Previous Article | Next Article ![]()
Journal of Clinical Microbiology, April 2000, p. 1319-1323, Vol. 38, No. 4
Department of Medical Microbiology, St.
Bartholomew's and the Royal London School of Medicine and
Dentistry, London E1 2AD,1 and
Respiratory and Systemic Infection Laboratory, Central
Public Health Laboratory, London NW9 5HT,2
United Kingdom
Received 17 August 1999/Returned for modification 11 October
1999/Accepted 3 January 2000
New pneumococcal conjugate vaccines covering a limited number of
serotypes are likely to come into widespread use over the next
few years. It is unknown what effect this will have on the relative
importance of different serotypes as causes of pneumococcal infection. Hence, it will be important to monitor serotype prevalence before, during, and after the introduction of new vaccines. We have
investigated the ability of a PCR method based on polymorphisms in two
genes common to the different capsule loci to predict the serotype of
93 clinical isolates of Streptococcus pneumoniae submitted to the Central Public Health Laboratory in 1997. Of 70 isolates with
vaccine serotypes, 65 were predicted to belong to the correct serotype;
this number was improved to 69 with the inclusion of two additional
patterns to the database. Of 23 isolates with other serotypes,
19 were correctly predicted as non-vaccine serotypes, the discrepancy
lying with four isolates of 6A (non-vaccine serotype) that were
indistinguishable from isolates of 6B (vaccine serotype). In situations
in which culture of the organism is not feasible, this method could
potentially be applicable directly to clinical specimens and could be a
valuable aid to the surveillance of pneumococcal serotypes.
Respiratory disease has overtaken
diarrheal disease as the major cause of death in children under the age
of 5 years worldwide. Streptococcus pneumoniae is one of
the most important pathogens involved. At the same time resistance to
penicillin and other antimicrobials has dramatically increased, leading
to serious problems in the treatment of pneumococcal disease. The case
for primary prevention of pneumococcal infection by vaccination is now compelling.
New pneumococcal conjugate vaccines are currently undergoing extensive
trials and are likely to be introduced in widespread vaccination
programs in the near future (20). Since such vaccines can
only cover up to 11 of the 90 pneumococcal serotypes, extensive surveillance of serotype prevalence in populations to be vaccinated will be needed. Furthermore, it is important that prevalence be monitored during and after implementation of vaccination programs, in
case widespread vaccination leads to the selective increase of
serotypes not covered by the vaccine.
Serotype prevalence is currently monitored by culture of the organism,
followed by serology. A nonculture diagnostic method with the
ability to determine serotype could have immense advantages in
convenience and cost. One potential approach to a nonculture method is
to use the PCR to detect pneumococcal DNA directly from a clinical
specimen, focusing on a segment either responsible for or closely
linked to production of the polysaccharide capsule (which determines
serotype). At the present time sequences of the genes responsible for
capsule production in several serotypes have been published, and
serotype specific genes have been identified (1, 7, 9, 11-13, 15,
18, 19, 21, 22). However, an inconveniently large number of
different PCR primers would be required to determine the serotype by
this strategy. Furthermore, the large size of the serotype-specific
region, at well over 10 kb in most cases, precludes the possibility of
using a universal PCR with primers in conserved flanking regions as a
method applicable directly to clinical specimens with current technology.
As an alternative approach which would be amenable to application on
clinical material, we have investigated polymorphism within the first
two genes of the serotype 19F capsule locus, cps19fA and
cps19fB, which have homologous sequences in most if not all
other serotypes (9, 19). These are physically the closest
conserved genes to those actually determining serotype, and thus
polymorphism within them would be expected to be tightly linked to
capsule type. We have examined the potential to use this region in a
PCR test as a marker for serotype among pneumococcal cultures submitted
to the major reference center in the United Kingdom. Specifically, in
the context of the introduction of a conjugate vaccine, can such a test
predict (i) whether a pneumococcus is of a serotype contained in the
vaccine and (ii), if so, which of the vaccine serotypes it is?
Bacterial isolates.
Ten pneumococci from each of the eleven
proposed conjugate vaccine serotypes (1, 3, 4, 5, 6B, 7F, 9V, 14, 18C,
19F, and 23F) were selected from among recent clinical isolates
submitted to the reference laboratory from September to December 1997, along with a reference strain for each of serotypes 5 (NCTC 11887), 6B
(NCTC 11888), 9V (NCTC 11897), and 23F (NCTC 11910). Uncharacterized pneumococci used for the prediction of serotype were submitted to the
reference laboratory over a 2-week period in March 1998.
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Evaluation of Serotype Prediction by
cpsA-cpsB Gene Polymorphism in
Streptococcus pneumoniae

![]()
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
Serotyping of isolates. Preliminary serotyping was performed by slide agglutination (5) with capsular typing sera and factor sera (Statens Serum Institute, Copenhagen, Denmark). Any discrepancies or equivocal results were rechecked by the Quellung reaction (16).
DNA extraction and PCR. Streptococci of other species and pneumococci in preliminary experiments were cultured overnight in 20 ml of Todd-Hewitt broth (Oxoid). After sedimentation the cells were resuspended in 0.1 ml of TE (10 mM Tris HCl, 1 mM EDTA; pH 8.0). Lysozyme (10 µl at 50 mg/ml) was added, and cells were incubated for 30 min at 37°C, followed by the addition of 0.5 ml of GES (5 M guanidine thiocyanate, 0.1 M EDTA [pH 8.0], 0.5% Sarkosyl) and incubation at room temperature for 10 min. Ammonium acetate (0.25 ml at 7.5 M) was added, and the cells were mixed and placed on ice for 10 min. Chloroform-isoamyl alcohol (24:1) was added, mixed, and separated by centrifugation, and 0.7 ml of the aqueous phase was recovered. DNA was precipitated with 0.54 volumes of isopropanol and then redissolved and reprecipitated in 70% ethanol. The DNA was finally resuspended in 50 to 100 µl of TE.
In subsequent experiments, as specified in Results, pneumococcal DNA was prepared as a crude extract. A loopful of growth from a fresh plate was suspended in 100 µl of TE and heated to 100°C for 5 min. Primers for PCR were CPSA3 (ATCCTTGTCAGCTCTGTGTC; GenBank accession no. U09239; positions 415 to 434 [9]) and CPSB2 (TCACTTGCAACTACATGAAC; positions 2191 to 2210 [9]). PCR was performed in 100-µl mixture containing 50 mM KCl, 10 mM Tris HCl (pH 8.3), 2.5 mM MgCl2, 0.2 mM concentrations of each deoxynucleoside triphosphate, 100 ng of each primer, 1 µl of template DNA (purified or crude extract), and 1.2 U of AmpliTaq polymerase (Perkin-Elmer). Conditions for PCR were 1 cycle of 95°C for 3 min, followed by 30 cycles of 95°C for 1 min, 50°C for 2 min, and 72°C for 2 min in a Hybaid Thermal Reactor. PCR products were analyzed on 10-cm 0.9% agarose gels in Tris-borate-EDTA (TBE), stained with ethidium bromide, and viewed with UV illumination. Restriction digests with AluI, HinfI, and RsaI (Promega) were performed on 10 to 18 µl of PCR product. Restriction fragments were separated on 4% polyacrylamide gels in TBE, stained with ethidium bromide, and viewed with UV illumination. Images were recorded with an IS 1000 Digital Imaging System (Flowgen). Fragment patterns were analysed with GelCompar, version 4.1 (Applied Maths, Kortrijk, Belgium), selecting the region of the gel between the 1,636- and 134-bp bands of the reference 1-kb ladder. Patterns were normalized by using three reference tracks per gel, a 400-point resolution, and a smoothing factor of 5. The bands were identified by the autosearch feature and artifacts on the images incorrectly identified as bands were manually deleted. No distinction was made for single bands that, on the basis of intensity, were likely to correspond to two comigrating fragments. Comparisons were made with a positional tolerance of 1%, a tolerance increase of 1.75%, and an optimization value of 0.5%. Patterns were clustered by the UPGMA method by using the Dice similarity coefficient. Restriction patterns of isolates of unknown serotype were compared with the database lists by using the identification feature (employing the above coefficient values and UPGMA clustering).| |
RESULTS |
|---|
|
|
|---|
Specificity of primers.
In a test designed for direct
application to clinical samples it is important to know whether an
amplification product would be obtained with other species,
particularly the related oral streptococci. DNA was extracted from
isolates of different streptococcal species (see Materials and Methods)
and used as a template for PCR. Only one isolate yielded a specific
product that had a size close to that obtained with pneumococci. This
was group K streptococcus NCTC 10232, which was determined to be a
putative S. oralis strain on the basis of Rapid Strep ID32
API and the production of
-D-N-acetylglucosaminidase and
-D-N-acetylglucosaminidase
(23).
Conservation of restriction profiles within serotypes. A preliminary investigation of the correlation between restriction patterns in cpsA-cpsB and serotype was undertaken on a set of isolates in our laboratory collection from Norway, Japan, Russia, the United Kingdom, and the West Indies. PCR products amplified with primers CPSA3 and CPSB2 were digested with AluI and with HinfI, and the resulting patterns were compared visually. Upon combining the results with both restriction enzymes, 33 patterns were observed among 153 isolates of 25 serotypes. Each combination of AluI and HinfI restriction patterns was unique to a single serotype with the following exceptions: all 14 isolates of serotype 6A shared the same patterns as 8 of 16 6B isolates; 1 of 3 isolates of serotype 1 and 1 of 2 of 23A shared patterns with 9 of 11 23F isolates; 2 of 6 19A isolates shared patterns with all 3 7F isolates; 1 of 2 15B isolates and the sole 15C isolate shared patterns with all 3 serotype 22F isolates; the other 15B isolate shared patterns with 16 of 18 serotype 14 isolates. Representative isolates with patterns shared between serotypes were further analyzed by using additional restriction enzymes. It was observed that RsaI digestion could distinguish 19A from 7F isolates and some isolates of 6A from 6B. Twelve serotypes were represented by more than one type of pattern with one or both enzymes. Overall, the preliminary investigation suggested a close association between restriction profile and serotype.
The strategy of serotype prediction from the restriction profile needed to be tested further under conditions more relevant to the context in which it might be used, such as a national pneumococcal reference center. This required the establishment of a database of patterns from clinical isolates typical of the time and place and a computerized system for pattern storage and comparison. Thus, 10 recent clinical isolates (or 9 plus 1 reference strain) confirmed to belong to each of the 11 serotypes likely to be included in conjugate vaccines (serotypes 1, 3, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F) were selected from among those recently submitted to the Central Public Health Laboratory. PCR with primers CPSA3 and CPSB2 was performed on a crude extract of each isolate. All isolates yielded a product corresponding to the predicted size of 1.8 kb. PCR products were digested with AluI, HinfI, and RsaI (three separate reactions), and the resultant fragments from each reaction were separated on polyacrylamide gels. The fragment patterns were recorded with a digital imager and analyzed by using GelCompar version 4.1 software as described in Materials and Methods. First, for each serotype the 10 isolates were compared to each other. For serotypes 1, 3, 4, 7F, and 9V the 10 isolates of the same serotype were indistinguishable with all three restriction enzymes. The restriction patterns obtained were given a code according to the serotype and enzyme used, e.g., the pattern obtained with AluI on all serotype 1 isolates was designated 1A, except for shared patterns as described below. For serotypes 5, 6B, 14, 18C, 19F, and 23F, two different sets of restriction patterns were obtained for the 10 isolates with, in most cases, a single isolate producing a distinct pattern from the other 9. These patterns were coded with an extra digit, e.g., the more common pattern obtained with AluI on serotype 23F isolates was designated 23fA1 and the less common pattern was designated 23fA2 (Table 1). Second, for each restriction enzyme in turn, isolates representing all the different restriction patterns for all the serotypes were compared. Figure 1 illustrates the comparison of all AluI patterns. The 15 patterns were derived from 11 different gels, normalized with reference ladders. Although normalization has not generated a visually perfect alignment, the program recognizes two pairs of matching patterns. Thus, with AluI all patterns were distinct except that one serotype 5 pattern was the same as the serotype 4 pattern and one 18C pattern was the same as one 19F pattern. (Apparent differences in the sum of fragment sizes, e.g., between 4A and 6bA, arise from comigrating fragments being scored as single bands and the discounting of bands below 134bp [see Materials and Methods].) Patterns were also shared between two pairs of serotypes for HinfI and three pairs of serotypes for RsaI (Table 1). Only one isolate, the reference serotype 5 isolate, shared patterns for two restriction enzymes with another serotype, and a combination of the three enzyme patterns (the restriction profile) was able to distinguish all 11 serotypes.
|
|
Correlation of restriction profile to serotype in uncharacterized
isolates.
To evaluate the ability of restriction profile to
predict serotype, 93 consecutive isolates submitted to the Respiratory
and Systemic Infection Laboratory (RSIL) over a 2-week period were examined. Restriction profile and serotype for these 93 isolates were
determined independently by different experimenters. The three
restriction patterns for each isolate were compared to the lists of
patterns in the database described above. The criterion used for
assignment of a predicted serotype from a restriction profile was that
there must be
90% similarity to patterns of the same serotype from
at least two of the three lists. This was established by comparing
serotype assignment of the patterns from the first 20 isolates by
visual inspection and GelCompar. An exception is applied in the case of
the serotype 4/5 patterns: since the rare serotype 5 pattern for two
enzymes is shared by serotype 4, all serotype 4 isolates would be
expected to match serotype 5 in two lists; in this case the prediction
of serotype 4 rather than 5 was made if there were matches to serotype
4 patterns in all three lists and to serotype 5 in two lists. On this
basis isolates were assigned to 1 of the 11 vaccine serotypes or, if the above criterion was not met, they were considered to be
"nonvaccine serotypes." After analysis, the serotype predicted by
PCR was compared to the serotype obtained by slide agglutination and
the Quellung reaction.
pe)/(1
pe), where po is the
observed proportion of isolates where the two methods agree and
pe is the expected proportion of agreement if the isolates
were allocated to serotype at random while keeping the total number of
isolates of each serotype fixed. With the results obtained, the kappa
value was calculated to be 0.88. A hypothesis test of kappa equal to
zero (i.e., if the serotypes were allocated at random) gives a
P value of <0.0001.
|
| |
DISCUSSION |
|---|
|
|
|---|
Preliminary work on an international collection of isolates demonstrated a strong correlation between the cpsA-cpsB restriction profile and the serotype. The study was then focused to evaluate the potential of a method based on cpsA-cpsB polymorphism to predict the serotype among isolates submitted to the major pneumococcal reference center in the United Kingdom, targetting the 11 serotypes being considered for inclusion in conjugate vaccines.
Among 93 consecutive isolates submitted to RSIL over a 2-week period, correlation between the predicted serotype from the restriction profile and the actual serotype calculated on the basis of the proportions of each serotype in the collection (Cohen's kappa statistic) was 0.88 (P < 0.0001). Isolates that were incorrectly assigned were examined further to see whether the accuracy of prediction could be improved for future analyses. Two serotype 6B isolates were missed because they had patterns that differed from those in the database; work with other pneumococci in this laboratory has demonstrated that this additional 6B profile is quite common and specific to 6B; its inclusion in the database would improve the detection of 6B isolates. The additional 9V profile had not been observed previously, but its addition to the database would not compromise recognition of other serotypes in this study. Inclusion of these two additional patterns would improve the correlation, kappa, to 0.94.
The four isolates incorrectly assigned to vaccine serotypes were all serotype 6A but were predicted to be serotype 6B. It appears from this and other work that the cpsA-cpsB restriction profile often cannot distinguish between these subtypes, and we are currently investigating other strategies to address this. It is a matter of current debate whether these two subtypes are cross-protective. Published data on conjugate 6B vaccine suggests that cross-protection will be provided (6, 8), in which case it would not be necessary to distinguish them. However, this remains to be confirmed in more extensive trials.
Potential pitfalls in applying an indirect test to predict serotype need to be considered. First, such a test can never guarantee 100% accuracy because the genes examined do not themselves determine serotype and so would not be appropriate if the serotype of one particular isolate was critical. Since serotype does not influence treatment this is rarely if ever likely to be the case in clinical situations. Second, it is likely that serotype will sometimes become dislocated from the cpsA-cpsB restriction profile, either through mutation in restriction sites or through recombination. Recombination of capsule genes is now well documented (2, 3, 10, 14, 17), although in the cases characterized to date the point of cross-over occurs outside the locus so that serotype remains linked to cpsA-cpsB restriction profile (4). For these reasons it is essential to verify and if necessary modify the database in any potential application of the method and to continue to apply conventional serology in a proportion of cases.
Such pitfalls should be weighed against the possible advantages, chief of which is the potential to screen serotype directly from clinical samples, avoiding the necessity for isolation of the organism. Where the balance of advantages and difficulties lies depends on the situation in which the test is to be applied. We consider that a typical context could be the introduction of a conjugate pneumococcal vaccine targeted at all infants in a population. Serotype surveillance is needed both before and after introduction to monitor changes that might be induced in serotype prevalence by protection against a limited number of serotypes. A major rise in disease caused by previously unusual serotypes could necessitate a change in vaccine composition. In addition, it would be critical to determine whether infections occurring in vaccinated individuals were due to a vaccine serotype and, if so, to which one, in order to monitor the efficacy of the vaccine. In monitoring trends in serotype prevalence over time, the accuracy of an indirect test would probably be acceptable given the advantage of a nonculture system, and it is our present intention to apply this methodology to the detection of vaccine and nonvaccine serotype pneumococci in clinical specimens. However, in examining infections in vaccinated individuals a further test to distinguish serotypes 6A and 6B might be required and is currently under investigation.
| |
ACKNOWLEDGMENTS |
|---|
We are grateful for the support of the Special Trustees of the Royal London Hospital and the Medical Research Council (studentship to E.R.L.) and Colfuturo (scholarship to C.A.A.).
We thank Andre Charlett and the PHLS Statistics Unit for advice on statistical analysis and NHS and PHLS microbiologists for referring cultures. International isolates were kindly provided by N. Rikitomi, Nagasaki, Japan; P. Prabhakar, Caribbean Epidemiology Centre, Trinidad, West Indies; L. Strachunsky, Smolensk, Russia; and T. Bergen, Oslo, Norway.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Medical Microbiology, St. Bartholomew's and the Royal London School of Medicine and Dentistry, Turner St., London E1 2AD, United Kingdom. Phone: 44-207-377-7259. Fax: 44-207-375-0518. E-mail: l.m.c.hall{at}mds.qmw.ac.uk.
Present address: Department of Biochemistry, University of
Cambridge, Cambridge CB2 1QW, United Kingdom.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Arrecubieta, C.,
R. Lopez, and E. Garcia.
1994.
Molecular characterization of cap3A, a gene from the operon required for the synthesis of the capsule of Streptococcus pneumoniae type 3: sequencing of mutations responsible for the unencapsulated phenotype and localization of the capsular cluster on the pneumococcal chromosome.
J. Bacteriol.
176:6375-6383 |
| 2. | Barnes, D. M., S. Whittier, P. H. Gilligan, S. Soares, A. Tomasz, and F. W. Henderson. 1995. Transmission of multidrug-resistant serotype 23F Streptococcus pneumoniae in group day care: evidence suggesting capsular transformation of the resistant strain in vivo. J. Infect. Dis. 171:890-896[Medline]. |
| 3. | Coffey, T. J., C. G. Dowson, M. Daniels, J. Zhou, C. Martin, B. G. Spratt, and J. M. Musser. 1991. Horizontal transfer of multiple penicillin-binding protein genes, and capsular biosynthetic genes, in natural populations of Streptococcus pneumoniae. Mol. Microbiol. 5:2255-2260[Medline]. |
| 4. | Coffey, T. J., M. C. Enright, M. Daniels, J. K. Morona, R. Morona, W. Hryniewicz, J. C. Paton, and B. G. Spratt. 1998. Recombinational exchanges at the capsular polysaccharide biosynthetic locus lead to frequent serotype changes among natural isolates of Streptococcus pneumoniae. Mol. Microbiol. 27:73-83[CrossRef][Medline]. |
| 5. |
Colman, G.,
E. M. Cooke,
B. D. Cookson,
P. G. Cooper,
A. Efstratiou, and R. C. George.
1998.
Pneumococci causing invasive disease in Britain 1982 to 1990.
J. Med. Microbiol.
47:17-27 |
| 6. | Dagan, R., M. Muallem, R. Melamed, O. Leroy, and P. Yagupsky. 1997. Reduction of pneumococcal nasopharyngeal carriage in early infancy after immunization with tetravalent pneumococcal vaccines conjugated to either tetanus toxoid or diphtheria toxoid. Pediatr. Infect. Dis. J. 16:1060-1064[CrossRef][Medline]. |
| 7. | Dillard, J. P., and J. Yother. 1994. Genetic and molecular characterisation of capsular polysaccharide biosynthesis in Streptococcus pneumoniae type 3. Mol. Microbiol. 12:959-972[CrossRef][Medline]. |
| 8. | Giebink, G. S., J. D. Meier, M. K. Quartey, C. L. Liebeler, and C. T. Le. 1996. Immunogenicity and efficacy of Streptococcus pneumoniae polysaccharide-protein conjugate vaccines against homologous and heterologous serotypes in the chinchilla otitis media model. J. Infect. Dis. 173:119-127[Medline]. |
| 9. |
Guidolin, A.,
J. K. Morona,
R. Morona,
D. Hansman, and J. C. Paton.
1994.
Nucleotide sequence analysis of genes essential for capsular polysaccharide biosynthesis in Streptococcus pneumoniae type 19F.
Infect. Immun.
62:5384-5396 |
| 10. | Hermans, P. W. M., M. Sluijter, K. Elzenaar, A. van Veen, J. J. M. Schonkeren, F. M. Nooren, W. J. van Leeuwen, A. J. de Neeling, B. van Klingeren, H. A. Verburgh, and R. de Groot. 1997. Penicillin-resistant Streptococcus pneumoniae in The Netherlands: results of a 1-year molecular epidemiologic survey. J. Infect. Dis. 175:1413-1422[Medline]. |
| 11. |
Iannelli, F.,
B. J. Pearce, and G. Pozzi.
1999.
The type 2 capsule locus of Streptococcus pneumoniae.
J. Bacteriol.
181:2652-2654 |
| 12. |
Kolkman, M. A. B.,
D. A. Morrison,
A. M. van der Zeijst, and P. J. M. Nuijten.
1996.
The capsule polysaccharide synthesis locus of Streptococcus pneumoniae serotype 14: identification of the glycosyl transferase gene cps14E.
J. Bacteriol.
178:3736-3741 |
| 13. | Kolkman, M. A. B., W. Wakarchuk, P. J. M. Nuijten, and B. A. M. van der Zeijst. 1997. Capsular polysaccharide synthesis in Streptococcus pneumoniae serotype 14: molecular analysis of the complete cps locus and identification of genes encoding glycosyltransferases required for the biosynthesis of the tetrasaccharide subunit. Mol. Microbiol. 26:197-208[CrossRef][Medline]. |
| 14. | Lefevre, J. C., M. A. Bertrand, and G. Faucon. 1995. Molecular analysis by pulsed-field gel electrophoresis of penicillin-resistant Streptococcus pneumoniae from Toulouse, France. Eur. J. Clin. Microbiol. Infect. Dis. 14:491-497[CrossRef][Medline]. |
| 15. | Llull, D., R. Lopez, E. Garcia, and R. Munoz. 1998. Molecular structure of the gene cluster responsible for the synthesis of the polysaccharide capsule of Streptococcus pneumoniae type 33F. Biochim. Biophys. Acta 1443:217-224[Medline]. |
| 16. | Lund, E., and J. Henrichsen. 1978. Laboratory diagnosis, serology and epidemiology of Streptococcus pneumoniae. Methods Microbiol. 12:241-262. |
| 17. |
McDougal, L. K.,
R. Facklam,
M. Reeves,
S. Hunter,
J. M. Swenson,
B. C. Hill, and F. C. Tenover.
1992.
Analysis of multiply antimicrobial-resistant isolates of Streptococcus pneumoniae from the United States.
Antimicrob. Agents Chemother.
36:2176-2184 |
| 18. |
Morona, J. K.,
R. Morona, and J. C. Paton.
1997.
Molecular and genetic characterization of the capsule biosynthesis locus of Streptococcus pneumoniae type 19B.
J. Bacteriol.
179:4953-4958 |
| 19. | Morona, J. K., R. Morona, and J. C. Paton. 1997. Characterization of the locus encoding the Streptococcus pneumoniae type 19F capsular polysaccharide biosynthetic pathway. Mol. Microbiol. 23:751-763[CrossRef][Medline]. |
| 20. | Mulholland, K. 1999. Strategies for the control of pneumococcal diseases. Vaccine 17:S79-S84. |
| 21. | Munoz, R., M. Mollerach, R. Lopez, and E. Garcia. 1997. Molecular organization of the genes required for the synthesis of type 1 capsular polysaccharide of Streptococcus pneumoniae: formation of binary encapsulated pneumococci and identification of cryptic dTDP-rhamnose biosynthesis genes. Mol. Microbiol. 25:79-92[CrossRef][Medline]. |
| 22. |
Ramirez, M., and A. Tomasz.
1998.
Molecular characterization of the complete 23F capsular polysaccharide locus of Streptococcus pneumoniae.
J. Bacteriol.
180:5273-5278 |
| 23. | Whiley, R. A., and D. Beighton. 1998. Current classification of the oral streptococci. Oral Microbiol. Immunol. 13:195-216[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»