Previous Article | Next Article 
Journal of Clinical Microbiology, April 2000, p. 1482-1487, Vol. 38, No. 4
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
A Simple PCR Method for Rapid Genotype Analysis of
Mycobacterium ulcerans
Timothy
Stinear,1,*
John K.
Davies,1
Grant A.
Jenkin,1
Françoise
Portaels,2
Bruce C.
Ross,3
Frances
OppEdIsano,4
Maria
Purcell,5
John A.
Hayman,6 and
Paul D. R.
Johnson1,4,7
Department of Microbiology, Monash
University,1 and Department of
Infectious Diseases and Clinical Epidemiology, Monash Medical
Centre,7 Clayton, Research and
Development, CSL Limited,3 and
Microbiology Research Unit, Royal Children's
Hospital,4 Parkville, Victorian
Infectious Diseases Reference Laboratory, North
Melbourne,5 and Department of
Pathology, Box Hill Hospital, Box Hill,6
Victoria, Australia, and Institute of Tropical Medicine,
Antwerp, Belgium2
Received 3 November 1999/Accepted 23 January 2000
 |
ABSTRACT |
Two high-copy-number insertion sequences, IS2404 and
IS2606, were recently identified in Mycobacterium
ulcerans and were shown by Southern hybridization to possess
restriction fragment length polymorphism between strains from different
geographic origins. We have designed a simple genotyping method that
captures these differences by PCR amplification of the region between
adjacent copies of IS2404 and IS2606. We have
called this system 2426 PCR. The method is rapid, reproducible,
sensitive, and specific for M. ulcerans, and it has
confirmed previous studies suggesting a clonal population structure of
M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia,
Surinam, Mexico, Japan, China, and several countries in Africa were
easily differentiated based on an array of 4 to 14 PCR products ranging
in size from 200 to 900 bp. Numerical analysis of the banding patterns
suggested a close evolutionary link between M. ulcerans
isolates from Africa and southeast Asia. The application of 2426 PCR to
total DNA, extracted directly from M. ulcerans-infected
tissue specimens without culture, demonstrated the sensitivity and
specificity of this method and confirmed for the first time that both
animal and human isolates from areas of endemicity in southeast
Australia have the same genotype.
 |
INTRODUCTION |
Mycobacterium ulcerans is
an environmental mycobacterium with worldwide distribution (Fig.
1) and causes chronic, necrotizing skin
lesions in otherwise healthy humans. The incidence of M. ulcerans disease has been increasing worldwide, particularly
throughout rural west Africa (11, 22). The reasons for this
increase are unknown. Epidemiological and PCR-based evidence suggests
that swamps and slow-flowing water are sources of the organism (1, 6, 8, 17, 25), and recent PCR data from Benin and Ghana have
identified M. ulcerans DNA in aquatic insects
(12). So far M. ulcerans has never been isolated
by culture from any of these environments. It has therefore been
difficult to clearly identify reservoirs or modes of transmission. One
approach to improving our understanding of the ecology of this organism
has been to study the molecular epidemiology of M. ulcerans,
for which two methods have been reported. The first of these identified restriction fragment length polymorphism (RFLP) between isolates by
probing with the polymorphic GC-rich repeat sequence contained in
plasmid pTBN12 (7). This approach distinguished 11 distinct RFLP types among isolates from four countries and
suggested a clonal population structure within a geographic region.
Supporting this conclusion, nucleotide sequence analysis of the 3'
region of the 16S rRNA gene identified three alleles that correlated with the geographic origin of an isolate (13). However, the methods used in these studies were limited by requiring
high-concentration, purified DNA or by offering limited discriminative
capability.
PCR genotyping of mycobacteria by targeting insertion sequences (IS)
has been well described (10, 16). The recent discovery of
two high-copy-number IS elements in M. ulcerans that
displayed RFLP between strains (21) suggested that
PCR amplification between adjacent copies of these elements
(IS2404 and IS2606) may be suitable for
genotyping this species.
The aims of this study were twofold. The first was to develop a method
that would offer strain discrimination in a simple, reproducible
format. Second, using this method, we hoped to improve our
understanding of the molecular epidemiology of M. ulcerans by analyzing a selection of isolates from disease foci around the world.
 |
MATERIALS AND METHODS |
Mycobacterial strains, clinical specimens, and culture
conditions.
The origins of the M. ulcerans strains used
in this study are listed in Table 1. The
origins of the other species of mycobacteria that were used and general
culture conditions have been described previously (21).
DNA preparation.
An approximately 10-µl loopful of cells
was scraped from an egg yolk agar slope and resuspended in 500 µl of
1% Triton X-100. This cell suspension was added to a 2-ml skirted,
screw cap tube containing 200 µl of washed 100-µ-m-diameter glass
beads and 500 µl of chloroform-isoamylalcohol (24:1). The tube was
placed in a Fastprep cell disrupter (Savant Instruments, Holbrook,
N.Y.) at speed setting 6 for 40 s. After cell disruption, the tube
was cooled on ice for 5 min and then centrifuged at 17,000 × g for 5 min. In some instances DNA was also prepared by
resuspending cells in 300 µl of water, heating cells to 100°C for
20 min, and then centrifuging as described above. The aqueous phases
were retained and stored at
20°C. A 2-µl volume of DNA from
either preparation was used as a template for the PCR.
For primer specificity testing, DNA was extracted from a panel of 23 species of mycobacteria and pooled into five groups. Each pool of DNA
was then tested by 2426 PCR. The composition of each group was as
follows: pool 1, Mycobacterium heidelbergense, M. intermedium, M. lentiflavum, M. obuense, and
M. parafortuitum; pool 2, M. pulveris, M. rhodesiae, M. shimoidei, M. tokaiense, and
M. triplex; pool 3, M. vaccae, M. xenopi, M. gordonae, M. simiae, and M. flavescens; pool 4, M. terrae, M. aurum,
M. chelonae, and M. smegmatis; pool 5, M. fortuitum, M. marinum, M. tuberculosis, and
M. haemophilum.
For method sensitivity experiments, purified DNA was extracted by the
method of Boddinghaus et al. (2) from 50 mg (wet weight) of
M. ulcerans cells harvested from egg yolk agar slopes. The
DNA was diluted as previously described to represent M. ulcerans genome equivalents, where 4 to 5 fg of DNA approximates
one mycobacterial genome (9).
2426 PCR.
Reaction conditions used for 2426 PCR were as
follows: each PCR mixture (20 µl) contained 1× PCR buffer II (10×
PCR buffer II contained 500 mM KCl and 100 mM Tris-HCl [pH 8.3]), 2.5 mM MgCl2, 0.2 mM deoxynucleoside triphosphates (0.2 mM
[each] dATP, dTTP, dCTP, and dGTP), an 0.5 µM concentration of each
primer (MU4, 5' ATCGCCGAAGCCTGCCGGAT 3', positions 1119 to
1138, and MU9, 5' TCTTCGTGGTTTTGTGATGGC 3', positions 1306 to 1326), 1 U of Ampli-Taq DNA polymerase (Perkin-Elmer,
Melbourne, Australia), and 2 µl of DNA. PCR was performed in an
FTS-960 thermal sequencer (Corbett Research, Sydney, Australia) with
the following protocol, optimized for this application: 5 cycles of
95°C for 1 min, 60°C for 1 min, and 72°C for 1 min and 25 cycles
(30 cycles for tissue specimens) of 95°C for 20 s, 58°C for
30 s, and 72°C for 40 s, followed by a final extension step
at 72°C for 5 min. The PCR products were held at 4°C until analyzed
and detected with 7.5% (0.75 mM) native polyacrylamide gel
electrophoresis at 200 V for 38 min in a Mini-Protean II apparatus
(Bio-Rad) with rapid silver staining. A 100-bp ladder was used as a
size marker (Gibco, BRL). The silver stain procedure was adapted from
Caetano-Anoelles and Breshoff (Promega Notes 45:13-18,
1994) as follows. After electrophoresis, gels were fixed in 7.5%
acetic acid for 6 min, rinsed three times in distilled water, and then
stained for 8 min with 50 ml of a 0.075% silver nitrate solution
containing 75 µl of formaldehyde. Gels were rinsed twice in distilled
water and developed in 50 ml of developing solution, which contained 1.5 g of sodium carbonate, 0.2 µg of sodium thiosulfate, and 75 µl of formaldehyde. The developing reaction was terminated with 7.5%
acetic acid.
The banding patterns from all strains were compared visually. A binary
matrix was constructed by scoring each pattern for the presence or
absence of the 29 PCR products that constituted the total pool of
fragments between 200 and 900 bp. It was assumed that comigrating bands
were of identical sequence and therefore an indication of genetic
relatedness. The patterns were compared by the method of unweighted
pair group average linkage and the simple matching coefficient
(19). The goodness of fit of the cluster analysis was tested
with the cophenetic correlation coefficient, where r values
greater than 0.9 suggest a very good fit (18). All analyses
were performed with NTSYS, version 1.8, software (Applied Biostatistics
Inc., Setauket, N.Y.).
 |
RESULTS |
A test panel of M. ulcerans clinical isolates was
assembled from many of the known M. ulcerans disease foci in
the world (Fig. 1), a collection that represented both temporal and
spatial diversity. All isolates were found to contain IS2404
and IS2606 as determined by PCR, and a selection of these
results is shown in Fig. 2A.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 2.
(A) PCR detection of IS2404 (492 bp) and
IS2606 (332 bp) in M. ulcerans isolates from
different geographic regions. (B) 2426 PCR genotype analysis of
M. ulcerans isolates from different geographic regions.
Lanes (A and B), 1, ATCC 19423; 2, 13822/70; 3, 11878/70; 4, 94-1331;
5, 186510; 6, 5155; 7, 842; 8, 5114; 9, 98-912; 10, ATCC 33728; lane
11, no-template control; lane M, 100-bp size ladder. Vic., Victoria;
QLD, Queensland; Aust., Australia.
|
|
Several combinations of outward-priming oligonucleotides for
IS2404 and IS2606 were then evaluated in order to
obtain reproducible and discriminatory patterns of bands for different
strains of M. ulcerans. Primers MU4 and MU9 gave the largest
number of clearly resolvable bands when PCR products were separated by
nondenaturing polyacrylamide gel electrophoresis and detected by silver
staining (Fig. 2B). The use of each primer alone in a PCR did not
produce a useful banding pattern. Nine different 2426 PCR genotypes
were observed (Fig. 2B). All isolates were tested at least twice with the same Triton X-100 DNA preparation, and identical profiles were
produced. For the strains from Africa, Queensland, Malaysia, and Papua
New Guinea and for two of the Victorian isolates, DNA was also
extracted by boiling cells in water. The crude DNA preparations from
this method produced banding patterns identical to that obtained from
the detergent-extracted DNA (data not shown). A single pattern for all
seven African isolates was obtained despite the large distances and
long times separating some of these isolates (Table 1; Fig. 1 and
3). The 35 Australian isolates produced
two profiles, representing one genotype from Queensland (northern
Australia) and one from Victoria (southeastern Australia). No variation
was detected among the 32 isolates from Victoria (Fig.
4), but there were two distinct genotypes
among the 3 isolates from Papua New Guinea (PNG I and PNG II). The
Malaysian genotype was nearly identical to PNG II, differing only by
the positions of two bands between 200 and 900 bp. Distinct profiles
were observed for the isolates from Surinam and Mexico; however, the
patterns for isolates from Japan and China were identical.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 3.
2426 PCR genotype analysis of M. ulcerans
isolates from five countries in Africa. Lane 1, 96-658; lane 2, 94-856;
lane 3, 97-111; lane 4, 5155; lane 5, 97-610; lane 6, 97-680; lane 7, no-template control; lane 8, 100-bp ladder size marker.
|
|

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 4.
2426 PCR genotype analysis of M. ulcerans
isolates from southeast Australia and Papua New Guinea. Lanes 1 and 3 to 7, strains 94114510, 95046437, 95067597, 94161099, 94171428, 94151667, respectively; lane 2, 186463; lane 8, no-template control;
lane M, 100-bp ladder size marker.
|
|
To investigate primer specificity 24 other species of mycobacteria were
tested by 2426 PCR. Some PCR products from other mycobacteria were
observed, but these were generally faint, and none produced profiles
similar to any of the patterns obtained from the different M. ulcerans strains (Fig. 5).

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 5.
Determination of primer specificity for M. ulcerans by 2426 PCR of 23 other species of mycobacteria as
described in Materials and Methods. Lane 1, mycobacterial DNA pool 1;
lane 2, pool 2; lane 3, pool 3; lane 4, pool 4; lane 5, pool 5; lane 6, M. ulcerans Malaysian strain 186510; lane 7, 100-bp ladder
size marker; lane 8, no-template control.
|
|
A dendrogram was constructed to display the relatedness between strains
based on banding pattern similarity (Fig.
6). The clustering of the southeast Asian
genotypes and the African genotype is suggestive of an evolutionary
link among these strains; however, the PNG I genotype was an
interesting exception to this cluster. The genotypes representing the
other regions appeared less related to each other, displaying 30 to
60% similarity (r = 0.91) (Fig. 6).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6.
Cluster analysis of the genetic relationships among 51 isolates based on banding pattern similarity displayed by 2426 PCR.
Percentage similarity is indicated by a scale at the top. Genotypes
codes are given on the right and reflect the origin of the isolates.
Codes are as follows: VIC; Victoria, Australia; PNG I and PNG II, Papua
New Guinea; MLAY, Malaysia; QLD, Queensland, Australia; JPN/CHN, Japan
and China; SRNME, Surinam, South America; MEX, Mexico. The numbers in
parentheses denote the numbers of isolates displaying the genotypes.
|
|
The detection sensitivity of 2426 PCR was tested with a dilution series
of purified M. ulcerans genomic DNA from an African isolate.
This demonstrated a detection limit of 100 genomes (Fig. 7).

View larger version (85K):
[in this window]
[in a new window]
|
FIG. 7.
Detection sensitivity of 2426 PCR for genotyping
M. ulcerans (strain 5152) with a dilution series of DNA.
Lane 1, 106 genomes; lane 2, 105 genomes; lane
3, 104 genomes; lane 4, 103 genomes; lane 5, 102 genomes; lane 6, 10 genomes; lane 7, 1 genome; lane 8, no-template control; lane M, 100-bp ladder size marker.
|
|
The relatively low concentration of cells required to produce a profile
and the specificity of the target sequences to M. ulcerans
suggested that this method may be useful for genotyping directly from
clinical samples. To investigate this, DNA extracted from 50 patient
specimens was subjected to 2426 PCR. These samples included swabs and
formalin-fixed and paraffin-embedded tissue specimens that had been
screened previously by IS2404 PCR for M. ulcerans
diagnosis (unpublished data). Of these 50 samples, 40 were
IS2404 positive and the remainder were IS2404
negative. All 50 samples were then tested by 2426 PCR. An example of
some profiles obtained is shown in Fig.
8. A recognizable genotype was obtained
for 20 of the 40 IS2404-positive specimens. All samples that
were IS2404 negative were also 2426 PCR negative. The
specificity of the 2426 PCR was 100% (calculated as the number of true
negatives divided by the number of true negatives plus false
positives), and the sensitivity was 66.7% (calculated as the number of
true positives divided by the number of true positives plus false
negatives). From the 20 recognizable profiles, 13 were identified as
the Victorian genotype and 7 as the Queensland genotype. These profiles
also correctly predicted the geographic origin of the specimen.
Analysis of tissue samples from an M. ulcerans-infected
alpaca (Quechua alpako) and possum (Trichosurus
vulpecula) clearly demonstrated that these animals were infected
with the same genotype as the human cases from these areas (Fig. 8).
Both these animals inhabited regions in southeast Australia where
M. ulcerans disease is known to be endemic.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 8.
2426 PCR genotype analysis of M. ulcerans
from DNA extracted directly from human and animal specimens. Lanes 1 to
3, dry swab, paraffin-embedded tissue, and formaldehyde-preserved
tissue specimens, respectively, from a possum captured on Phillip
Island; lane 4, formaldehyde-preserved human tissue specimen from the
Langwarrin focus; lane 5, formaldehyde-preserved alpaca tissue from the
east Gippsland focus; lane 6, Victorian isolate ATCC 19423; lane 7, no-template control; lane M, 100-bp ladder size marker.
|
|
 |
DISCUSSION |
In mycobacteria, genetic diversity is driven by the activity of
mobile DNA such as IS rather than nucleotide sequence drift (20). Thus IS elements are potentially ideal targets for
indexing rapidly evolving change in mycobacterial populations (10,
26). M. ulcerans has at least two high-copy-number IS
elements, IS2404 and IS2606, that demonstrate
RFLP between strains (21) and that appear to be present in
isolates of diverse geographic origin (Fig. 2A) (4).
However, M. ulcerans is a slow-growing organism, and
extraction of a sufficient quantity and quality of DNA to perform a
Southern analysis is a time-consuming and impractical process for
routine analysis.
The PCR typing method we have developed is a simple and robust tool for
quickly determining the origin of an isolate, requiring a minimum of
100 genomic equivalents of DNA (Fig. 7). The high detection sensitivity
and specificity permitted typing directly from patient specimens
without requiring culture. Other mycobacteria tested by 2426 PCR did
produce some bands, but none reproduced any of the profiles seen with
M. ulcerans (Fig. 5). The sensitivity of 2426 PCR for
genotyping directly from tissue specimens was, however, found to be
somewhat low (66.7%). This was most likely due to the low numbers of
target cells in some samples; however, DNA extracted from swabs or
tissue specimens served equally well as a template. The detection
sensitivity of 2426 PCR in this application may be improved by ensuring
that specimens are taken from areas of ulceration likely to contain
large numbers of bacilli.
Analysis by 2426 PCR of IS2404-positive swab and tissue
specimens, obtained from animals and humans in areas of southeast Australia where M. ulcerans disease is endemic identified
the same genotype in all specimens, suggesting that animals are
infected from the same environmental source as humans (Fig. 8).
Genotyping directly from tissue specimens will be particularly useful
for studying the epidemiology of M. ulcerans, as culture of
this organism is slow and relatively insensitive (4).
To investigate the discriminating capability of 2426 PCR, 55 M. ulcerans isolates were tested (Table 1). The combination of
primers MU4 and MU9 produced nine distinct profiles that correlated absolutely with the geographic source of the isolates, i.e., the origin
of an isolate could be unambiguously assigned based on its banding
pattern. This result is somewhat surprising as other mycobacteria, such
as Mycobacterium avium, exhibit considerable IS diversity
even within a geographic region when analyzed by a similar genotyping
technique (26). The lack of genotype variation in M. ulcerans within a region may be a reflection of its slow generation time and perhaps a low population density within its environmental niche. PCR-based incidence data, gathered during a
disease outbreak, suggested a very low abundance of bacteria in the
environment (17).
A lack of IS mobility as a cause of the limited genotype diversity is
possible but unlikely, as the different 2426 PCR genotypes are
indicative of ongoing transposition events or IS-associated genome
rearrangements. Furthermore, these events appear to have occurred
relatively recently, considering (i) the absence of IS2404 and IS2606 from the closely related M. marinum
and (ii) the very high nucleotide sequence similarity between the 16S
rRNA and groEL genes of M. ulcerans and M. marinum (13-15, 23), which is indicative of the recent
evolutionary divergence of these species. The inferred close genetic
relationship among the five genotypes obtained from the southeast Asian
isolates (Fig. 6) suggests that M. ulcerans is introduced
into an area and then is isolated or sequestered, undergoing occasional
transposition or genome rearrangement events to produce a unique
genotype in a particular region. However, rapid dispersal over large
distances also seems possible considering that only one genotype was
observed among the isolates from five countries throughout central and
west Africa (Fig. 3). This analysis suggests that the spread of disease
across Africa has occurred after its spread throughout southeast Asia
and Australia if the rate of genome rearrangements displayed by 2426 PCR is assumed to be the same for all strains.
The 2426 PCR method is highly reproducible. The DNA from all isolates
was tested at least twice, and each set of tests produced identical
profiles. In addition, 2426 PCR performed with DNA extracted from cells
in crude form by boiling produced profiles identical to those produced
by PCR performed with purified DNA. The reproducibility of this method
is further reinforced by the ability to produce the same pattern from
DNA over a 5-log-unit dilution range of template DNA (Fig. 7) and by
the fact that the same pattern was obtained for the 32 Victorian
isolates and 7 African isolates (Fig. 4).
The findings of previous genotype studies of M. ulcerans by
Southern hybridization with the pTBN12 probe (7) and
nucleotide sequence analysis of the 16SrRNA gene (13)
generally concurred with the results from 2426 PCR analysis, where
identical genotypes were detected within a region. However the pTBN12
probe method also identified some additional RFLP among African
isolates. The apparent increased discriminatory capability of the
pTBN12 probe is countered by the length of time taken to perform a
Southern hybridization (3 to 4 days) compared with that taken by 2426 PCR (4 to 6 h) and the ability of 2426 PCR to obtain a genotype
directly from a clinical specimen.
Interestingly the pTBN12 probe offered no additional discrimination
among Victorian isolates, thus supporting the suggestion of clonality
of M. ulcerans within a region. Analysis of additional African isolates with the pTBN12 probe and 2426 PCR is warranted to
more thoroughly examine evidence for clonality between endemic foci and
to better compare the capabilities of each method.
It is of interest that two genotypes were detected in Papua New Guinea
(Fig. 1B). The PNG II pattern appears closely related those of the
Malaysian and Australian strains. By comparison, the PNG I pattern is
quite distinct and appears, at least by this method, less related to
those of the other southeast Asian strains than to those of the African
isolates (Fig. 6). Unfortunately further details regarding the origin
of this strain were unavailable but, it is likely to represent an
endemic focus distant to the PNG II isolates. We are currently
sequencing multiple gene loci from M. ulcerans to better
establish the genetic relatedness between all strains.
It has been proposed that the global distribution of M. ulcerans may be linked to the breakup of the supercontinents at
the end of the Jurassic period (5). However, the data
presented in this study, previous 16S rRNA sequence comparisons of
M. ulcerans and M. marinum, and the discovery of
M. ulcerans in Japan and China (3, 24) argue
against this hypothesis and suggest a far more recent mechanism of
dispersal. More-extensive nucleotide sequence analyses of M. ulcerans strains are now required to investigate intraspecies and
interspecies evolution and to further our understanding of the
molecular epidemiology of M. ulcerans.
 |
ACKNOWLEDGMENTS |
We thank David Dawson for the provision of mycobacterial isolates.
This work was supported in part by funding from the Government of
Victoria through the Department of Human Services.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology, Monash University, Wellington Rd., Clayton 3168, Australia. Phone: 61 3 9905 4809. Fax: 61 3 9905 4811. E-mail:
tim.stinear{at}med.monash.edu.au.
 |
REFERENCES |
| 1.
|
Anonymous.
1971.
Epidemiology of Mycobacterium ulcerans infection (Buruli ulcer) at Kinyara, Uganda.
Trans R. Soc. Trop. Med. Hyg.
65:763-775[CrossRef][Medline].
|
| 2.
|
Boddinghaus, B.,
T. Rogall,
T. Flohr,
H. Blocker, and E. C. Bottger.
1990.
Detection and identification of mycobacteria by amplification of rRNA.
J. Clin. Microbiol.
28:1751-1759[Abstract/Free Full Text].
|
| 3.
| Faber, W. R., L. M. Pereira Arias-Bouda,
J. E. Zeegelaar, A. H. J. Kolk, P. A. Fonteyne, J. Toonstra, and F. Portaels. 1999. First case of Mycobacterium
ulcerans infection in the Peoples Republic of China. Trans. R. Soc. Trop. Med. Hyg., in press.
|
| 4.
|
Guimaraes-Peres, A.,
F. Portaels,
P. de Rijk,
K. Fissette,
S. R. Pattyn,
J. van Vooren, and P. Fonteyne.
1999.
Comparison of two PCRs for detection of Mycobacterium ulcerans.
J. Clin. Microbiol.
37:206-208[Abstract/Free Full Text].
|
| 5.
|
Hayman, J.
1984.
Mycobacterium ulcerans: an infection from Jurassic time?
Lancet
ii:1015-1016.
|
| 6.
|
Hayman, J.
1991.
Postulated epidemiology of Mycobacterium ulcerans infection.
Int. J. Epidemiol.
20:1093-1098[Abstract/Free Full Text].
|
| 7.
|
Jackson, K.,
R. Edwards,
D. E. Leslie, and J. Hayman.
1995.
Molecular method for typing Mycobacterium ulcerans.
J. Clin. Microbiol.
33:2250-2253[Abstract].
|
| 8.
|
Johnson, P. D.,
M. G. Veitch,
D. E. Leslie,
P. E. Flood, and J. A. Hayman.
1996.
The emergence of Mycobacterium ulcerans infection near Melbourne.
Med. J. Aust.
164:76-78[Medline].
|
| 9.
|
Mangiapan, G.,
M. Vokurka,
L. Schouls,
J. Cadranel,
D. Lecossier,
J. van Embden, and A. J. Hance.
1996.
Sequence capture-PCR improves detection of mycobacterial DNA in clinical specimens.
J. Clin. Microbiol.
34:1209-1215[Abstract].
|
| 10.
|
Picardeau, M., and V. Vincent.
1996.
Typing of Mycobacterium avium isolates by PCR.
J. Clin. Microbiol.
34:389-392[Abstract].
|
| 11.
|
Portaels, F.
1998.
Historical overview of the Buruli ulcer, p. 17.
In
K. Asiedu, M. Raviglione, and R. Scherpbier (ed.), Proceedings of the International Conference on Buruli Ulcer Control and Research. World Health Organization, Geneva, Switzerland.
|
| 12.
|
Portaels, F.,
P. Elsen,
A. Guimares-Peres,
P. A. Fonteyne, and W. M. Meyers.
1999.
Insects in the transmission of Mycobacterium ulcerans infection.
Lancet
353:986[CrossRef][Medline]. (Letter.)
|
| 13.
|
Portaels, F.,
P. A. Fonteyne,
H. de Beenhouwer,
P. de Rijk,
A. Guedenon,
J. Hayman, and M. W. Meyers.
1996.
Variability in 3' end of 16S rRNA sequence of Mycobacterium ulcerans is related to geographic origin of isolates.
J. Clin. Microbiol.
34:962-965[Abstract].
|
| 14.
|
Roberts, B., and R. Hirst.
1997.
Immunomagnetic separation and PCR for detection of Mycobacterium ulcerans.
J. Clin. Microbiol.
35:2709-2711[Abstract].
|
| 15.
|
Rogall, T.,
J. Wolters,
T. Flohr, and E. C. Bottger.
1990.
Towards a phylogeny and definition of species at the molecular level within the genus Mycobacterium.
Int. J. Syst. Bacteriol.
40:323-330[Abstract/Free Full Text].
|
| 16.
|
Ross, B. C., and B. Dwyer.
1993.
Rapid, simple method for typing isolates of Mycobacterium tuberculosis by using the polymerase chain reaction.
J. Clin. Microbiol.
31:329-334[Abstract/Free Full Text].
|
| 17.
|
Ross, B. C.,
P. D. Johnson,
F. Oppedisano,
L. Marino,
A. Sievers,
T. Stinear,
J. A. Hayman,
M. G. Veitch, and R. M. Robins-Browne.
1997.
Detection of Mycobacterium ulcerans in environmental samples during an outbreak of ulcerative disease.
Appl. Environ. Microbiol.
63:4135-4138[Abstract].
|
| 18.
|
Sneath, P. H. A.
1978.
Classification of microorganisms, p. 9/1-9/31.
In
J. R. Norris, and M. H. Richmond (ed.), Essays in microbiology. John Wiley, Chichester, United Kingdom.
|
| 19.
|
Sneath, P. H. A., and R. R. Sokal.
1973.
Numerical taxonomy. W. H.
Freeman & Co., San Francisco, Calif.
|
| 20.
|
Sreevatsan, S.,
X. Pan,
K. E. Stockbauer,
N. D. Connell,
B. N. Kreiswirth,
T. S. Whittam, and J. M. Musser.
1997.
Restricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination.
Proc. Natl. Acad. Sci. USA
94:9869-9874[Abstract/Free Full Text].
|
| 21.
|
Stinear, T.,
B. C. Ross,
J. K. Davies,
L. Marino,
R. M. Robins-Browne,
F. Oppedisano,
A. Sievers, and P. D. R. Johnson.
1999.
Identification and characterization of IS2404 and IS2606: two distinct repeated sequences for detection of Mycobacterium ulcerans by PCR.
J. Clin. Microbiol.
37:1018-1023[Abstract/Free Full Text].
|
| 22.
|
Thangaraj, H. S.,
M. R. W. Evans, and M. H. Wansborough-Jones.
1999.
Mycobacterium ulcerans disease; Buruli ulcer.
Trans. R. Soc. Trop. Med. Hyg.
93:337-340[CrossRef][Medline].
|
| 23.
|
Tonjum, T.,
D. B. Welty,
E. Jantzen, and P. L. Small.
1998.
Differentiation of Mycobacterium ulcerans, M. marinum, and M. haemophilum: mapping of their relationships to M. tuberculosis by fatty acid profile analysis. DNA-DNA hybridization, and 16S rRNA gene sequence analysis.
J. Clin. Microbiol.
36:918-925[Abstract/Free Full Text].
|
| 24.
|
Tsukamura, M.,
K. Kaneda,
T. Imaeda, and H. Mikoshiba.
1989.
A taxonomic study on a mycobacterium which caused a skin ulcer in a Japanese girl that resembled Mycobacterium ulcerans.
Kekkaku
64:691-697[Medline].
|
| 25.
|
Veitch, M. G.,
P. D. Johnson,
P. E. Flood,
D. E. Leslie,
A. C. Street, and J. A. Hayman.
1997.
A large localized outbreak of Mycobacterium ulcerans infection on a temperate southern Australian island.
Epidemiol. Infect.
119:313-318[CrossRef][Medline].
|
| 26.
|
Yoder, S.,
C. Argueta,
A. Holtzman,
T. Aronson,
O. G. W. Berlin,
P. Tomasek,
N. Glover,
S. Froman, and G. Stelma, Jr.
1999.
PCR comparison of Mycobacterium avium isolates obtained from patients and foods.
Appl. Environ. Microbiol.
65:2650-2653[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, April 2000, p. 1482-1487, Vol. 38, No. 4
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Huber, C. A., Ruf, M.-T., Pluschke, G., Kaser, M.
(2008). Independent Loss of Immunogenic Proteins in Mycobacterium ulcerans Suggests Immune Evasion. CVI
15: 598-606
[Abstract]
[Full Text]
-
Graham, M., Ballard, S. A., Grabsch, E. A., Johnson, P. D. R., Grayson, M. L.
(2008). High Rates of Fecal Carriage of Nonenterococcal vanB in both Children and Adults. Antimicrob. Agents Chemother.
52: 1195-1197
[Abstract]
[Full Text]
-
Chauty, A., Ardant, M.-F., Adeye, A., Euverte, H., Guedenon, A., Johnson, C., Aubry, J., Nuermberger, E., Grosset, J.
(2007). Promising Clinical Efficacy of Streptomycin-Rifampin Combination for Treatment of Buruli Ulcer (Mycobacterium ulcerans Disease). Antimicrob. Agents Chemother.
51: 4029-4035
[Abstract]
[Full Text]
-
Hilty, M., Yeboah-Manu, D., Boakye, D., Mensah-Quainoo, E., Rondini, S., Schelling, E., Ofori-Adjei, D., Portaels, F., Zinsstag, J., Pluschke, G.
(2006). Genetic Diversity in Mycobacterium ulcerans Isolates from Ghana Revealed by a Newly Identified Locus Containing a Variable Number of Tandem Repeats. J. Bacteriol.
188: 1462-1465
[Abstract]
[Full Text]
-
Oliveira, M. S., Fraga, A. G., Torrado, E., Castro, A. G., Pereira, J. P., Filho, A. L., Milanezi, F., Schmitt, F. C., Meyers, W. M., Portaels, F., Silva, M. T., Pedrosa, J.
(2005). Infection with Mycobacterium ulcerans Induces Persistent Inflammatory Responses in Mice. Infect. Immun.
73: 6299-6310
[Abstract]
[Full Text]
-
Ablordey, A., Hilty, M., Stragier, P., Swings, J., Portaels, F.
(2005). Comparative Nucleotide Sequence Analysis of Polymorphic Variable-Number Tandem-Repeat Loci in Mycobacterium ulcerans. J. Clin. Microbiol.
43: 5281-5284
[Abstract]
[Full Text]
-
Phillips, R., Horsfield, C., Kuijper, S., Lartey, A., Tetteh, I., Etuaful, S., Nyamekye, B., Awuah, P., Nyarko, K. M., Osei-Sarpong, F., Lucas, S., Kolk, A. H. J., Wansbrough-Jones, M.
(2005). Sensitivity of PCR Targeting the IS2404 Insertion Sequence of Mycobacterium ulcerans in an Assay Using Punch Biopsy Specimens for Diagnosis of Buruli Ulcer. J. Clin. Microbiol.
43: 3650-3656
[Abstract]
[Full Text]
-
Ablordey, A., Swings, J., Hubans, C., Chemlal, K., Locht, C., Portaels, F., Supply, P.
(2005). Multilocus Variable-Number Tandem Repeat Typing of Mycobacterium ulcerans. J. Clin. Microbiol.
43: 1546-1551
[Abstract]
[Full Text]
-
Stragier, P., Ablordey, A., Meyers, W. M., Portaels, F.
(2005). Genotyping Mycobacterium ulcerans and Mycobacterium marinum by Using Mycobacterial Interspersed Repetitive Units. J. Bacteriol.
187: 1639-1647
[Abstract]
[Full Text]
-
Stinear, T. P., Hong, H., Frigui, W., Pryor, M. J., Brosch, R., Garnier, T., Leadlay, P. F., Cole, S. T.
(2005). Common Evolutionary Origin for the Unstable Virulence Plasmid pMUM Found in Geographically Diverse Strains of Mycobacterium ulcerans. J. Bacteriol.
187: 1668-1676
[Abstract]
[Full Text]
-
Ballard, S. A., Grabsch, E. A., Johnson, P. D. R., Grayson, M. L.
(2005). Comparison of Three PCR Primer Sets for Identification of vanB Gene Carriage in Feces and Correlation with Carriage of Vancomycin-Resistant Enterococci: Interference by vanB-Containing Anaerobic Bacilli. Antimicrob. Agents Chemother.
49: 77-81
[Abstract]
[Full Text]
-
Ablordey, A., Kotlowski, R., Swings, J., Portaels, F.
(2005). PCR Amplification with Primers Based on IS2404 and GC-Rich Repeated Sequence Reveals Polymorphism in Mycobacterium ulcerans. J. Clin. Microbiol.
43: 448-451
[Abstract]
[Full Text]
-
McNabb, A., Eisler, D., Adie, K., Amos, M., Rodrigues, M., Stephens, G., Black, W. A., Isaac-Renton, J.
(2004). Assessment of Partial Sequencing of the 65-Kilodalton Heat Shock Protein Gene (hsp65) for Routine Identification of Mycobacterium Species Isolated from Clinical Sources. J. Clin. Microbiol.
42: 3000-3011
[Abstract]
[Full Text]
-
Marsollier, L., Stinear, T., Aubry, J., Saint Andre, J. P., Robert, R., Legras, P., Manceau, A.-L., Audrain, C., Bourdon, S., Kouakou, H., Carbonnelle, B.
(2004). Aquatic Plants Stimulate the Growth of and Biofilm Formation by Mycobacterium ulcerans in Axenic Culture and Harbor These Bacteria in the Environment. Appl. Environ. Microbiol.
70: 1097-1103
[Abstract]
[Full Text]
-
Daniel, A. K., Lee, R. E., Portaels, F., Small, P. L. C.
(2004). Analysis of Mycobacterium Species for the Presence of a Macrolide Toxin, Mycolactone. Infect. Immun.
72: 123-132
[Abstract]
[Full Text]
-
Rondini, S., Mensah-Quainoo, E., Troll, H., Bodmer, T., Pluschke, G.
(2003). Development and Application of Real-Time PCR Assay for Quantification of Mycobacterium ulcerans DNA. J. Clin. Microbiol.
41: 4231-4237
[Abstract]
[Full Text]
-
Drancourt, M., Jarlier, V., Raoult, D.
(2002). The Environmental Pathogen Mycobacterium ulcerans Grows in Amphibian Cells at Low Temperatures. Appl. Environ. Microbiol.
68: 6403-6404
[Abstract]
[Full Text]
-
Marsollier, L., Robert, R., Aubry, J., Saint Andre, J.-P., Kouakou, H., Legras, P., Manceau, A.-L., Mahaza, C., Carbonnelle, B.
(2002). Aquatic Insects as a Vector for Mycobacterium ulcerans. Appl. Environ. Microbiol.
68: 4623-4628
[Abstract]
[Full Text]
-
Stinear, T. P., Jenkin, G. A., Johnson, P. D. R., Davies, J. K.
(2000). Comparative Genetic Analysis of Mycobacterium ulcerans and Mycobacterium marinum Reveals Evidence of Recent Divergence. J. Bacteriol.
182: 6322-6330
[Abstract]
[Full Text]