, Moraxella lacunata, Moraxella nonliquefaciens, M. osloensis, and M. ovis and could be differentiated from each other by the presence of a fragment of 193 bp in M. canis tDNA PCR fingerprints and the presence of fragments of 167 and 179 bp in M. catarrhalis fingerprints.

Despite the fact that M. canis was isolated in large numbers from the clinical site, the organism has to be considered an opportunistic pathogen, since this strain was isolated from a heavily debilitated patient, as was the case for the Swiss patient (7). Whether our patient lived in close contact with dogs or cats could not be investigated.

In conclusion, gram-negative oxidase-positive diplococci which produce brownish pigment on MHAII are most probably M. canis, a Moraxella species that is a commensal of dogs and cats and that exceptionally can be isolated from clinical samples in humans.


    FOOTNOTES

* Corresponding author. Mailing address: Laboratory of Bacteriology & Virology, Blok A, Ghent University Hospital, De Pintelaan 185, B9000 Ghent, Belgium. Phone: 32 9 240 36 92. Fax: 32 9 240 36 59. E-mail: Mario.Vaneechoutte{at}rug.ac.be.


    REFERENCES
Top
Abstract
Text
References

1. Coenye, T., E. Falsen, M. Vancanneyt, B. Hoste, J. R. W. Govan, K. Kersters, and P. Vandamme. 1999. Classification of Alcaligenes faecalis-like isolates from the environment and human clinical samples as Ralstonia gilardii sp. nov. Int. J. Syst. Bacteriol. 49:405-413[Abstract/Free Full Text].
2. Jannes, G., M. Vaneechoutte, M. Lannoo, M. Gillis, M. Vancanneyt, P. Vandamme, G. Verschraegen, H. Van Heuverswyn, and R. Rossau. 1993. Polyphasic taxonomy leading to the proposal of Moraxella canis sp. nov. for Moraxella catarrhalis-like strains. Int. J. Syst. Bacteriol. 43:438-449[Abstract/Free Full Text].
3. Pettersson, B., A. Kodjo, M. Ronaghi, M. Uhlén, and T. Tonjum. 1998. Phylogeny of the family Moraxellaceae by 16S rDNA sequence analysis, with special emphasis on differentiation of Moraxella species. Int. J. Syst. Bacteriol. 48:75-89[Abstract/Free Full Text].
4. Vaneechoutte, M., G. Verschraegen, G. Claeys, and A.-M. Van den Abeele. 1988. A selective medium for Branhamella catarrhalis, with acetazolamide as a specific inhibitor of Neisseria spp. J. Clin. Microbiol. 26:2544-2548[Abstract/Free Full Text].
5. Vaneechoutte, M., P. Boerlin, H.-V. Tichy, E. Bannerman, B. Jäger, and J. Bille. 1998. Comparison of PCR-based DNA fingerprinting techniques for the identification of Listeria species and their use for atypical Listeria isolates. Int. J. Syst. Bacteriol. 48:127-139[Abstract/Free Full Text].
6. Welsh, J., and M. McClelland. 1991. Genomic fingerprints produced by PCR with consensus tRNA gene primers. Nucleic Acids Res. 19:861-866[Abstract/Free Full Text].
7. Wüst, J., G. V. Doern, and A. von Graevenitz. 1988. Branhamella catarrhalis: fatty acid and lipopolysaccharide analysis of an atypical strain from blood culture. Diagn. Microbiol. Infect. Dis. 10:131-134[CrossRef][Medline].


Journal of Clinical Microbiology, October 2000, p. 3870-3871, Vol. 38, No. 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Vaneechoutte, M., Nemec, A., Musilek, M., van der Reijden, T. J. K., van den Barselaar, M., Tjernberg, I., Calame, W., Fani, R., De Baere, T., Dijkshoorn, L. (2009). Description of Acinetobacter venetianus ex Di Cello et al. 1997 sp. nov.. Int. J. Syst. Evol. Microbiol. 59: 1376-1381 [Abstract] [Full Text]  
  • Van Hoovels, L., Vankeerberghen, A., Boel, A., Van Vaerenbergh, K., De Beenhouwer, H. (2006). First Case of Staphylococcus pseudintermedius Infection in a Human. J. Clin. Microbiol. 44: 4609-4612 [Abstract] [Full Text]  
  • Vaneechoutte, M., Young, D. M., Ornston, L. N., De Baere, T., Nemec, A., Van Der Reijden, T., Carr, E., Tjernberg, I., Dijkshoorn, L. (2006). Naturally Transformable Acinetobacter sp. Strain ADP1 Belongs to the Newly Described Species Acinetobacter baylyi. Appl. Environ. Microbiol. 72: 932-936 [Abstract] [Full Text]  
  • Stakenborg, T., Vicca, J., Verhelst, R., Butaye, P., Maes, D., Naessens, A., Claeys, G., De Ganck, C., Haesebrouck, F., Vaneechoutte, M. (2005). Evaluation of tRNA Gene PCR for Identification of Mollicutes. J. Clin. Microbiol. 43: 4558-4566 [Abstract] [Full Text]  
  • Van daele, S. G., Franckx, H., Verhelst, R., Schelstraete, P., Haerynck, F., Van Simaey, L., Claeys, G., Vaneechoutte, M., de Baets, F. (2005). Epidemiology of Pseudomonas aeruginosa in a cystic fibrosis rehabilitation centre. Eur Respir J 25: 474-481 [Abstract] [Full Text]  
  • De Baere, T., Verhelst, R., Labit, C., Verschraegen, G., Wauters, G., Claeys, G., Vaneechoutte, M. (2004). Bacteremic Infection with Pantoea ananatis. J. Clin. Microbiol. 42: 4393-4395 [Abstract] [Full Text]  
  • Vaneechoutte, M., Kampfer, P., De Baere, T., Falsen, E., Verschraegen, G. (2004). Wautersia gen. nov., a novel genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species, and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al. 1990) comb. nov.. Int. J. Syst. Evol. Microbiol. 54: 317-327 [Abstract] [Full Text]  
  • Wauters, G., De Baere, T., Willems, A., Falsen, E., Vaneechoutte, M. (2003). Description of Comamonas aquatica comb. nov. and Comamonas kerstersii sp. nov. for two subgroups of Comamonas terrigena and emended description of Comamonas terrigena. Int. J. Syst. Evol. Microbiol. 53: 859-862 [Abstract] [Full Text]  
  • De Baere, T., Wauters, G., Kampfer, P., Labit, C., Claeys, G., Verschraegen, G., Vaneechoutte, M. (2002). Isolation of Buttiauxella gaviniae from a Spinal Cord Patient with Urinary Bladder Pathology. J. Clin. Microbiol. 40: 3867-3870 [Abstract] [Full Text]  
  • De Baere, T., Muylaert, A., Everaert, E., Wauters, G., Claeys, G., Verschraegen, G., Vaneechoutte, M. (2002). Bacteremia Due to Moraxella atlantae in a Cancer Patient. J. Clin. Microbiol. 40: 2693-2695 [Abstract] [Full Text]  
  • Wauters, G., Claeys, G., Verschraegen, G., De Baere, T., Vandecruys, E., Van Simaey, L., De Ganck, C., Vaneechoutte, M. (2001). Case of Catheter Sepsis with Ralstonia gilardii in a Child with Acute Lymphoblastic Leukemia. J. Clin. Microbiol. 39: 4583-4584 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vaneechoutte, M.
Right arrow Articles by Verschraegen, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vaneechoutte, M.
Right arrow Articles by Verschraegen, G.