Previous Article | Next Article 
Journal of Clinical Microbiology, March 2000, p. 1250-1254, Vol. 38, No. 3
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Epidemiological Analysis of Non-M-Typeable Group A
Streptococcus Isolates from a Thai Population in Northern
Thailand
Sumalee
Pruksakorn,1,*
Nopporn
Sittisombut,1
Charlie
Phornphutkul,2
Chulabhorn
Pruksachatkunakorn,2
Michael F.
Good,3 and
Evelyn
Brandt3
Department of
Microbiology1 and Department of
Pediatrics,2 Faculty of Medicine, Chiang Mai
University, Chiang Mai 50200, Thailand, and Queensland
Institute of Medical Research, Brisbane 4029, Queensland,
Australia3
Received 3 September 1999/Returned for modification 13 October
1999/Accepted 4 December 1999
 |
ABSTRACT |
Infection with group A streptococci (GAS) can lead to the
development of severe postinfectious sequelae such as rheumatic fever
(RF). In Thailand, RF and rheumatic heart disease (RHD) remain
important health problems. More than 80% of GAS circulating in this
population are non-M antigen typeable by conventional M serotyping
methods. In this study, we determine the M protein sequence types of
GAS isolates found in northern Thailand. The emm genes from
53 GAS isolates, collected between 1985 and 1995 from individuals with
pharyngitis, impetigo, acute RF (ARF), RHD, or meningitis as well as
from individuals without infections, were amplified by PCR and
sequenced. Thirteen new sequence types that did not show homology to
previously published sequences were characterized. Six of these
sequence types could be isolated from both skin and throat sites of
impetigo and pharyngitis/ARF patients, respectively. In many cases we
could not specifically differentiate skin strains or throat strains
that could be associated with ARF or acute glomerulonephritis.
Antigenic variations in the emm gene of the isolates
investigated, compared to published M protein sequences, were
predominantly due to point mutations, small deletions, and insertions
in the hypervariable region. One group of isolates with homology to M44
exhibited corrected frameshift mutations. A new M type isolated from an
RHD patient exhibited nucleotide sequence corresponding to the N
terminus of M58 and the C terminus of M25, suggesting that
recombination between the two types may have occurred. This study
provided epidemiological data relating to GAS endemic to northern
Thailand which could be useful for identification of vaccine candidates
in a specific region of endemicity.
| |
TEXT |
Infection with group A streptococci
(GAS) can lead to diseases ranging from impetigo and pharyngitis to the
postinfectious sequelae rheumatic fever (RF), rheumatic heart disease
(RHD), and acute glomerulonephritis. The incidence of RF has declined in developed countries since World War II, but in the last decade RF
outbreaks have been described in several United States cities and new M
antigen types of GAS, previously not associated with RF, have been
isolated (7). In Thailand, RF remains an important health
problem in children aged 5 to 15 years (17); its prevalence of 0.38 per 1,000 in Thailand (12, 22) is comparable to that in other developing countries in the western Pacific, Africa, and the
Americas (22).
The M protein, a cell surface protein, may play an important role in
the pathogenesis of disease. More than 80 GAS M types have been
identified by serological M typing. However, most GAS isolated from
patients and carriers in developing countries such as Thailand (8,
14, 17), aboriginal communities in Australia (5), and
Kuwait (9) cannot be classified into M types by conventional
M serotyping. DNA sequencing of the M protein gene permits the typing
of strains which cannot be serologically classified (2, 10, 20,
21).
In vaccine development, many studies have defined protective epitopes
from the N-terminal and C-terminal regions of the M protein (3, 4,
15, 16, 18). However, the vast number of isolates from specific
regions of endemicity remain largely uncharacterized, with over 80% of
isolates being classified as non-M typeable (5, 8, 17). The
non-M-typeable strains in Thailand have not yet been characterized.
Identification of predominant M types in this area would facilitate the
development of a vaccine targeted to this population. This study
examines non-M-typeable GAS isolates from patients and carriers in
northern Thailand. The sequence or sequence types of the M protein
genes were identified and their relatedness to published M protein
sequences was determined. These data provide useful information for
epidemiological studies of GAS in Thailand.
Isolation of GAS.
Throat swab and skin lesion swab specimens
were obtained from persons living in Chiang Mai, Thailand, with sore
throat, acute RF (ARF), RHD, meningitis, or impetigo as well as from
individuals without disease. The swab specimens were then cultured on
blood agar plates, with incubation at 37°C in an atmosphere with 5% CO2 for 24 to 48 h. The organisms that produced
beta-hemolytic colonies were identified as GAS by susceptibility to
0.04 U of bacitracin and agglutinated with group-specific antiserum by
the latex agglutination test (bioMerieux, Marcy Létoile, France). M typing was performed by a slide precipitation test with type-specific antiserum (19). All GAS isolates were stored in glycerol
storage medium (6) at 
40°C until required. Fifty-three
non-M-typeable isolates were included in the study.
DNA isolation.
The organisms were streaked out on blood agar
plates, and a single colony was used to inoculate 50 ml of Todd-Hewitt
broth. After incubation at 37°C overnight, the culture was spun down and the pellet was washed three times with phosphate-buffered saline
(pH 7.0), resuspended in 0.5 ml of a lysozyme solution (100 mg/ml), and
incubated at 37°C for 1 h. Sodium dodecyl sulfate (200 µl of a
20% solution) and proteinase K (100 µl of a 10-mg/ml solution) were
added, and the suspension was incubated at 55°C overnight. One-third
volume of a saturated NaCl solution was added, and the mixture was
incubated at 4°C for 20 min. The mixture was then centrifuged to
sediment the protein, the supernatant was transferred to a new tube,
and 95% ethanol (3 volumes) was added to precipitate the DNA. The tube
was rocked gently until the DNA flocculated. The DNA was then washed
once in 70% ethanol and retrieved with a bent-tip pipette, allowed to
air dry for 1 min, resuspended in 0.5 ml of Tris-EDTA buffer (pH 7.8),
and stored at 4°C until used.
Primers, PCR, and sequencing analysis.
The forward primer,
5' CAGTATTCGCTTAGAAAATTAAAA 3', was derived from leader
sequence of the M protein gene (10). The antisense primer,
5' CCCTTACGGCTTGCTTCTGA 3', was derived from the C repeat region of the M protein gene, which is conserved in several of the GAS
isolates. These primers were also used for cycle sequencing.
The PCR conditions were as follows: denaturation at 94°C for 30 s, annealing at 45°C for 30 s, and extension at 72°C for 2 min
for 35 cycles. The PCR products were purified by 0.8%
low-melting-point agarose gel extraction, using a PrepAGen DNA
purification kit (Bio-Rad Laboratories); they were quantitated and then
kept at 20°C until used.
The DNA was sequenced by using an ABI Dye Terminator Cycle Sequencing
Ready Reaction Kit in accordance with the manufacturer's
instructions
and an ABI 310 automated sequencer (both from The
Perkin-Elmer
Corporation). Each reaction product sequence was
confirmed
twice.
DNA sequences were transferred to the DNASIS program for sequence
comparisons between isolates. Pairwise nucleotide sequence
identity
comparisons were included. The percentages of homology
were used for
the arrangement of Table
1. The BLAST 2 program
(National Center for Biotechnology Information) was used to
determine
levels of homology with published sequences in the GenBank
(
1).
Fifty-three non-M-typeable GAS isolates from northern Thailand were
sequence typed by PCR amplification of the M protein genes
of their
DNAs. M protein genes were amplified from all 53 isolates.
Thirty
(59%) of the 53 isolates had DNA sequences with more than
98%
homology to published M protein gene sequences. The remaining
23 isolates had novel M protein gene sequences designated ST1
to ST13
(Table
1). The level of homology between isolates of
a given sequence
type is 98 to 100%.
Of the M types with homology to published sequences, Potter41
predominated, representing up to 21% of the non-M-typeable isolates
investigated, all of which were collected from patients with
pharyngitis
in 1985. The other M sequences, homologous to M44, M25,
M27, M22,
M12, M3, M70, M76, M81, M1, M11, and M63, represented up to
36%
of the isolates sequenced. The translated sequences of the M
proteins
from isolates corresponding to M1, M3, M11, M22, Potter41,
M70,
and M80 showed complete homology in the hypervariable region (data
not shown). Isolates that were homologous to M12, M25, M63, and
M75
differed in sequence by point mutations which resulted in
no more than
three amino acid substitutions in the hypervariable
region. The
sequences of isolates cmu68, cmud14-5, cmuj63, and
cmus665 differed
from that of M44 by only a compensatory frameshift
mutation spanning 5 amino acids (Fig.
1). Interestingly, the
isolate
represented by ST2 (cmuh92), which was obtained from an RHD
patient,
showed N-terminal sequence homology to M58 and C-terminal
sequence
homology to M25 (Fig.
2). GAS
isolates with homology to M25 were
found within the Thai population
investigated in this study (cmu42-1985,
cmuj59-1990, and cmuak19-1995)
(Table
1).
View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Alignment of nucleotide sequences of GAS isolates
cmu68, cmud14-5, cmuj63, and cmus665 with that of M44 in the region of
the frameshift mutation. Asterisks represent identity to the
corresponding nucleotides; dashes represent missing nucleotides. The
numbers attached to the sequence represent positions in the M44
nucleotide sequence published in GenBank. The region of the frameshift
mutation is shaded. (B) Translated sequence of cmu68 and M44 in the
region of the frameshift mutation. The region of the frameshift
mutation is shaded.
|
|
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Alignment of nucleotide sequence of GAS isolate cmuh92
with M58 and M25 DNA sequences (derived from GenBank), showing 96 and
89% homology, respectively. Asterisks represent identity to the
corresponding nucleotides, dashes represent missing nucleotides, and
dots indicate that no nucleotide sequence was given.
|
|
Six isolates were collected from ARF patients. Their sequences
exhibited homology to M22 (
n = 1) and M63 (
n = 2), and three
were new sequence types, ST7, ST8, and ST9. One
isolate from an
RHD patient exhibited nucleotide sequence homology to
M81, and
three were new sequence types, ST2, ST5, and ST10. Several
isolates
were collected from both throat and skin sites of patients
with
impetigo or sore throat or from noninfected individuals (ST1,
ST6,
ST7, ST8, M25, M44, and
M70).
Sequence analysis of the 53 isolates used in this study revealed 13 novel-sequence M types which were not identifiable with
previously
published
emm sequences. This finding shows the diversity
of
GAS strains found in northern Thailand. The majority of strains
with
more than one isolate (e.g., ST1, ST6, ST8, M25, M44, and
M70) were
isolated from both throat and skin sites. These strains,
as with
strains of other M types (
10), cannot be exclusively
categorized as rheumatogenic or
nephritogenic.
Antigenic variation in the M proteins of the isolates investigated,
compared to published M protein sequences, was predominantly
due to
point mutations, small deletions, and insertions in the
hypervariable
region. One group of isolates with homology to M44
exhibited corrected
frameshift mutations (Fig.
1). Studies of
isolates from the Northern
Territory of Australia had previously
revealed a number of M family
groups that showed compensatory
frameshift mutations, including
M52/M53/M80, M5,
emm49,
emm13,
emm33,
and
emm70 (
5). Interestingly, one new sequence M
type,
ST2, shows N-terminal homology to M58 (96%) and C-terminal
homology
to M25 (89%) (Fig.
2). Our data show that M25 is endemic to
this
area (isolate cmuj59 and cmuak19); therefore, this sequence type
may have been the result of intergenomic recombination between
two
isolates of M25 and M58, possibly while the host harbored
two GAS
strains at the same time. Recent studies suggest that
this may be a
mechanism for transfer of DNA between strains, resulting
in
emm-like genes and
vir regulons with mosaic
structures (
5,
13). These recombination events would alter
the amino acid sequence
of M and M-like genes, which may contribute to
pathogen virulence,
thereby effecting host immune
responses.
GAS are endemic in Thailand, and ARF is a severe health problem in that
area (
12). M sequence typing is a useful tool for
conducting
epidemiological studies of streptococcal infections,
particularly in an
area where nearly all GAS isolates are non-M
typeable by conventional M
serotyping methods. It allows not only
monitoring of streptococcal
carriage within regions of endemicity
but also identification of types
of circulating streptococci.
This information provides a useful
guideline for developing a
vaccine for RF in a specific area of
endemicity.
Nucleotide sequence accession numbers.
DNA sequences with no
homology to any published emm gene sequence were submitted
to GenBank (accession numbers are given in Table 1).
| |
ACKNOWLEDGMENTS |
This study was supported by The Thailand Research Fund, grant no.
BR/06/2539.
We are very grateful to Diana Martin and Teiko Murai for performing M serotyping.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand. Phone: (66)(53)221122, ext. 5332. Fax: (66)(53)217144. E-mail: spruksak{at}sd01.med.cmu.ac.th.
| |
REFERENCES |
| 1.
|
Altschul, S. F.,
T. L. Madden,
A. A. Schaffer,
J. Zhang,
Z. Zhang,
W. Miller, and D. J. Lipman.
1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res.
25:3389-3402[Abstract/Free Full Text].
|
| 2.
|
Beall, B.,
R. Facklam, and T. Thompson.
1996.
Sequencing emm-specific PCR products for routine and accurate typing of group A streptococci.
J. Clin. Microbiol.
34:953-958[Abstract].
|
| 3.
|
Brandt, E. R.,
W. A. Hayman,
B. Currie,
S. Pruksakorn, and M. F. Good.
1997.
Human antibodies to the conserved region of the M protein: opsonization of the heterologous strains of group A streptococci.
Vaccine
15:1805-1812[CrossRef][Medline].
|
| 4.
|
Fischetti, V. A.,
W. M. Hodges, and D. E. Hruby.
1989.
Protection against streptococcal pharyngeal colonization with a vaccinia:M protein recombinant.
Science
244:1487-1490[Abstract/Free Full Text].
|
| 5.
|
Gardiner, D. L., and K. S. Sriprakash.
1996.
Molecular epidemiology of impetiginous group A streptococcal infections in aboriginal communities of northern Australia.
J. Clin. Microbiol.
34:1448-1452[Abstract].
|
| 6.
|
Gherna, R. L.
1981.
Preservation, p. 208-217.
In
P. Gerhardt, R. G. E. Murray, R. N. Costilow, E. W. Nester, W. A. Wood, N. R. Krieg, and G. B. Phillips (ed.), Manual of methods for general bacteriology. American Society for Microbiology, Washington, D.C.
|
| 7.
|
Kaplan, E. L.,
D. J. Johnson, and P. P. Cleary.
1989.
Group A streptococcal serotypes isolated from patients and sibling contacts during the resurgence of rheumatic fever in the United States in the mid-1980s.
J. Infect. Dis.
159:101-103[Medline].
|
| 8.
|
Kaplan, E. L.,
D. R. Johnson,
P. Nanthapisud,
S. Sirilertpanrana, and S. Chumdermpadetsuk.
1992.
A comparison of group A streptococcal serotypes isolated from the upper respiratory tract in the USA and Thailand: implications.
Bull. W. H. O.
70:433-437[Medline].
|
| 9.
|
Majeed, H. A.,
F. A. Khuffash,
A. M. Yousof,
S. S. Farwana,
T. D. Chugh,
M. A. Moussa,
J. Rotta, and H. Havlickova.
1986.
The concurrent associations of group A streptococcal serotypes in children with acute rheumatic fever or pharyngitis-associated glomerulonephritis and their families in Kuwait.
Zentbl. Bakteriol. Mikrobiol. Hyg. Ser. A
262:346-356.
|
| 10.
|
Manjula, B. N.,
K. M. Khandke,
T. Fairwell,
W. A. Relf, and K. S. Sriprakash.
1991.
Heptad motifs within the distal subdomain of the coiled-coil rod region of M protein from rheumatic fever and nephritis associated serotypes of group A streptococci are distinct from each other: nucleotide sequence of the M57 gene and relation of the deduced amino acid sequence to other M proteins.
J. Protein Chem.
10:369-383[CrossRef][Medline].
|
| 11.
|
Martin, D. R.
1988.
Streptococcal infection: rheumatogenic streptococci reconsidered.
N. Z. Med. J.
101:394-396[Medline].
|
| 12.
|
Phornphutkul, C., and M. Markowitz.
1981.
Secondary prophylaxis in patients with rheumatic fever: use of outlying health centers.
Chiang Mai Med. Bull.
23:275-279.
|
| 13.
|
Podbielski, A.,
B. Krebs, and A. Kaufhold.
1994.
Genetic variability of the emm-related genes of the large vir regulon of group A streptococci: potential intra- and intergenomic recombination events.
Mol. Gen. Genet.
243:691-698[Medline].
|
| 14.
|
Pruksachatkunakorn, C.,
T. Vaniyapongs, and S. Pruksakorn.
1993.
Impetigo: an assessment of etiology and appropriate therapy in infants and children.
J. Med. Assoc. Thail.
76:222-229[Medline].
|
| 15.
|
Pruksakorn, S.,
A. Galbraith,
R. A. Houghten, and M. F. Good.
1992.
Conserved T and B cell epitopes on the M protein of group A streptococci: induction of bactericidal antibodies.
J. Immunol.
149:2729-2735[Abstract].
|
| 16.
|
Pruksakorn, S.,
B. Currie,
E. Brandt,
C. Phornphutkul,
S. Hunsakunachai,
A. Manmontri,
J. H. Robinson,
M. A. Kehoe,
A. Galbraith, and M. F. Good.
1994.
Toward a vaccine for rheumatic fever: identification of a conserved target epitope on the M protein of group A streptococci.
Lancet
344:639-642[CrossRef][Medline].
|
| 17.
|
Pruksakorn, S.,
C. Phornphutkul,
C. Boonchoo, et al.
1990.
Prevalence of group A streptococci from school children and patients in Chiang Mai, Thailand.
Chiang Mai Med. Bull.
29:15-26.
|
| 18.
|
Relf, W. A.,
J. Cooper,
E. R. Brandt,
W. A. Hayman,
R. F. Ander,
S. Pruksakorn,
B. Currie,
A. Saul, and M. F. Good.
1996.
Mapping a conserved conformational epitope from the M protein of group A streptococci.
Pept. Res.
9:12-20[Medline].
|
| 19.
|
Rotta, J., and R. R. Facklam.
1980.
Manual of microbiological diagnostic methods for streptococcal infections and their sequelae.
World Health Organization, Geneva, Switzerland.
|
| 20.
|
Saunders, N. A.,
G. Hallas,
E. T. Gaworzewska,
L. Metherell,
A. Efstratiou,
J. V. Hookey, and R. C. George.
1997.
PCR-enzyme-linked immunosorbent assay and sequencing as an alternative to serology for M-antigen typing of Streptococcus pyogenes.
J. Clin. Microbiol.
35:2689-2691[Abstract].
|
| 21.
|
Whatmore, A. M.,
V. Kapur,
D. J. Sullivan,
J. M. Musser, and M. A. Kehoe.
1994.
Non-congruent relationships between variation in emm gene sequences and the population genetic structure of group A streptococci.
Mol. Microbiol.
14:619-631[Medline].
|
| 22.
|
World Health Organization.
1992.
WHO programme for the prevention of rheumatic fever/rheumatic heart disease in 16 developing countries: report from phase I (1986-90).
Bull. W. H. O.
70:213-221[Medline].
|
Journal of Clinical Microbiology, March 2000, p. 1250-1254, Vol. 38, No. 3
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nawawi, R. A., Baiano, J. C. F., Kvennefors, E. C. E., Barnes, A. C.
(2009). Host-Directed Evolution of a Novel Lactate Oxidase in Streptococcus iniae Isolates from Barramundi (Lates calcarifer). Appl. Environ. Microbiol.
75: 2908-2919
[Abstract]
[Full Text]
-
Shulman, S. T., Carapetis, J. R.
(2007). Rheumatic Heart Disease in Developing Countries. NEJM
357: 2089-2089
[Full Text]
-
Tewodros, W., Kronvall, G.
(2005). M Protein Gene (emm Type) Analysis of Group A Beta-Hemolytic Streptococci from Ethiopia Reveals Unique Patterns. J. Clin. Microbiol.
43: 4369-4376
[Abstract]
[Full Text]
-
Moses, A. E., Hidalgo-Grass, C., Dan-Goor, M., Jaffe, J., Shetzigovsky, I., Ravins, M., Korenman, Z., Cohen-Poradosu, R., Nir-Paz, R.
(2003). emm Typing of M Nontypeable Invasive Group A Streptococcal Isolates in Israel. J. Clin. Microbiol.
41: 4655-4659
[Abstract]
[Full Text]
-
Ho, P. L., Johnson, D. R., Yue, A. W. Y., Tsang, D. N. C., Que, T. L., Beall, B., Kaplan, E. L.
(2003). Epidemiologic Analysis of Invasive and Noninvasive Group A Streptococcal Isolates in Hong Kong. J. Clin. Microbiol.
41: 937-942
[Abstract]
[Full Text]
Top
Abstract
Text
