Previous Article | Next Article 
Journal of Clinical Microbiology, October 2000, p. 3870-3871, Vol. 38, No. 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Isolation of Moraxella canis from an
Ulcerated Metastatic Lymph Node
Mario
Vaneechoutte,1,*
Geert
Claeys,1
Sophia
Steyaert,1
Thierry
De
Baere,1
Renaat
Peleman,2 and
Gerda
Verschraegen1
Department of Chemistry, Microbiology and
Immunology1 and Department of
Pulmonology,2 Ghent University Hospital,
Ghent, Belgium
Received 15 May 2000/Returned for modification 21 July
2000/Accepted 9 August 2000
 |
ABSTRACT |
Moraxella canis was isolated in large numbers from an
ulcerated supraclavicular lymph node of a terminal patient, who died a
few days later. Although the patient presented with septic symptoms and
with a heavy growth of gram-negative diplococci in the lymph node,
blood cultures remained negative. M. canis is an
upper-airway commensal from dogs and cats and is considered
nonpathogenic for humans, although this is the third reported human
isolate of this species.
| |
TEXT |
Case report.
A 51-year-old
patient who was a 55-pack-per-year smoker and who had a long history of
serious, chronic obstructive pulmonary disease was sent to the hospital
in October 1998 because of dyspnea. A primary bronchial carcinoma was
diagnosed. Biopsy of the left supraclavicular lymph node revealed a
moderately differentiated adenocarcinoma. Palliative radiotherapy was
started but was stopped in December 1998, and the patient was sent home
during the first week of January.
The patient was in a cachectic, immunodepressed condition, presented
with fever and chills, and had a large ulcer at the left supraclavicular lymph node. A differential diagnosis of sepsis and
tumor was made. Computed tomography of the thorax showed a large
necrotic nodus at the left supraclavicular lymph node and a tumor at
the right lower lobe in association with pleural fluid effusion and a
diffuse metastasized bronchial carcinoma. Staphylococcus aureus in small numbers and Moraxella canis in large
numbers were isolated from the ulcer wound. Blood cultures remained
negative. The patient was discharged 2 days later and died shortly
thereafter at home.
The oxidase-positive gram-negative diplococci were given a preliminary
identification as
M. canis after observation of brown
pigmentation of the Mueller-Hinton II agar (MHAII; BBL Becton
Dickinson, Cockeysville, Md.), used routinely for disk diffusion
susceptibility testing. This characteristic was present in 15
of the 16 previously described isolates of
M. canis, while absent
in
all other
Moraxella species (
2). Further
differentiation
from other
Moraxella species was possible on
the basis of a positive
DNase reaction, acetate assimilation
positivity, and a positive
gamma glutamyl aminopeptidase reaction
(
2).
The isolate (LBV436) was resistant to ampicillin and susceptible to
co-trimoxazole, doxycycline, fucidic acid, vancomycin,
rifampin,
gentamicin, and quinolones. Production of
-lactamase
has been
demonstrated in some strains of
M. canis (
2), and
this strain was also
-lactamase
positive.
M. canis, together with
Moraxella catarrhalis,
Moraxella cuniculi,
Moraxella caviae,
Moraxella ovis, and
Moraxella sp. incertae
sedis
strain NCTC 4103 belong to the coccal moraxellae, which,
in contrast to
the bacillary moraxellae, all exhibit DNase activity.
M. canis and strain NCTC 4103 differ from all other coccoid
moraxellae
by the production of gamma glutamyl aminopeptidase and the
ability
to grow on MHAII at room temperature. Moreover,
M. canis and,
to a weaker extent, strain NCTC 4103 produce a brownish
pigment
on this growth medium, which is a feature not shown by any
other
moraxellae.
To our knowledge, this is the third isolation of
M. canis
from humans. The first isolate (N7
T, CCUG
8415A
T) was from a dog bite wound in a Swedish female in
1979, for which
no further clinical data are available (
2).
Wüst et al. (
7)
described a blood culture isolate
(U33, BLU8387) obtained in 1988
from a 61-year-old alcoholic Swiss male
with bleeding esophageal
varices who was hospitalized for symptoms
suggesting pneumonia.
The cachectic immunodepressed condition of our
patient is comparable
to that of the Swiss patient (
7). All
other known isolates
of this species are commensals isolated from dog
saliva (P37,
Paris) (
2) or swabs from dog muzzles (one was
from a cat muzzle)
(
2), from which
M. canis could
be cultured only after suppression
of other commensal bacteria with a
selective medium (
4).
Sequence determination of the first 450 to 700 bp of the PCR-amplified
16S rRNA gene was carried out for isolate LBV436, for
four of the
previously collected
M. canis strains (O18, P37, U33,
and
W4), for strain NCTC 4103, for an unidentified gram-negative
diplococcus isolated from a dog bite (MOR32), and for a
Moraxella strain producing yellowish pigment on MHAII
(LBV438). The complete
sequence was determined for the
M. canis type strain N7. Amplification
was done by PCR with the
primers 5'-AGT TTG ATC CTG GCT CAG and
5'-TAC CTT GTT ACG ACT TCG TCC
CA. The reactions were performed
in a final reaction mixture of 50 µl
containing 25 µl of Master
Mix (Qiagen, Hilden, Germany), a 0.2-µM
concentration of each
primer, and 5 µl of a DNA suspension obtained
by alkaline lysis.
Alkaline lysis was done by suspending one colony in
20 µl of 0.25%
sodium dodecyl sulfate-0.05 N NaOH and heating at
95°C for 15
min, followed by a final dilution with 180 µl of
distilled water.
The amplification reactions were performed in a
GeneAmp PCR System
9600 (Applied Biosystems, Foster City, Calif.) with
the following
cycling parameters: 94°C for 5 min, followed by 3 cycles of 45
s at 94°C, 2 min at 50°C, 1 min at 72°C, and 30 cycles of 20 s
at 94°C, 1 min at 50°C, 1 min at 72°C, with a
final extension
at 72°C for 7 min. The presence of amplification
products was
checked by electrophoresis on 2% agarose gels stained
with ethidium
bromide. The amplification products were then purified
with the
Concert PCR purification kit (Gibco BRL Life Technologies,
Merelbeke,
Belgium), used according to the manufacturer's
instructions. Sequencing
was done using the ABI Big Dye cycle
sequencing reaction kit with
Ampli
Taq FS DNA polymerase
(Applied Biosystems) with the following
primers: 5' AGT TTG ATC CTG GCT
CAG (
Escherichia coli 16S rRNA
gene sequence position 8 to
27), 5'CTCCTACGGGAGGCAGCAGT (339 to
358 bp),
5'CAGCAGCCGCGGTAATAC (519 to 536),
5'AACTCAAAGGAATTGACGG
(908 to 926),
5'AGTCCCGCAACGAGCGCAAC (1093 to 1112), and
5'GCTACACACGTGCTACAATG
(1222 to 1241) (
1).
Electrophoresis was performed on an ABI
310 analyzer. Analysis of the
sequences and clustering was done
by GeneCompar, version 2.0 (Applied Maths, Kortrijk,
Belgium).
The clinical isolate reported here revealed 100% 16S rDNA sequence
identity with U33 (the clinical isolate described by Wüst
et al.
[
7]) and above 99% identity with the other four
M. canis strains sequenced and with strain NCTC 4103. Less
than 96% identity
was observed with the 16S rDNA sequences of other
Moraxella species
(
3). The dog bite isolate MOR32
was identified as
Neisseria weaveri, and the
Moraxella isolate which produced yellow pigmentation
on
MHAII (LBV438) was identified as
M. osloensis (Fig.
1).
View larger version (23K):
[in this window]
[in a new window]
|
FIG. 1.
Dendrogram based on clustering by means of the
unweighted pair groups method using arithmetic averages (open gap
penalty, 100%; unit gap penalty, 0%) of 16S rDNA sequences published
for the genus Moraxella and obtained in this study.
|
|
M. canis can also be differentiated from all other
Moraxella species by amplification of the tRNA intergenic
spacers (
6)
and determination of the tRNA intergenic-spacer
lengths by means
of capillary electrophoresis (
5).
M. canis and
M. catarrhalis had tRNA spacer fragments with
lengths of 66, 81, and 215 bp in
common, which were absent in
M. caviae,
M. cuniculi,
Moraxella lacunata,
Moraxella nonliquefaciens,
M. osloensis, and
M. ovis and could be differentiated from each other by the
presence of
a fragment of 193 bp in
M. canis tDNA PCR
fingerprints and the
presence of fragments of 167 and 179 bp in
M. catarrhalis fingerprints.
Despite the fact that
M. canis was isolated in large numbers
from the clinical site, the organism has to be considered an
opportunistic pathogen, since this strain was isolated from a
heavily
debilitated patient, as was the case for the Swiss patient
(
7). Whether our patient lived in close contact with dogs or
cats could not be
investigated.
In conclusion, gram-negative oxidase-positive diplococci
which produce brownish pigment on MHAII are most probably
M. canis,
a
Moraxella species that is a commensal of dogs
and cats and that
exceptionally can be isolated from clinical samples
in
humans.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Bacteriology & Virology, Blok A, Ghent University Hospital, De
Pintelaan 185, B9000 Ghent, Belgium. Phone: 32 9 240 36 92. Fax: 32 9 240 36 59. E-mail: Mario.Vaneechoutte{at}rug.ac.be.
| |
REFERENCES |
| 1.
|
Coenye, T.,
E. Falsen,
M. Vancanneyt,
B. Hoste,
J. R. W. Govan,
K. Kersters, and P. Vandamme.
1999.
Classification of Alcaligenes faecalis-like isolates from the environment and human clinical samples as Ralstonia gilardii sp. nov.
Int. J. Syst. Bacteriol.
49:405-413[Abstract/Free Full Text].
|
| 2.
|
Jannes, G.,
M. Vaneechoutte,
M. Lannoo,
M. Gillis,
M. Vancanneyt,
P. Vandamme,
G. Verschraegen,
H. Van Heuverswyn, and R. Rossau.
1993.
Polyphasic taxonomy leading to the proposal of Moraxella canis sp. nov. for Moraxella catarrhalis-like strains.
Int. J. Syst. Bacteriol.
43:438-449[Abstract/Free Full Text].
|
| 3.
|
Pettersson, B.,
A. Kodjo,
M. Ronaghi,
M. Uhlén, and T. Tonjum.
1998.
Phylogeny of the family Moraxellaceae by 16S rDNA sequence analysis, with special emphasis on differentiation of Moraxella species.
Int. J. Syst. Bacteriol.
48:75-89[Abstract/Free Full Text].
|
| 4.
|
Vaneechoutte, M.,
G. Verschraegen,
G. Claeys, and A.-M. Van den Abeele.
1988.
A selective medium for Branhamella catarrhalis, with acetazolamide as a specific inhibitor of Neisseria spp.
J. Clin. Microbiol.
26:2544-2548[Abstract/Free Full Text].
|
| 5.
|
Vaneechoutte, M.,
P. Boerlin,
H.-V. Tichy,
E. Bannerman,
B. Jäger, and J. Bille.
1998.
Comparison of PCR-based DNA fingerprinting techniques for the identification of Listeria species and their use for atypical Listeria isolates.
Int. J. Syst. Bacteriol.
48:127-139[Abstract/Free Full Text].
|
| 6.
|
Welsh, J., and M. McClelland.
1991.
Genomic fingerprints produced by PCR with consensus tRNA gene primers.
Nucleic Acids Res.
19:861-866[Abstract/Free Full Text].
|
| 7.
|
Wüst, J.,
G. V. Doern, and A. von Graevenitz.
1988.
Branhamella catarrhalis: fatty acid and lipopolysaccharide analysis of an atypical strain from blood culture.
Diagn. Microbiol. Infect. Dis.
10:131-134[CrossRef][Medline].
|
Journal of Clinical Microbiology, October 2000, p. 3870-3871, Vol. 38, No. 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Vaneechoutte, M., Nemec, A., Musilek, M., van der Reijden, T. J. K., van den Barselaar, M., Tjernberg, I., Calame, W., Fani, R., De Baere, T., Dijkshoorn, L.
(2009). Description of Acinetobacter venetianus ex Di Cello et al. 1997 sp. nov.. Int. J. Syst. Evol. Microbiol.
59: 1376-1381
[Abstract]
[Full Text]
-
Van Hoovels, L., Vankeerberghen, A., Boel, A., Van Vaerenbergh, K., De Beenhouwer, H.
(2006). First Case of Staphylococcus pseudintermedius Infection in a Human. J. Clin. Microbiol.
44: 4609-4612
[Abstract]
[Full Text]
-
Vaneechoutte, M., Young, D. M., Ornston, L. N., De Baere, T., Nemec, A., Van Der Reijden, T., Carr, E., Tjernberg, I., Dijkshoorn, L.
(2006). Naturally Transformable Acinetobacter sp. Strain ADP1 Belongs to the Newly Described Species Acinetobacter baylyi. Appl. Environ. Microbiol.
72: 932-936
[Abstract]
[Full Text]
-
Stakenborg, T., Vicca, J., Verhelst, R., Butaye, P., Maes, D., Naessens, A., Claeys, G., De Ganck, C., Haesebrouck, F., Vaneechoutte, M.
(2005). Evaluation of tRNA Gene PCR for Identification of Mollicutes. J. Clin. Microbiol.
43: 4558-4566
[Abstract]
[Full Text]
-
Van daele, S. G., Franckx, H., Verhelst, R., Schelstraete, P., Haerynck, F., Van Simaey, L., Claeys, G., Vaneechoutte, M., de Baets, F.
(2005). Epidemiology of Pseudomonas aeruginosa in a cystic fibrosis rehabilitation centre. Eur Respir J
25: 474-481
[Abstract]
[Full Text]
-
De Baere, T., Verhelst, R., Labit, C., Verschraegen, G., Wauters, G., Claeys, G., Vaneechoutte, M.
(2004). Bacteremic Infection with Pantoea ananatis. J. Clin. Microbiol.
42: 4393-4395
[Abstract]
[Full Text]
-
Vaneechoutte, M., Kampfer, P., De Baere, T., Falsen, E., Verschraegen, G.
(2004). Wautersia gen. nov., a novel genus accommodating the phylogenetic lineage including Ralstonia eutropha and related species, and proposal of Ralstonia [Pseudomonas] syzygii (Roberts et al. 1990) comb. nov.. Int. J. Syst. Evol. Microbiol.
54: 317-327
[Abstract]
[Full Text]
-
Wauters, G., De Baere, T., Willems, A., Falsen, E., Vaneechoutte, M.
(2003). Description of Comamonas aquatica comb. nov. and Comamonas kerstersii sp. nov. for two subgroups of Comamonas terrigena and emended description of Comamonas terrigena. Int. J. Syst. Evol. Microbiol.
53: 859-862
[Abstract]
[Full Text]
-
De Baere, T., Wauters, G., Kampfer, P., Labit, C., Claeys, G., Verschraegen, G., Vaneechoutte, M.
(2002). Isolation of Buttiauxella gaviniae from a Spinal Cord Patient with Urinary Bladder Pathology. J. Clin. Microbiol.
40: 3867-3870
[Abstract]
[Full Text]
-
De Baere, T., Muylaert, A., Everaert, E., Wauters, G., Claeys, G., Verschraegen, G., Vaneechoutte, M.
(2002). Bacteremia Due to Moraxella atlantae in a Cancer Patient. J. Clin. Microbiol.
40: 2693-2695
[Abstract]
[Full Text]
-
Wauters, G., Claeys, G., Verschraegen, G., De Baere, T., Vandecruys, E., Van Simaey, L., De Ganck, C., Vaneechoutte, M.
(2001). Case of Catheter Sepsis with Ralstonia gilardii in a Child with Acute Lymphoblastic Leukemia. J. Clin. Microbiol.
39: 4583-4584
[Abstract]
[Full Text]
Top
Abstract
Text
