Previous Article | Next Article 
Journal of Clinical Microbiology, November 2000, p. 4201-4207, Vol. 38, No. 11
Department of Pathology, Bacteriology and
Poultry Diseases, Faculty of Veterinary Medicine, University of
Ghent, B-9820 Merelbeke,1 Department
of Clinical Chemistry, Microbiology and Immunology, Faculty of
Medicine, University of Ghent,2 and
Laboratorium voor Microbiologie, Faculteit Wetenschappen,
Universiteit Gent,3 B-9000 Ghent, Belgium
Received 13 June 2000/Returned for modification 25 July
2000/Accepted 31 August 2000
tRNA intergenic spacer PCR (tDNA-PCR) was evaluated for its
usefulness in the differentiation of enterococcal species of human and
animal origin. This technique was carried out for 124 strains belonging
to 17 enterococcal species and generated DNA fragments, which were
separated by capillary electrophoresis. tDNA-PCR enabled us to
discriminate for all species tested. Enterococcus faecium showed minor but reproducible differences with Enterococcus
durans, while Enterococcus hirae was easily
distinguishable. Enterococcus avium, Enterococcus
malodoratus, and Enterococcus raffinosus generated highly similar though distinctive patterns.
Enterococci are regarded as one of
the leading causes of nosocomial infections (11), and cases
of endocarditis, bacteremia, urinary tract infection, and neonatal
sepsis have frequently been reported. Several authors have highlighted
the need for rapid and accurate identification of enterococcal strains
(3, 6, 7, 21). Although Enterococcus faecalis and
Enterococcus faecium are responsible for about 95% of all
nosocomial infections caused by enterococci, most of the described
species have been encountered in human infections (20).
The increasing occurrence of antibiotic resistance, for instance to
In the study of outbreaks it is helpful to know that the isolates
involved are all the same species of enterococci (1, 5, 23).
Fingerprinting techniques acting at infraspecies level, such as
restriction analysis in combination with pulsed-field gel
electrophoresis, can then be applied (3).
Sequencing of conserved regions, such as the 16S rRNA gene
(16) and the sodA gene encoding superoxide
dismutase (18), is useful in the identification of
enterococci. Several other molecular identification methods have
recently been evaluated (3, 6, 14, 16, 19, 24, 29). PCR
assays using genes involved in peptidoglycan synthesis
(D-alanine:D-alanine ligase genes) and in
vancomycin resistance (vanC-1, vanC-2/3) have
also been used for identification, classification, or detection of enterococci (7, 9, 17).
tRNA intergenic spacer PCR (tDNA-PCR) (26) has been applied
for the species differentiation of streptococci (27),
Acinetobacter spp. (8, 28), staphylococci
(12), and Listeria spp. (25) and
consists of amplification of the tDNAs by use of consensus primers,
which are complementary to the highly conserved edges of the flanking
tRNA genes and are directed outwardly. The resulting PCR fragments can
be separated by capillary electrophoresis. tDNA-PCR makes use of
primers complementary to regions conserved throughout the bacteria and
should therefore be applicable to a wide range of genera.
Bacterial strains.
Seventy-one well-characterized
enterococcal strains from different origins, identified by whole-cell
protein analysis using sodium dodecyl sulfate-polyacrylamide gel
electrophoresis, were obtained from the Belgian Coordinated Collection
of Microorganisms culture collection (University of Ghent, Ghent,
Belgium). This series was extended to include 19 strains isolated from
different animal species, which were identified with a biochemical test scheme as described by Devriese et al. (4, 5). E. faecium, E. faecalis, E. gallinarum, and
E. casseliflavus strains were confirmed by a specific
multiplex PCR using the van and ddl primers as
described by Dutka-Malen et al. (7). All reference strains are listed in Table 1.
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Application of tRNA Intergenic Spacer PCR for
Identification of Enterococcus Species
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-lactam antibiotics and more recently to glycopeptides, has caused
great concern (11). Some species, such as E. faecium, are likelier to be more resistant to antimicrobial agents
than are others, and Enterococcus gallinarum,
Enterococcus casseliflavus, and Enterococcus
flavescens show intrinsic low-level resistance to glycopeptide
antibiotics. Rapid species identification therefore can be of
substantial help in the choice of antibiotic therapy (15).
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
TABLE 1.
Enterococcal strains used in this study
|
DNA preparation.
Bacterial cells were grown overnight on
Columbia agar (Gibco Technologies, Paisley, Scotland) with 5% sheep
blood for 24 h at 37°C in a 5% CO2-enriched
environment and were checked for purity. A 1-µl loopful of cells was
suspended in 20 µl of lysis buffer (0.25% sodium dodecyl sulfate,
0.05 N NaOH) and heated at 95°C for 5 min. The cell lysate was spun
down by brief centrifugation at 16,000 × g and diluted
by adding 180 µl of distilled water. The cell debris was removed by
centrifugation at 16,000 × g for 5 min. Supernatants
were directly used as the template for PCR or were frozen at 
20°C
until further use.
tDNA-PCR. PCR was carried out using the outwardly directed tRNA gene consensus primers T5A (5' AGTCCGGTGCTCTAACCAACTGAG) and T3B (5' AGGTCGCGGGTTCGAATCC), as described by Welsh and McClelland (26). Reactions were carried out in a 10-µl volume containing 9.1 µl of High Fidelity Mix 1.1× (Gibco Life Technologies). Primers were added at a final concentration of 0.1 µM. Primer T3B consisted of a mixture of 1/5 fluorescent TET-labeled oligonucleotides and 4/5 nonlabeled oligonucleotides (Perkin-Elmer Applied Biosystems, Foster City, Calif.). A volume of 0.7 µl of sample DNA was added (the template was diluted 15 times). After 2 min at 94°C, reaction mixtures were cycled 30 times in a Perkin-Elmer Cetus 9600 thermocycler under the following conditions: 30 s at 94°C, 1 min at 50°C, and 1 min at 72°C. The final extension was 30 min at 72°C. Reaction vials were then cooled to 10°C and kept on ice until used in electrophoresis.
Capillary electrophoresis. Twelve microliters of deionized formamide was mixed with 0.5 µl of an internal size standard mixture, containing 0.3 µl of the GS-400 High Density size standard and 0.2 µl of the GS-500 size standard, which both have ROX-labeled fragments in the range of 50 to 500 bp (Perkin-Elmer Applied Biosystems). One microliter of tDNA-PCR product was added. The mixtures were denatured by heating at 95°C for 3 min and placed directly on ice for at least 15 min.
Capillary electrophoresis was carried out using an ABI-Prism 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems) at 60°C, a constant voltage of 1.5 kV, and a more or less constant current of approximately 10 mA. Capillaries with a length of 47 cm and a diameter of 50 µm were filled with Performance Optimized Polymer 4. Electropherograms were normalized using Genescan Analysis software, version 2.1 (Perkin-Elmer Applied Biosystems). The fragment lengths were derived from the peak positions after interpolation with the peak positions of the size standard fragments.Data analysis. Electropherograms were interpreted visually and with a software program developed at our laboratory (available upon request from the authors).
The software compares samples which are derived from the ABI310 Genescan Analysis program as molecular weight tables. A library, containing one entry per species, was constructed manually as a text file (see Table 3 for an example). Each entry is a list of numerical values which represent those fragment lengths (i.e., peaks) differentiating the species from each other, as established by visual interpretation of superimposed fingerprints obtained with the Genescan software. A positive value indicates that a peak is present in the fingerprint of a particular species, while a negative value penalizes the presence of a peak with this value. After elimination of peaks lower than 50% of the average height of all peaks, the fingerprint of an unknown strain was compared with all entries in the library. The number of fragments in common between the unknown fingerprint and the species entry, divided by the total number of fragments of the species entry in the library, was taken as a measure of similarity. The library does not contain irreproducible peaks or peaks considered irrelevant after visual comparison, which therefore are not taken into consideration by the program when comparing unknown fingerprints with entries in the library. The program enables one to enlarge the peak position tolerance, which corrects for small base pair shifts.
|
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
tDNA-PCR. Capillary electrophoresis of tDNA-PCR amplification products of enterococcal strains generated fingerprint patterns with three to five large, reproducible peaks and several smaller, irreproducible ones. The reproducibility of tDNA-PCR was evaluated by carrying it out for strains LMG 11423 (E. faecium), LMG 13129 (E. gallinarum), and LMG 13595 (E. faecalis) four times, each time using different PCR mixtures, thermal cycling runs, and electrophoresis runs. For each strain, one of these four tDNA-PCR products was run three times in capillary electrophoresis. Similarity was calculated with the in-house software and a background noise level of 50%. Clustering was done using the UPGMA algorithm. The minimal similarity level for the six tDNA-PCR fingerprints obtained for each strain named above was 88.6, 89.3, and 90%, respectively. For all six samples, the standard deviation of the peaks, which are used in the library of the in-house software, ranged from 0.045 bp (for a fragment length of 266.5 bp) to 0.364 bp (for a fragment length of 110.8 bp). Repeated electrophoresis runs of the same PCR product gave a minimum standard deviation of 0.007 bp (for a fragment length of 266.5 bp) and a maximum of 0.418 bp (for a fragment length of 110.8 bp). Repeats of the entire PCR assay (different PCR mixtures, PCR runs, and electrophoresis runs) gave a minimum standard deviation of 0.035 bp (for a fragment length of 269.3 bp) and a maximum of 0.371 bp (for a fragment length of 65.8 bp). The highest reproducibility and the most reliable identifications were obtained by not taking into account those peaks lower than 50% of the average peak height within the range of 60 to 400 bp.
Visual interpretation showed that tDNA-PCR fingerprints of strains belonging to the same species were similar, while strains belonging to different species exhibited different patterns, except for those belonging to the species E. casseliflavus and E. flavescens (Fig. 1). Some species, for instance E. faecium and Enterococcus durans, could be differentiated by the 1-bp length difference of a single tDNA spacer fragment. Enterococcus avium and Enterococcus malodoratus differed in the lengths of two fragments: E. avium strains showed peaks at 65.8, 92.9, and 253.8 bp, whereas the patterns of isolates belonging to E. malodoratus were composed of peaks of 65.8, 91.6, and 251.5 bp.
|
|
Identification of unknown strains with tDNA-PCR. Thirty-four strains isolated from humans and animals were identified in a polyphasic approach using biochemical tests (4, 5) and van-ddl PCR (7) to verify identification results from tDNA-PCR. The results are summarized in Table 2. tDNA fingerprints were analyzed with the in-house software. All 34 strains were identified correctly, regardless of whether peaks lower than 50% of the average peak height were eliminated.
The fingerprints of the enterococcal species were compared with fingerprints obtained from about 400 species belonging to over 40 different genera. All enterococcal strains could be correctly identified.| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
For the identification of the most important enterococci, a simple, conventional biochemical test scheme exists (10) and a more complex, phylogenetically based differential identification scheme has been described (4). However, the results of these tests are sometimes unreliable or ambiguous, and some species are too closely related to show biochemical differences. This is especially the case for Enterococcus hirae and E. durans, E. gallinarum and E. casseliflavus, and Enterococcus cecorum and Enterococcus columbae (4). In this study, we evaluated a universally applicable genotypic method for the identification of enterococci.
tDNA-PCR enabled us to differentiate between all species tested, except E. casseliflavus and E. flavescens. However, these species are most probably synonymous, as is also apparent from several other studies (3, 7, 19, 22). Closely related organisms showed peak shifts of no more than one or a few base pairs. Therefore, the high resolution of capillary electrophoresis was needed to separate fragments differing by 1 bp in length.
Values for similarity between fingerprints of the same strain obtained in different PCR and electrophoresis runs were very high, around 90%. In the reproducibility test, standard deviations of the peak positions in base pairs were not higher than 0.364 bp, which indicates that the peak positions in the fingerprints are highly reproducible.
To be able to compare large numbers of unidentified strains to a
database of well-characterized strains, a suitable software package was
necessary. When comparing complete fingerprints, as is done when using
the Dice coefficient, calculation of the similarity between visually
highly identical fingerprints can still give low values (as a
consequence of small peak shifts and variable presence of minor peaks).
Software which enabled a different approach was developed. A library in
which only reproducible peaks were included was manually constructed.
Peaks in new fingerprints were regarded to be identical to a peak of a
reference pattern when their positions lay within a range of 0.7 bp
to +0.7 bp of the reference peak. This is twice the maximum standard
deviation obtained in the reproducibility tests. Because the peak
position of each fragment is Gauss distributed, 95% of the
electrophoretic profiles of the same sample should have a peak within
this range. The use of a manually constructed library also prevents
nonreproducible peaks from influencing the calculation of similarity
values, which in turn leads to a higher discriminatory power.
Analysis of the molecular weight tables with the in-house software permitted discrimination of the highly similar tDNA patterns of E. faecium and E. durans strains. Blind testing of enterococcal strains which were previously identified with biochemical tests or multiplex PCR showed that this software enabled us to process tDNA-PCR fingerprints originating from an ABI Prism 310 Genetic Analyzer. One of the most important advantages of tDNA-PCR is the use of universal primers. In theory, this technique can be used for species identification for a wide range of genera. It requires little time and manual labor. tDNA-PCR takes about 3 h; the GeneAmp 9600 PCR cycler permits testing of 96 strains at once. Capillary electrophoresis requires half an hour per run; one run can include up to three samples if primers are labeled with different fluorescent dyes. Its high reproducibility and satisfactory discriminatory power make it possible to develop an identification tool which can be used by different laboratories. Normalization of the fingerprints is done automatically by the Genescan Analysis program, and quality control of the different steps in the protocol takes between 2 and 10 min for approximately 50 strains. Using our software, a list of identifications for up to 50 strains at once is available within 5 min of exportation in table format of the normalized fingerprints as obtained on ABI310.
Taken together, the whole procedure as described above, starting from a pure culture to a final identification, can be completed in 24 h for 45 strains, requiring only 4 to 5 h hands-on time. The cost per strain, comprising DNA preparation, tDNA-PCR, and capillary electrophoresis reagents (capillary, buffer, size marker, POP4 gel, and laser wear, excluding PCR and electrophoresis equipment), was calculated to add up to $2.50 (U.S.) (labor not included). tDNA-PCR fingerprints can be obtained within 8 h after colony picking for the first five electrophoresis samples, which can contain PCR products of up to three strains.
From these results, we conclude that tDNA-PCR is very suitable for rapid, discriminatory, and reliable identification of all currently described enterococcal species and can be extended to include newly described ones.
In addition to the high discriminatory power of tDNA-PCR for other groups, like Acinetobacter (8, 28), Listeria (25), staphylococci (12), and streptococci (2, 13), one can start to consider the applicability of this technique for the species identification of cultured organisms in the average laboratory.
| |
ACKNOWLEDGMENTS |
|---|
M.V. is indebted to FWO Flanders for an appointment as research associate.
We are grateful to A. Vandekerckhove, L. Van Simaey, and F. Grillaert for excellent technical assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Pathology, Bacteriology and Poultry Diseases, Faculty of Veterinary Medicine, University of Ghent, Salisburylaan 133, B-9820 Merelbeke, Belgium. Phone: 32 9 264 74 34. Fax: 32 9 264 74 94. E-mail: Margo.Baele{at}rug.ac.be.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Alonso-Echanove, J.,
B. Robles, and W. R. Jarvis.
1999.
Proficiency of clinical laboratories in Spain in detecting vancomycin-resistant Enterococcus spp.
J. Clin. Microbiol.
37:2148-2152 |
| 2. |
Degheldre, Y.,
P. Vandamme,
H. Goossens, and M. Struelens.
1999.
Identification of clinically relevant viridans streptococci by analysis of transfer DNA intergenic spacer length polymorphism.
Int. J. Syst. Bacteriol.
49:1591-1598 |
| 3. |
Descheemaeker, P.,
C. Lammens,
B. Pot,
P. Vandamme, and H. Goossens.
1997.
Evaluation of arbitrarily primed PCR analysis and pulsed-field gel electrophoresis of large genomic DNA fragments for identification of enterococci important in human medicine.
Int. J. Syst. Bacteriol.
47:555-561 |
| 4. | Devriese, L. A., B. Pot, and M. D. Collins. 1993. Phenotypic identification of the genus Enterococcus and differentiation of phylogenetically distinct enterococcal species and species groups. J. Appl. Bacteriol. 75:399-408[Medline]. |
| 5. |
Devriese, L. A.,
B. Pot,
K. Kersters,
S. Lauwers, and F. Haesebrouck.
1996.
Acidification of methyl- -D-glucopyranoside: a useful test to differentiate Enterococcus casseliflavus and Enterococcus gallinarum from Enterococcus faecium species group and from Enterococcus faecalis.
J. Clin. Microbiol.
34:2607-2608[Abstract].
|
| 6. | Donabedian, S., J. W. Chow, D. M. Shlaes, M. Green, and M. J. Zervos. 1995. DNA hybridization and contour-clamped homogeneous electric field electrophoresis for identification of enterococci to the species level. J. Clin. Microbiol. 33:141-145[Abstract]. |
| 7. | Dutka-Malen, S., S. Evers, and P. Courvalin. 1995. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant enterococci by PCR. J. Clin. Microbiol. 33:24-27[Abstract]. |
| 8. | Ehrenstein, B., A. T. Bernards, L. Dijkshoorn, P. Gerner-Smidt, K. J. Towner, P. J. M. Bouvet, F. D. Daschner, and H. Grundmann. 1996. Acinetobacter species identification by using tRNA spacer fingerprinting. J. Clin. Microbiol. 34:2414-2420[Abstract]. |
| 9. | Evers, S., B. Casadewall, M. Charles, S. Dutka-Malen, M. Galimand, and P. Courvalin. 1996. Evolution of structure and substrate specificity in D-alanine:D-alanine ligases and related enzymes. J. Mol. Evol. 42:706-712[CrossRef][Medline]. |
| 10. |
Facklam, R., and M. D. Collins.
1989.
Identification of Enterococcus species isolated from human infections by a conventional test scheme.
J. Clin. Microbiol.
27:731-734 |
| 11. | Huycke, M. M., D. F. Sahm, and M. S. Gilmore. 1998. Multiple-drug resistant enterococci: the nature of the problem and an agenda for the future. Emerg. Infect. Dis. 4:239-249[Medline]. |
| 12. | Maes, N., Y. De Gheldre, R. De Ryck, M. Vaneechoutte, H. Meugnier, J. Etienne, and M. J. Struelens. 1997. Rapid and accurate identification of Staphylococcus species by tRNA intergenic spacer length polymorphism analysis. J. Clin. Microbiol. 35:2477-2481[Abstract]. (Erratum, 36:1468, 1998.) |
| 13. |
McClelland, M., and J. Welsh.
1992.
Length polymorphisms in tRNA intergenic spacers detected by using the polymerase chain reaction can distinguish streptococcal strains and species.
J. Clin. Microbiol.
30:1499-1504 |
| 14. |
Monstein, H. J.,
M. Quednau,
A. Samuelsson,
S. Ahrne,
B. Isaksson, and J. Jonasson.
1998.
Division of the genus Enterococcus into species groups using PCR-based molecular typing methods.
Microbiology
144:1171-1179 |
| 15. |
Murray, B. E.
1990.
The life and times of the Enterococcus.
Clin. Microbiol. Rev.
3:46-65 |
| 16. |
Patel, R.,
K. E. Piper,
M. S. Rouse,
J. M. Steckelberg,
J. R. Uhl,
P. Kohner,
M. K. Hopkins,
F. R. Cockerill, and B. C. Kline.
1998.
Determination of 16S rRNA sequences of enterococci and application to species identification of nonmotile Enterococcus gallinarum isolates.
J. Clin. Microbiol.
36:3399-3407 |
| 17. | Patel, R., J. R. Uhl, P. Kohner, M. K. Hopkins, and F. R. Cockerill, III. 1997. Multiplex PCR detection of vanA, vanB, vanC-1, and vanC-2/3 genes in enterococci. J. Clin. Microbiol. 35:703-707[Abstract]. |
| 18. |
Poyart, C.,
G. Quesnes, and P. Trieu-Cuot.
2000.
Sequencing the gene encoding manganese-dependent superoxide dismutase for rapid species identification of enterococci.
J. Clin. Microbiol.
38:415-418 |
| 19. | Quednau, M., S. Ahrne, A. C. Petersson, and G. Molin. 1998. Identification of clinically important species of Enterococcus within 1 day with randomly amplified polymorphic DNA (RAPD). Curr. Microbiol. 36:332-336[CrossRef][Medline]. |
| 20. |
Ruoff, K. L.,
L. de la Maza,
M. J. Murtagh,
J. D. Spargo, and M. J. Ferraro.
1990.
Species identities of enterococci isolated from clinical specimens.
J. Clin. Microbiol.
28:435-437 |
| 21. | Schaberg, D. R., D. H. Culver, and R. P. Gaynes. 1991. Major trends in the microbial etiology of nosocomial infection. Am. J. Med. 91:72S-75S[Medline]. |
| 22. | Teixeira, L. M., M. G. Carvalho, V. L. Merquior, A. G. Steigerwalt, M. G. Teixeira, D. J. Brenner, and R. R. Facklam. 1997. Recent approaches on the taxonomy of the enterococci and some related microorganisms. Adv. Exp. Med. Biol. 418:397-400[Medline]. |
| 23. | Toye, B., J. Shymanski, M. Bobrowska, W. Woods, and K. Ramotar. 1997. Clinical and epidemiologic significance of enterococci intrinsically resistant to vancomycin (possessing the vanC genotype). J. Clin. Microbiol. 35:3166-3170[Abstract]. (Erratum, 36:1469, 1998.) |
| 24. | Tyrrell, G. J., R. N. Bethune, B. Willey, and D. E. Low. 1997. Species identification of enterococci via intergenic ribosomal PCR. J. Clin. Microbiol. 35:1054-1060[Abstract]. (Erratum, 35:2434.) |
| 25. |
Vaneechoutte, M.,
P. Boerlin,
H. V. Tichy,
E. Bannerman,
B. Jäger, and J. Bille.
1998.
Comparison of PCR-based DNA fingerprinting techniques for the identification of Listeria species and their use for atypical Listeria isolates.
Int. J. Syst. Bacteriol.
48:127-139 |
| 26. |
Welsh, J., and M. McClelland.
1991.
Genomic fingerprints produced by PCR with consensus tRNA gene primers.
Nucleic Acids Res.
19:861-866 |
| 27. | Welsh, J., and M. McClelland. 1992. PCR-amplified length polymorphisms in tRNA intergenic spacers for categorizing staphylococci. Mol. Microbiol. 6:1673-1680[CrossRef][Medline]. |
| 28. |
Wiedmann-Al-Ahmad, M.,
H. V. Tichy, and G. Schön.
1994.
Characterization of Acinetobacter type strains and isolates obtained from wastewater treatment plants by PCR fingerprinting.
Appl. Environ. Microbiol.
60:4066-4071 |
| 29. | Williams, A. M., U. M. Rodrigues, and M. D. Collins. 1991. Intrageneric relationships of enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA. Res. Microbiol. 142:67-74[Medline]. |
Journal of Clinical Microbiology, November 2000, p. 4201-4207, Vol. 38, No. 11
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kampfer, P., Vaneechoutte, M., Lodders, N., De Baere, T., Avesani, V., Janssens, M., Busse, H.-J., Wauters, G.
(2009). Description of Chryseobacterium anthropi sp. nov. to accommodate clinical isolates biochemically similar to Kaistella koreensis and Chryseobacterium haifense, proposal to reclassify Kaistella koreensis as Chryseobacterium koreense comb. nov. and emended description of the genus Chryseobacterium. Int. J. Syst. Evol. Microbiol.
59: 2421-2428
[Abstract] [Full Text] -
Supre, K., De Vliegher, S., Sampimon, O. C., Zadoks, R. N., Vaneechoutte, M., Baele, M., De Graef, E., Piepers, S., Haesebrouck, F.
(2009). Technical note: Use of transfer RNA-intergenic spacer PCR combined with capillary electrophoresis to identify coagulase-negative Staphylococcus species originating from bovine milk and teat apices. J DAIRY SCI
92: 3204-3210
[Abstract] [Full Text] -
Vaneechoutte, M., Nemec, A., Musilek, M., van der Reijden, T. J. K., van den Barselaar, M., Tjernberg, I., Calame, W., Fani, R., De Baere, T., Dijkshoorn, L.
(2009). Description of Acinetobacter venetianus ex Di Cello et al. 1997 sp. nov.. Int. J. Syst. Evol. Microbiol.
59: 1376-1381
[Abstract] [Full Text] -
Su, S. C., Vaneechoutte, M., Dijkshoorn, L., Wei, Y. F., Chen, Y. L., Chang, T. C.
(2009). Identification of non-fermenting Gram-negative bacteria of clinical importance by an oligonucleotide array. J Med Microbiol
58: 596-605
[Abstract] [Full Text] -
Baele, M., Stakenborg, T., Lopes dos Santos Santiago, G., Haesebrouck, F., Vaneechoutte, M.
(2009). tDNA-PCR Followed by Automated Fluorescent Capillary Electrophoresis for Identification of Bacterial Species. CSH Protocols
2009: pdb.prot5196-pdb.prot5196
[Abstract] [Full Text] -
Nemati, M., Hermans, K., Vancraeynest, D., De Vliegher, S., Sampimon, O. C., Baele, M., De Graef, E. M., Pasmans, F., Haesebrouck, F.
(2008). Screening of bovine coagulase-negative staphylococci from milk for superantigen-encoding genes. Vet Rec.
163: 740-743
[Abstract] [Full Text] -
Martel, A., Pasmans, F., Hellebuyck, T., Haesebrouck, F., Vandamme, P.
(2008). Devriesea agamarum gen. nov., sp. nov., a novel actinobacterium associated with dermatitis and septicaemia in agamid lizards. Int. J. Syst. Evol. Microbiol.
58: 2206-2209
[Abstract] [Full Text] -
Tanasupawat, S., Sukontasing, S., Lee, J.-S.
(2008). Enterococcus thailandicus sp. nov., isolated from fermented sausage ('mum') in Thailand. Int. J. Syst. Evol. Microbiol.
58: 1630-1634
[Abstract] [Full Text] -
Vaneechoutte, M., De Baere, T., Nemec, A., Musilek, M., van der Reijden, T. J. K., Dijkshoorn, L.
(2008). Reclassification of Acinetobacter grimontii Carr et al. 2003 as a later synonym of Acinetobacter junii Bouvet and Grimont 1986. Int. J. Syst. Evol. Microbiol.
58: 937-940
[Abstract] [Full Text] -
Schelstraete, P., Van daele, S., De Boeck, K., Proesmans, M., Lebecque, P., Leclercq-Foucart, J., Malfroot, A., Vaneechoutte, M., De Baets, F.
(2008). Pseudomonas aeruginosa in the home environment of newly infected cystic fibrosis patients. Eur Respir J
31: 822-829
[Abstract] [Full Text] -
Martens, M., Dawyndt, P., Coopman, R., Gillis, M., De Vos, P., Willems, A.
(2008). Advantages of multilocus sequence analysis for taxonomic studies: a case study using 10 housekeeping genes in the genus Ensifer (including former Sinorhizobium). Int. J. Syst. Evol. Microbiol.
58: 200-214
[Abstract] [Full Text] -
Vaneechoutte, M., Kampfer, P., De Baere, T., Avesani, V., Janssens, M., Wauters, G.
(2007). Chryseobacterium hominis sp. nov., to accommodate clinical isolates biochemically similar to CDC groups II-h and II-c. Int. J. Syst. Evol. Microbiol.
57: 2623-2628
[Abstract] [Full Text] -
Sukontasing, S., Tanasupawat, S., Moonmangmee, S., Lee, J.-S., Suzuki, K.-i.
(2007). Enterococcus camelliae sp. nov., isolated from fermented tea leaves in Thailand. Int. J. Syst. Evol. Microbiol.
57: 2151-2154
[Abstract] [Full Text] -
Tung, S. K., Teng, L. J., Vaneechoutte, M., Chen, H. M., Chang, T. C.
(2007). Identification of species of Abiotrophia, Enterococcus, Granulicatella and Streptococcus by sequence analysis of the ribosomal 16S-23S intergenic spacer region. J Med Microbiol
56: 504-513
[Abstract] [Full Text] -
Martens, M., Delaere, M., Coopman, R., De Vos, P., Gillis, M., Willems, A.
(2007). Multilocus sequence analysis of Ensifer and related taxa. Int. J. Syst. Evol. Microbiol.
57: 489-503
[Abstract] [Full Text] -
Moyaert, H., Decostere, A., Vandamme, P., Debruyne, L., Mast, J., Baele, M., Ceelen, L., Ducatelle, R., Haesebrouck, F.
(2007). Helicobacter equorum sp. nov., a urease-negative Helicobacter species isolated from horse faeces. Int. J. Syst. Evol. Microbiol.
57: 213-218
[Abstract] [Full Text] -
Tung, S. K., Teng, L. J., Vaneechoutte, M., Chen, H. M., Chang, T. C.
(2006). Array-Based Identification of Species of the Genera Abiotrophia, Enterococcus, Granulicatella, and Streptococcus. J. Clin. Microbiol.
44: 4414-4424
[Abstract] [Full Text] -
Kampfer, P., Avesani, V., Janssens, M., Charlier, J., De Baere, T., Vaneechoutte, M.
(2006). Description of Wautersiella falsenii gen. nov., sp. nov., to accommodate clinical isolates phenotypically resembling members of the genera Chryseobacterium and Empedobacter.. Int. J. Syst. Evol. Microbiol.
56: 2323-2329
[Abstract] [Full Text] -
Van daele, S., Vaneechoutte, M., De Boeck, K., Knoop, C., Malfroot, A., Lebecque, P., Leclercq-Foucart, J., Van Schil, L., Desager, K., De Baets, F.
(2006). Survey of Pseudomonas aeruginosa genotypes in colonised cystic fibrosis patients. Eur Respir J
28: 740-747
[Abstract] [Full Text] -
Naser, S. M., Vancanneyt, M., Hoste, B., Snauwaert, C., Vandemeulebroecke, K., Swings, J.
(2006). Reclassification of Enterococcus flavescens Pompei et al. 1992 as a later synonym of Enterococcus casseliflavus (ex Vaughan et al. 1979) Collins et al. 1984 and Enterococcus saccharominimus Vancanneyt et al. 2004 as a later synonym of Enterococcus italicus Fortina et al. 2004. Int. J. Syst. Evol. Microbiol.
56: 413-416
[Abstract] [Full Text] -
Vaneechoutte, M., Young, D. M., Ornston, L. N., De Baere, T., Nemec, A., Van Der Reijden, T., Carr, E., Tjernberg, I., Dijkshoorn, L.
(2006). Naturally Transformable Acinetobacter sp. Strain ADP1 Belongs to the Newly Described Species Acinetobacter baylyi. Appl. Environ. Microbiol.
72: 932-936
[Abstract] [Full Text] -
Naser, S. M., Vancanneyt, M., De Graef, E., Devriese, L. A., Snauwaert, C., Lefebvre, K., Hoste, B., Svec, P., Decostere, A., Haesebrouck, F., Swings, J.
(2005). Enterococcus canintestini sp. nov., from faecal samples of healthy dogs. Int. J. Syst. Evol. Microbiol.
55: 2177-2182
[Abstract] [Full Text] -
Stakenborg, T., Vicca, J., Verhelst, R., Butaye, P., Maes, D., Naessens, A., Claeys, G., De Ganck, C., Haesebrouck, F., Vaneechoutte, M.
(2005). Evaluation of tRNA Gene PCR for Identification of Mollicutes. J. Clin. Microbiol.
43: 4558-4566
[Abstract] [Full Text] -
Devriese, L. A., Vancanneyt, M., Baele, M., Vaneechoutte, M., De Graef, E., Snauwaert, C., Cleenwerck, I., Dawyndt, P., Swings, J., Decostere, A., Haesebrouck, F.
(2005). Staphylococcus pseudintermedius sp. nov., a coagulase-positive species from animals. Int. J. Syst. Evol. Microbiol.
55: 1569-1573
[Abstract] [Full Text] -
Naser, S. M., Thompson, F. L., Hoste, B., Gevers, D., Dawyndt, P., Vancanneyt, M., Swings, J.
(2005). Application of multilocus sequence analysis (MLSA) for rapid identification of Enterococcus species based on rpoA and pheS genes. Microbiology
151: 2141-2150
[Abstract] [Full Text] -
Van daele, S., Verhelst, R., Claeys, G., Verschraegen, G., Franckx, H., Van Simaey, L., de Ganck, C., De Baets, F., Vaneechoutte, M.
(2005). Shared Genotypes of Achromobacter xylosoxidans Strains Isolated from Patients at a Cystic Fibrosis Rehabilitation Center. J. Clin. Microbiol.
43: 2998-3002
[Abstract] [Full Text] -
Naser, S., Thompson, F. L., Hoste, B., Gevers, D., Vandemeulebroecke, K., Cleenwerck, I., Thompson, C. C., Vancanneyt, M., Swings, J.
(2005). Phylogeny and Identification of Enterococci by atpA Gene Sequence Analysis. J. Clin. Microbiol.
43: 2224-2230
[Abstract] [Full Text] -
Van daele, S. G., Franckx, H., Verhelst, R., Schelstraete, P., Haerynck, F., Van Simaey, L., Claeys, G., Vaneechoutte, M., de Baets, F.
(2005). Epidemiology of Pseudomonas aeruginosa in a cystic fibrosis rehabilitation centre. Eur Respir J
25: 474-481
[Abstract] [Full Text] -
Tsai, J.-C., Hsueh, P.-R., Lin, H.-M., Chang, H.-J., Ho, S.-W., Teng, L.-J.
(2005). Identification of Clinically Relevant Enterococcus Species by Direct Sequencing of groES and Spacer Region. J. Clin. Microbiol.
43: 235-241
[Abstract] [Full Text] -
Vancanneyt, M., Zamfir, M., Devriese, L. A., Lefebvre, K., Engelbeen, K., Vandemeulebroecke, K., Amar, M., De Vuyst, L., Haesebrouck, F., Swings, J.
(2004). Enterococcus saccharominimus sp. nov., from dairy products. Int. J. Syst. Evol. Microbiol.
54: 2175-2179
[Abstract] [Full Text] -
De Baere, T., Verhelst, R., Labit, C., Verschraegen, G., Wauters, G., Claeys, G., Vaneechoutte, M.
(2004). Bacteremic Infection with Pantoea ananatis. J. Clin. Microbiol.
42: 4393-4395
[Abstract] [Full Text] -
Jackson, C. R., Fedorka-Cray, P. J., Barrett, J. B.
(2004). Use of a Genus- and Species-Specific Multiplex PCR for Identification of Enterococci. J. Clin. Microbiol.
42: 3558-3565
[Abstract] [Full Text] -
Vancanneyt, M., Devriese, L. A., De Graef, E. M., Baele, M., Lefebvre, K., Snauwaert, C., Vandamme, P., Swings, J., Haesebrouck, F.
(2004). Streptococcus minor sp. nov., from faecal samples and tonsils of domestic animals. Int. J. Syst. Evol. Microbiol.
54: 449-452
[Abstract] [Full Text] -
Baele, M., Van den Bulck, K., Decostere, A., Vandamme, P., Hanninen, M.-L., Ducatelle, R., Haesebrouck, F.
(2004). Multiplex PCR Assay for Differentiation of Helicobacter felis, H. bizzozeronii, and H. salomonis. J. Clin. Microbiol.
42: 1115-1122
[Abstract] [Full Text] -
De Graef, E. M., Devriese, L. A., Vancanneyt, M., Baele, M., Collins, M. D., Lefebvre, K., Swings, J., Haesebrouck, F.
(2003). Description of Enterococcus canis sp. nov. from dogs and reclassification of Enterococcus porcinus Teixeira et al. 2001 as a junior synonym of Enterococcus villorum Vancanneyt et al. 2001. Int. J. Syst. Evol. Microbiol.
53: 1069-1074
[Abstract] [Full Text] -
Wauters, G., De Baere, T., Willems, A., Falsen, E., Vaneechoutte, M.
(2003). Description of Comamonas aquatica comb. nov. and Comamonas kerstersii sp. nov. for two subgroups of Comamonas terrigena and emended description of Comamonas terrigena. Int. J. Syst. Evol. Microbiol.
53: 859-862
[Abstract] [Full Text] -
Baele, M., Vancanneyt, M., Devriese, L. A., Lefebvre, K., Swings, J., Haesebrouck, F.
(2003). Lactobacillus ingluviei sp. nov., isolated from the intestinal tract of pigeons. Int. J. Syst. Evol. Microbiol.
53: 133-136
[Abstract] [Full Text] -
Baele, M., Devriese, L. A., Vancanneyt, M., Vaneechoutte, M., Snauwaert, C., Swings, J., Haesebrouck, F.
(2003). Emended description of Streptococcus ferus isolated from pigs and rats. Int. J. Syst. Evol. Microbiol.
53: 143-146
[Abstract] [Full Text] -
De Baere, T., Wauters, G., Kampfer, P., Labit, C., Claeys, G., Verschraegen, G., Vaneechoutte, M.
(2002). Isolation of Buttiauxella gaviniae from a Spinal Cord Patient with Urinary Bladder Pathology. J. Clin. Microbiol.
40: 3867-3870
[Abstract] [Full Text] -
Lu, H.-Z., Weng, X.-H., Li, H., Yin, Y.-K., Pang, M.-Y., Tang, Y.-W.
(2002). Enterococcus faecium-Related Outbreak with Molecular Evidence of Transmission from Pigs to Humans. J. Clin. Microbiol.
40: 913-917
[Abstract] [Full Text] -
Wauters, G., Claeys, G., Verschraegen, G., De Baere, T., Vandecruys, E., Van Simaey, L., De Ganck, C., Vaneechoutte, M.
(2001). Case of Catheter Sepsis with Ralstonia gilardii in a Child with Acute Lymphoblastic Leukemia. J. Clin. Microbiol.
39: 4583-4584
[Abstract] [Full Text] -
Vaneechoutte, M., De Baere, T., Wauters, G., Steyaert, S., Claeys, G., Vogelaers, D., Verschraegen, G.
(2001). One Case Each of Recurrent Meningitis and Hemoperitoneum Infection with Ralstonia mannitolilytica. J. Clin. Microbiol.
39: 4588-4590
[Abstract] [Full Text] -
Clementino, M. M., de Filippis, I., Nascimento, C. R., Branquinho, R., Rocha, C. L., Martins, O. B.
(2001). PCR Analyses of tRNA Intergenic Spacer, 16S-23S Internal Transcribed Spacer, and Randomly Amplified Polymorphic DNA Reveal Inter- and Intraspecific Relationships of Enterobacter cloacae Strains. J. Clin. Microbiol.
39: 3865-3870
[Abstract] [Full Text] -
Prystowsky, J., Siddiqui, F., Chosay, J., Shinabarger, D. L., Millichap, J., Peterson, L. R., Noskin, G. A.
(2001). Resistance to Linezolid: Characterization of Mutations in rRNA and Comparison of Their Occurrences in Vancomycin-Resistant Enterococci. Antimicrob. Agents Chemother.
45: 2154-2156
[Abstract] [Full Text] -
Baele, M., Storms, V., Haesebrouck, F., Devriese, L. A., Gillis, M., Verschraegen, G., de Baere, T., Vaneechoutte, M.
(2001). Application and Evaluation of the Interlaboratory Reproducibility of tRNA Intergenic Length Polymorphism Analysis (tDNA-PCR) for Identification of Streptococcus Species. J. Clin. Microbiol.
39: 1436-1442
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»