Previous Article | Next Article 
Journal of Clinical Microbiology, November 2000, p. 4126-4130, Vol. 38, No. 11
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Analysis of Immunoreactivity to a
Streptococcus equi subsp. zooepidemicus M-Like
Protein To Confirm an Outbreak of Poststreptococcal
Glomerulonephritis, and Sequences of M-Like Proteins from Isolates
Obtained from Different Host Species
Mary Lou
Nicholson,1
LaReesa
Ferdinand,1
Jacquelyn S.
Sampson,1
Andrea
Benin,1
Sharon
Balter,1
Sergio Wyton Lima
Pinto,2
Scott F.
Dowell,1
Richard R.
Facklam,1
George M.
Carlone,1 and
Bernard
Beall1,*
Respiratory Diseases Branch, Centers for
Disease Control and Prevention, Atlanta, Georgia
30333,1 and Department of
Nephrology, Hospital São João de Deus, Divinópolis,
Brazil2
Received 28 June 2000/Returned for modification 16 August
2000/Accepted 5 September 2000
 |
ABSTRACT |
The etiologic agent of a large 1998 outbreak of poststreptococcal
acute glomerulonephritis (PSGN) in Nova Serrana, Brazil, was found
likely to be a specific strain of Streptococcus equi subsp.
zooepidemicus from contaminated cheese (S. Balter et al., Lancet 355:1776-1780, 2000). In the present study, we used a serologic screen for a known surface-exposed virulence factor to confirm the
epidemiologic findings. Using primers flanking a previously characterized M-like protein gene (J. F. Timoney et al., Infect. Immun. 63:1440-1445, 1995), we amplified and sequenced the M-like protein (designated Szp5058) gene and found it to be identical among
four independent acute-phase PSGN patient isolates. Convalescent-phase sera from 33 of 44 patients in the PSGN outbreak were found to contain
antibodies highly reactive to a purified Szp5058 fusion protein,
compared with 1 of 17 control sera (P < 0.0001),
suggesting that Szp5058 was expressed during infection and further
implicating this strain as the cause of the PSGN outbreak. The
predicted signal sequence and cell wall association motif of Szp5058
were highly conserved with the corresponding sequence from S. equi subsp. zooepidemicus SzpW60, while the predicted
surface-exposed portions differed markedly between these two proteins.
The 5' end of the szp5058 gene, including its variable
region, was identical to the szp gene from another strain
associated with a previous PSGN outbreak in England (M. Barham et al.,
Lancet i:945-948, 1983), and the corresponding szp
sequence found from the Lancefield group C type strain isolated from a
guinea pig. In addition, the hypervariable (HV) portion of
szp5058 was identical to a previously published HV sequence
from a horse isolate (J. A. Walker and J. F. Timoney, Am. J. Vet. Res. 59:1129-1133, 1998). Three other strains of
S. equi subsp. zooepidemicus, including another
strain previously associated with a PSGN outbreak, were each found to
contain a distinct szp gene. Two of these szp
genes had HV regions identical to szp regions from isolates
recovered from different host species.
 |
INTRODUCTION |
Streptococcus equi subsp.
zooepidemicus causes disease in several animal species and
is a frequently isolated pathogen in horses, where it exists as normal
flora (10). This organism has been known to cause a variety
of serious infections in humans, including meningitis (13),
pneumonia (20), septic arthritis (5),
endocarditis (15), and poststreptococcal acute
glomerulonephritis (PSGN) (1, 2, 4, 7). Transmission to
humans has been associated with equine contact (14, 20) or
dairy product consumption (2, 4, 7).
In 1998, a large outbreak of PSGN was linked to a specific strain of
S. equi subsp. zooepidemicus on the basis of
throat culture identification from patients (1). Patients
were more likely than matched controls to have consumed a locally
produced cheese product, and throat cultures of individuals who
prepared the cheese were also positive for this specific S. equi subsp. zooepidemicus strain. Illness was severe;
of 133 confirmed cases, 3 persons died, 7 required dialysis, and 96 were hospitalized. Because of a limited number of culture
confirmations, it was important to solidify the link between the
bacterial isolates and the outbreak using a serologic approach.
Similar to Streptococcus pyogenes, acid protein extracts
from different strains of S. equi subsp.
zooepidemicus contain a protein that elicits protective
opsonic activity and exhibits extensive antigenic variability between
strains (16, 21, 22). The gene encoding the S. equi subsp. zooepidemicus protein, designated szpW60, was cloned from one S. equi subsp.
zooepidemicus strain and sequenced (22). SzpW60,
other than similarities in membrane export and wall attachment motif,
did not share high sequence homology with other known surface proteins
of gram-positive bacteria; however, certain structural and opsonogenic
features of SzpW60 were found to be analogous to the antiphagocytic M
proteins of S. pyogenes. Unlike M proteins, which are
extremely variable within their N-terminal 40 to 50 residues, SzpW60
and other Szp proteins were found to have their most variable region
situated approximately 70 residues from the mature N terminus
(24). While the N termini of M proteins contain
type-specific and opsonic epitopes, the relationship of the Szp
hypervariable (HV) segments to Szp serologic types or opsonic antibody
elicitation has not yet been established (24). All of the
Szp types that have been associated with normal equine tonsil isolates
have been represented by equine pneumonia isolates, suggesting that in
horses, S. equi subsp. zooepidemicus is an
endogenous opportunist (23).
The aims of this study were twofold. We wished to strengthen the
circumstantial data linking the S. equi subsp.
zooepidemicus strain as the etiologic agent of the 1998 PSGN
outbreak in Brazil by demonstrating reactivity between
convalescent-phase sera and the M-like protein (Szp5058) of this
strain. We also wanted to compare the deduced sequence of Szp5058 to
the sequences of Szp proteins from other known PSGN outbreak isolates
and animal isolates of S. equi subsp.
zooepidemicus. We show that szp5058
variable-region sequences are shared between two different S. equi subsp. zooepidemicus PSGN outbreak strains and
guinea pig and horse strains. One other example of identical
szp sequences shared between isolates from different host
species is presented, indicating that at least some szp
sequences are not unique to specific host species.
 |
MATERIALS AND METHODS |
Strains.
Streptococcus equi subsp.
zooepidemicus isolates 5058, 5059, 5060, and 5064 were
recovered from the throats of acute glomerulonephritis patients in Nova
Serrana, Brazil, during the 1998 outbreak (1).
PCR and sequence analysis.
PCR and DNA sequencing were
performed as previously described (3) with PCR and
sequencing primers cf1 (gataattaggagacatcatgtctagata), cf2
(ggctagcttcagtatcggcagccttgt), cr1 (aagctttaccactggggtat), and cr2 (gcaagagctgccgcggtgaa gaatggat) derived from the
sequence with accession no. U04620 (21; bases 181 to 208, 274 to 300, 1362 to 1383, and 1276 to 1303, respectively).
Purification of His-Emz1 fusion protein.
The
szp-specific amplicon from strain 5057 was digested with
PstI, and the 1,018-bp szp5058 PstI fragment
encoding the putative surface-exposed region was cloned in the proper
orientation into the PstI site of pQE-30 using methods
described in the instructions for the Qiaexpress system (QIAgen).
Transformants were screened for the correct orientation of the coding
fragment by PvuII restriction analysis of plasmid minipreps.
The six-histidine (His6)-tagged fusion protein was overexpressed and
purified by Ni-nitrilotriacetic acid affinity chromatography as
described in the Qiaexpress system.
Human sera.
During the outbreak investigation
(1), 44 human serum specimens were obtained from adults who
met the case definition. Cases were defined as residents of the state
where the outbreak occurred (Minas Gerais) with onset of illness
between December 1997 and August 1998 and at least two of the following
symptoms of disease: (i) systolic blood pressure of >140 mm Hg or
diastolic blood pressure of >90 mm Hg for adults and >95th percentile
of the age-specific normal limit for children, (ii) edema, or (iii) hematuria or proteinuria. All of the sera used for this study were
collected 7 or more days after initial complaints of illness occurred.
Pharyngeal cultures were obtained from 6 of the 44 patients who
provided the study serum samples. Two of these six cultures were
positive for the S. equi subsp. zooepidemicus
strain that was determined to be the cause of the outbreak
(1). One of these two isolates was 5060-98, which was one of
the four isolates from patients used for this study. Control sera were
obtained from 17 randomly selected adult blood donors at a hospital in a nearby city.
SDS-PAGE and Western blotting.
Sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
immunoblotting procedures were performed with 10% polyacrylamide gels
as described previously (5). Samples containing 80 µg of
the Szp5058 fusion protein were loaded onto a single-well gel and
electrophoresed. Kaleidoscope prestained standards (Bio-Rad Laboratories) were used as molecular weight markers. After transfer, the nitrocellulose membranes with bound Szp5058 were incubated at room
temperature with Brazilian serum samples diluted 1:500 in
casein-thimerosal buffer (CTB) for 1 h (11). After
three washes (5 min each) with CTB, the membranes were exposed to goat anti-human immunoglobulin G horseradish peroxidase conjugate (Bio-Rad Laboratories) for 1 h at room temperature. The wash step with CTB
was repeated, and the membranes were developed with
3,3'-diaminobenzidine tetrahydrochloride. The development was stopped
after 5 min by rinsing with deionized water.
Statistical analysis.
Intensities of reactive bands observed
on Western blots were quantified with a fluor-chem digital imager
(Alpha Innotech, San Leandro, Calif.) to obtain an integrated density
value (IDV) for each of the 61 Brazilian serum samples. Positive
reactivity was defined as any log10 IDV greater than or
equal to the logarithmic mean of the normal controls plus 1 standard
deviation, which was 3.62. The Wilcoxon rank sum test was used to
compare distributions of the serology results from cases and controls.
Nucleotide sequence accession numbers.
The GenBank accession
numbers for the sequences obtained in this work, including the 1,151-bp
szp5058 structural gene and putative ribosome binding
sequence, as well as the ribosome binding sequence and 70 to 80% of
szp1028, szp1345, and szp1216, are
listed in Table 1. Signal sequence
predictions were made at the web site
http://www.cbs.dtu.dk /services/SignalP/ (17).
 |
RESULTS AND DISCUSSION |
Crude chromosomal templates from four independent isolates
(isolates 5058, 5059, 5060, and 5064) previously associated with the
Brazil PSGN outbreak (1) were used to amplify the
szp gene with two different primer sets (cf1 plus cr1 and
cf2 plus cr2). As expected, the four PCR products shared sequence
identity over their entire lengths (1,128-bp structural gene plus 19 bp
of upstream sequence). The full-length deduced protein, designated
Szp5058, had 86.5% overall sequence identity with the single, complete S. equi subsp. zooepidemicus M-like protein in
the GenBank database (designated SzpW60; GenBank accession no. U04620)
which was previously obtained from a horse nasal discharge isolate
(22). The 32-residue signal sequence and 124 C-terminal
residues (residues 254 to 377), including 20 repeats of PEPK upstream
of its LPSTGE wall attachment motif (9), were identical
between Szp5058 and SzpW60. Most of the variation between these two
proteins was over the first 143 mature N-terminal residues, with only
69% sequence identity within this region. As with SzpW60, Szp5058
appears to be alpha helical over most of its N-terminal two-thirds and
lacks the region A, B, and C repeat regions characteristic of M
proteins (8).
We subsequently analyzed 5' partial sequences predicted to encompass
about 70 to 80% of the szp structural genes from five Centers for Disease Control and Prevention culture collection S. equi subsp. zooepidemicus strains from diverse sources
(Table 1). It was interesting that the szp gene from strain
SS1215, which originated from a PSGN outbreak in England during 1982 (2), shared sequence identity with szp5058 over
its entire overlap (Table 1). We also found that the szp
gene from SS189, the Lancefield type C reference strain of guinea pig
origin isolated prior to 1933 (strain K64 in reference
10), shared identity over this region with
szp5058. According to previous data (24), still another S. equi subsp. zooepidemicus strain of
horse origin shared sequence identity over at least Szp5058 residues
107 to 167 (Fig. 1; Table 1; see GenBank
accession no. AF021915). Strains SS1028, SS1345, and SS1216 were each
found to have distinct szp gene sequences (Fig. 1; Table 1).
It is notable that residues 107 to 167 of Szp5058 represent the most
variable region among these four proteins (Fig. 1), which is in
agreement with previous findings (24). In this previous
work, five subgroups based upon similarities in this 60-residue HV
region were found among 15 different S. equi subsp.
zooepidemicus strains and were designated HV1 to 5. As Table
1 indicates, four distinct szp sequences were found among
the six strains analyzed in this study, and these sequences were found
to belong to one of three different HV types based upon the 60-residue
HV region (Table 1). At least 15 antigenic types of S. equi
subsp. zooepidemicus acid extracts are known to exist
(16); however, the relationship of the HV region to the Szp
antigenic type is unknown since certain distinct serotypes have been
shown to share sequence identity in the HV region (24). The
relationship of the HV region to protective opsonic epitopes is also
unknown, since all known S. equi subsp.
zooepidemicus antigenic types are opsonized by antisera to
the SzpW60 protein (24).

View larger version (91K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence comparison of the Szp5058 N terminus with
corresponding regions of Szp proteins from three S. equi
subsp. zooepidemicus strains. The inverted arrow indicates
the predicted signal sequence cleavage site. Shaded segments represent
shared identity among at least three of the four proteins. The entire
deduced Szp5058 sequence shown was identical to the deduced Szp
sequence from strains SS1215 (England PSGN outbreak strain) and SS189
(guinea pig isolate) (Table 1). The bold segment of Szp5058 (Brazil
PSGN outbreak strain) indicates a region identical to that deduced from
a partial szp gene sequence obtained from a horse pleuritic
fluid isolate (GenBank accession no. AF021907). The bold segment of
Szp1345 (bovine mastitis isolate) indicates a region identical to that
deduced from a partial szp gene from a horse nasal aspirate
(GenBank accession no. AF021907).
|
|
These results show that szp genes may show significant
variation among different human PSGN outbreak strains. Although
szp5058 was found to be shared between the Brazil PSGN
outbreak strain and the England PSGN outbreak strain (Table 1 and
references 4 and 5), the sequence
of szp5058 varied considerably from that of
szp1028 from the Romania PSGN outbreak strain (Table 1 and
reference 11). Additionally, these three PSGN
outbreak strains appeared to be genomically unrelated since they had
unrelated SmaI-digested chromosomal DNA pulsed-field gel
electrophoresis profiles (1). szp5058 was also
found to share sequence identity with the szp gene from a
guinea pig isolate recovered prior to 1933 (Table 1). Again,
pulsed-field gel electrophoresis results revealed no relatedness
between these strains (1). To examine the genetic
relatedness of these strains in more detail, it may prove useful to
compare them by multilocus sequence typing. It is possible that allelic
identities would show closer relatedness between the outbreak strain
and other szp5058-containing strains compared to those
containing szp alleles other than szp5058.
From other sequencing results, it is shown here that besides isolates
from two human sources and one guinea pig source, an szp5058-specific sequence was also found in a horse nasal
aspirate isolate (GenBank accession no. AF021915). An
szp1345-specific sequence from both bovine and equine
sources was also found (Table 1). This work shows conclusively that
specific szp genes are shared among isolates recovered from
different mammalian hosts and clinical specimens.
Sequencing of the szp5058 structural gene revealed two
fortuitously situated PstI sites (one PstI site
overlapping the sequence encoding the signal peptide cleavage site and
the other situated about 60 bp downstream of the region encoding the
wall attachment motif LPSTGE [see GenBank accession no. AF150748 and
U04620 for the exact locations of these conserved PstI sites
in these two szp genes]) that expedited the construction of
a histidine-tagged fusion product. The 1,018-bp PstI
fragment was cloned in the proper orientation into the His6 fusion
vector for purification of the resultant fusion protein. The predicted
molecular mass of the His6-Szp1 fusion protein was approximately 38 kDa. SDS-10% PAGE analysis revealed that the His6-Szp5058 fusion
protein was approximately 54 kDa, which is consistent with a previous
report that these proteins migrate on SDS-PAGE at a much slower
mobility than that predicted by their actual molecular weight
(22).
To evaluate the immune response and to determine if patients clinically
diagnosed with PSGN respond serologically to the Szp5058 fusion
protein, 61 serum samples (representing 44 cases and 17 case-matched
controls) were analyzed by Western blotting. Representative examples of
positive and negative seroreactivity to the Szp5058 fusion protein are
shown in Fig. 2. The major reactive band
migrated at a calculated molecular mass of ~54 kDa. An additional
positive reactive band observed at ~52 kDa was possibly a degradation
product of the 54-kDa fusion protein. Logarithmic IDVs were normally
distributed in both the case and control groups; the mean logarithmic
IDV of case patients was significantly higher than that of control persons (P < 0.001). Thirty-three of 44 case persons
and 1 of 17 control persons were seropositive for the Szp5058 fusion
protein (Fig. 3). All six of the case
patients who had pharyngeal cultures were seropositive (data not
shown). Compared to the clinically and epidemiologically defined
criteria (1), the test specificity was 94%, the sensitivity
was 71%, and the positive predictive value was 97%.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 2.
Immunoblot analysis of patient and control sera with
purified His6-Szp5058 fusion protein. Lanes: 1 to 4, controls; 5 to 8, nephritis patient sera; 9, nonreactive group C rabbit polyclonal
antibody to S. equisimilis control; 10, CTB control strip
with no added antibody. The blot shows an upper band of 54 kDa and a
lower band of 52 kDa.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3.
Logarithmic IDVs reflecting immunoblot reactivity of
nephritis patient and control sera against purified His6-Szp5058 fusion
protein. The solid lines represent the mean and the standard deviation
for the control and patient groups.
|
|
In summary, the data indicate that antibodies to the Szp5058 protein
were generated in the human host as a result of infection with the
Brazil PSGN outbreak S. equi subsp. zooepidemicus
strain and provide additional important evidence that this strain was the etiologic agent. A standardized M-like-protein-based approach (e.g., enzyme-linked immunosorbent assay) of screening
convalescent-phase sera could potentially be used to determine likely
etiologic causes of PSGN. It is possible that representative
streptococcal M or M-like proteins from group A and G and other group C
species could also be used in this manner, although differentiation of
protein type specificity (e.g., Szp5058 versus Szp1028 versus Szp1345 versus Szp1216) would probably require the use of specific HV segment
peptides rather than full-length proteins which share extensive
sequence identity.
The pathogenic mechanism of PSGN is still unknown. PSGN in mice
following infection by group A streptococci requires streptokinase (18, 19); however, other streptococcal factors may be
additionally required. It is possible that Szp proteins have an
antiphagocytic role analogous to that of group A streptococcal M
proteins that is essential in establishing human infection. Both M and
Szp proteins stimulate opsonic antibodies, are protective in animal
models, and share key structural similarities (22-24). The
apparent strong antibody response evoked by Szp5058 during human
infection (Fig. 2 and 3) and the variability of the N termini of Szp
proteins are features that are consistent with surface virulence
proteins under immunologic selection.
 |
ACKNOWLEDGMENTS |
M.L.N. was supported by an American Society for
Microbiology-National Centers for Infectious Diseases postdoctoral
fellowship. L.F. was supported by an Emerging Infectious Diseases
Advanced Laboratory Training Fellowship sponsored through the Centers
for Disease Control and Prevention and the Association of Public Health Laboratories.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centers for
Disease Control and Prevention, Mailstop C02, 1600 Clifton Rd., NE,
Atlanta, GA 30333. Phone: (404) 639-1237. Fax: (404) 639-3123. E-mail: BBeall{at}cdc.gov.
 |
REFERENCES |
| 1.
|
Balter, S.,
A. Benin,
S. W. L. Pinto,
L. M. Teixeira,
G. G. Alvim,
E. Luna,
D. Jackson,
L. LaClaire,
J. Elliott,
R. Facklam, and A. Schuchat.
2000.
Epidemic nephritis in Nova Serrana, Brazil, 1998.
Lancet
355:1776-1780[CrossRef][Medline].
|
| 2.
|
Barham, M.,
T. J. Thorton, and K. Lange.
1983.
Nephritis caused by Streptococcus zooepidemicus (Lancefield group C).
Lancet
i:945-948.
|
| 3.
|
Beall, B.,
R. Facklam, and T. Thompson.
1996.
Sequencing emm-specific PCR products for routine and accurate typing of group A streptococci.
J. Clin. Microbiol.
34:953-958[Abstract].
|
| 4.
|
Centers for Disease Control.
1983.
Group C streptococcal infections associated with eating homemade cheese, New Mexico.
Morbid. Mortal. Weekly Rep.
32:510-516[Medline].
|
| 5.
|
Collazos, J.,
M. J. Echevarria,
R. Ayarza, and J. Miguel.
1992.
Streptococcus zooepidemicus septic arthritis: case report and review of group C streptococcal arthritis.
Clin. Infect. Dis.
15:744-746[Medline].
|
| 6.
|
Crook, J.,
J. A. Tharpe,
S. E. Johnson,
D. B. Williams,
A. R. Stinson,
R. R. Facklam,
E. W. Ades,
G. M. Carlone, and J. S. Sampson.
1998.
Immunoreactivity of five monoclonal antibodies against the 37kDa common cell wall protein of Streptococcus pneumoniae.
Clin. Diag. Lab. Immunol.
5:205-210[Abstract/Free Full Text].
|
| 7.
|
Duca, E.,
G. Teodorovici,
C. Radu, et al.
1969.
A new nephritogenic streptococcus.
J. Hyg.
67:691-698.
|
| 8.
|
Fischetti, V. A.
1989.
Streptococcal M protein: molecular design and biological behavior.
Clin. Microbiol. Rev.
2:285-314[Abstract/Free Full Text].
|
| 9.
|
Fischetti, V. A.,
V. Pancholi, and O. Schneewind.
1990.
Conservation of a hexapeptide sequence in the anchor region of surface proteins from gram-positive cocci.
Mol Microbiol.
4:1603-1605[Medline].
|
| 10.
|
Kasai, K.,
R. Nobata, and E. Rya.
1944.
On the incidence of Streptococcus hemolyticus in the normal tonsils of horses and the typing of equine tonsillar streptococci.
Jpn. J. Vet. Sci.
6:116-123.
|
| 11.
|
Kenna, J. G.,
G. N. Major, and R. S. Williams.
1985.
Methods for reducing non-specific antibody binding in enzyme-linked immunosorbent assays.
J. Immunol. Methods
85:409-419[CrossRef][Medline].
|
| 12.
|
Lancefield, R. C.
1933.
A serological differentiation of human and other groups of hemolytic streptococci.
J. Exp. Med.
57:571-595[Abstract].
|
| 13.
|
Latorre, M.,
M. Alvarez,
J. M. Fernandez,
P. Berdonces,
P. Llanos, and R. Cisterna.
1993.
A case of meningitis due to Streptococcus zooepidemicus.
Clin. Infect. Dis.
17:932-933[Medline].
|
| 14.
|
Low, D. E.,
M. R. Young, and G. K. M. Harding.
1980.
Group C streptococcal meningitis in an adult: probably acquisition from a horse.
Arch. Intern. Med.
140:977-978[Abstract/Free Full Text].
|
| 15.
|
Martinez-Luengas, F.,
G. M. Inclan,
A. Pastor, et al.
1982.
Endocarditis due to Streptococcus zooepidemicus.
Can. Med. Assoc. J.
127:13[Medline].
|
| 16.
|
Moore, B. O., and J. T. Bryans.
1969.
Antigenic classification of group C animal streptococci.
J. Am. Vet. Med. Assoc.
155:416-420[Medline].
|
| 17.
|
Nielsen, H.,
J. Engelbrecht,
S. Brunak, and G. von Heijne.
1997.
Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites.
Protein Eng.
10:1-6[Abstract/Free Full Text].
|
| 18.
|
Nordstrand, A.,
M. Norgren,
J. J. Ferretti, and S. E. Holm.
1998.
Streptokinase as a mediator of acute poststreptococcal glomerulonephritis in an experimental mouse model.
Infect. Immun.
66:315-321[Abstract/Free Full Text].
|
| 19.
|
Nordstrand, A.,
M. Norgren, and S. E. Holm.
1999.
Pathogenic mechanism of acute post-streptococcal glomerulonephritis.
Scand. J. Infect. Dis.
31:523-537[CrossRef][Medline].
|
| 20.
|
Rose, H. D.,
J. R. Allen, and G. Witte.
1980.
Streptococcus zooepidemicus (group C) pneumonia in a human.
J. Clin. Microbiol.
11:76-78[Abstract/Free Full Text].
|
| 21.
|
Timoney, J. F., and M. Mukhtar.
1992.
Variability in the M proteins of equine strains of Streptococcus equi subsp. zooepidemicus, p. 15-20.
In
W. Plowright, P. D. Rossdale, and J. F. Wade (ed.), Equine infectious diseases VI. R&W Publications, Newmarket, England.
|
| 22.
|
Timoney, J. F.,
J. Walker,
M. Zhou, and J. Ding.
1995.
Cloning and sequence analysis of a protective M-like gene from Streptococcus equi subsp. zooepidemicus.
Infect. Immun.
63:1440-1445[Abstract].
|
| 23.
|
Timoney, J. F.,
T. Anzai, and M. Blair.
1997.
Clonal invasion of the equine respiratory tract by Streptococcus zooepidemicus.
Adv. Exp. Med. Biol.
418:611-613[Medline].
|
| 24.
|
Walker, J. A., and J. F. Timoney.
1998.
Molecular basis of variation in protective Szp proteins of Streptococcus zooepidemicus.
Am. J. Vet. Res.
59:1129-1133[Medline].
|
Journal of Clinical Microbiology, November 2000, p. 4126-4130, Vol. 38, No. 11
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Rodriguez-Iturbe, B., Musser, J. M.
(2008). The Current State of Poststreptococcal Glomerulonephritis. J. Am. Soc. Nephrol.
19: 1855-1864
[Abstract]
[Full Text]
-
Sesso, R., Pinto, S. W. L.
(2005). Five-year follow-up of patients with epidemic glomerulonephritis due to Streptococcus zooepidemicus. Nephrol Dial Transplant
20: 1808-1812
[Abstract]
[Full Text]
-
Bessen, D. E., Manoharan, A., Luo, F., Wertz, J. E., Robinson, D. A.
(2005). Evolution of Transcription Regulatory Genes Is Linked to Niche Specialization in the Bacterial Pathogen Streptococcus pyogenes. J. Bacteriol.
187: 4163-4172
[Abstract]
[Full Text]
-
Facklam, R.
(2002). What Happened to the Streptococci: Overview of Taxonomic and Nomenclature Changes. Clin. Microbiol. Rev.
15: 613-630
[Abstract]
[Full Text]