This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hudson, C. R.
Right arrow Articles by Maurer, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hudson, C. R.
Right arrow Articles by Maurer, J. J.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, May 2000, p. 1860-1865, Vol. 38, No. 5
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Genetic Relatedness of Salmonella Isolates from Nondomestic Birds in Southeastern United States

Charlene R. Hudson,1 Charlotte Quist,2 Margie D. Lee,3 Kathleen Keyes,3 Sara V. Dodson,1 Cesar Morales,1 Susan Sanchez,2 David G. White,4 and John J. Maurer1,*

Departments of Avian Medicine1 and Medical Microbiology and Parasitology3 and Athens Diagnostic Laboratory,2 College of Veterinary Medicine, The University of Georgia, Athens, Georgia 30602, and Center for Veterinary Medicine, The Food and Drug Administration, Laurel, Maryland 207084

Received 30 November 1999/Returned for modification 8 January 2000/Accepted 1 March 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Salmonella infections have been implicated in large-scale die-offs of wild birds in the United States. Although we know quite a bit about the epidemiology of Salmonella infection among domestic fowl, we know little about the incidence, epidemiology, and genetic relatedness of salmonellae in nondomestic birds. To gain further insight into salmonellae in these hosts, 22 Salmonella isolates from diseased nondomestic birds were screened for the presence of virulence and antibiotic resistance-associated genes and compared genetically using pulsed-field gel electrophoresis (PFGE) and random amplified polymorphic DNA analysis. Of the 22 Salmonella isolates examined, 15 were positive for the invasion gene invA and the virulence plasmid-associated genes spvC and pef. Most (15 of 22) were generally sensitive to antibiotics. However, two Salmonella isolates from pet birds were identified as Salmonella enterica serovar Typhimurium DT104. Despite the general susceptibility of these Salmonella isolates to most antimicrobial agents, antibiotic resistance-associated genes intI1, merA, and aadA1 were identified in a number of these isolates. Five distinct XbaI and nine distinct BlnI DNA patterns were observed for the 22 Salmonella isolates typed by PFGE. PFGE analysis determined that Salmonella isolates from passerines in Georgia and Wyoming were genetically related.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Salmonella spp. can infect and cause significant disease in free-ranging and captive birds. Most salmonellosis in free-ranging wild birds is documented via case reports and other clinical observations (12, 18, 34, 41), with outbreaks in wildlife birds occurring during the winter months. While many outbreaks are localized, several large-scale epizootics have occurred. Recently, a widespread epizootic of salmonellosis was reported during the winter of 1997 to 1998 in free-ranging birds across the northeastern and midwestern United States (National Wildlife Health Center, unpublished data). Hundreds of birds, mostly songbirds, were reported to have died in this epizootic, yet little is known about the Salmonella spp. found in these free-ranging species. Salmonella spp. have been isolated from numerous free-ranging avian species, including passerine (18, 23, 25, 34, 36, 37, 41, 44, 59), psittacine (43, 45, 46), and gallinaceous birds (16, 19, 26); free-ranging and captive waterfowl (13, 33, 44, 49, 53); and raptors (6, 27, 28). Cases of salmonellosis in free-ranging birds, particularly in passerines, have been reported in several countries (25, 35, 37) and several eastern and midwestern states in the United States (18, 24, 34, 41) since 1957, when this disease was first documented in wild birds (24). The most common Salmonella serotype encountered is Salmonella enterica serovar Typhimurium (18, 24, 25, 34, 41, 59), a broad-host-range serotype that is commonly associated with cases of human salmonellosis in the United States (9). The high incidence of S. enterica serovar Typhimurium among passerines (47, 58) and their subsequent congregation around bird feeders may offer some opportunity for the transmission of this organism to humans.

Over the last decade, the Southeastern Cooperative Wildlife Disease Study has performed 264 bacterial cultures on over 50 species of free-ranging birds that were submitted for necropsy through the Southeastern Cooperative Wildlife Disease Study diagnostic service. Eighteen Salmonella isolates were obtained from those 264 bacterial cultures, giving a prevalence of 6.8%. Fourteen of the 18 cases were diagnosed as clinical salmonellosis, suggesting that these birds were not unapparent carriers. Nine of those 18 isolates were preserved, allowing this retrospective comparison of the Salmonella isolates found in free-ranging birds. Necropsy of these wild birds revealed that lesions associated with salmonellosis in passerine birds were distinctly different from the disease observed in other free-ranging and captive nondomestic birds. Is the unique pathology associated with salmonellosis in passerine birds, like goldfinches, due to a single Salmonella clone, or is the disease syndrome a function of the host species? To address the former question, we typed Salmonella isolates by pulsed-field gel electrophoresis (PFGE) and random amplified polymorphic DNA (RAPD) analysis. We further characterized these isolates as to the distribution of virulence and antibiotic resistance-associated genes. In this report, we identify a single S. enterica serovar Typhimurium genetic type commonly associated with disease in passerine species. Also, we identify the first reported case of multiple-drug-resistant S. enterica serovar Typhimurium DT104 from two psittacine companion birds, indicating a potential disease risk for both bird owners and fanciers in the United States.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Bacterial isolates. All of the Salmonella isolates used in this study are listed in Table 1. S. enterica serovar Typhimurium SR11 and Escherichia coli HB101 were included in PCR and invasion assays as positive and negative controls.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Gross and histologic lesions associated with salmonellosis in nondomestic birds

Antimicrobial susceptibility determination. Antimicrobial MICs of E. coli isolates were determined via the Sensititre automated antimicrobial susceptibility system (Trek Diagnostic Systems, Westlake, Ohio) and interpreted according to the National Committee for Clinical Laboratory Standards guidelines for broth microdilution methods (39, 40). Sensititre susceptibility testing was performed in accordance with the manufacturer's instructions. The following antimicrobials were assayed: amikacin, amoxicillin-clavulanic acid, ampicillin, ceftiofur, cephalothin, chloramphenicol, ciprofloxacin, gentamicin, kanamycin, nalidixic acid, streptomycin, sulfamethoxazole, tetracycline, and trimethoprim-sulfamethoxazole.

RAPD analysis. Salmonella isolates were typed by RAPD analysis using primer 1254 (23). RAPD PCR was performed using the Rapidcycler hot-air thermocycler (Idaho Technologies, Idaho Falls, Idaho) (60). The RAPD conditions used were those of Maurer et al. (36). DNA was separated on 1.5% agarose and 1× TAE gel with ethidium bromide (0.2 µg/ml) at 100 V for 1 h (50). The 100-bp ladder (GIBCO/BRL, Gaithersburg, Md.) was used as a molecular weight standard for determining the molecular weights of the PCR products.

PFGE. Agarose-embedded bacterial genomic DNA was digested with 10 U of restriction enzyme XbaI overnight at 37°C, and DNA fragments were separated by PFGE (3, 49) in a 1% agarose gel (Bio-Rad, Hercules, Calif.) using the CHEF DR-II electrophoretic apparatus (Bio-Rad). Electrophoresis was done for 25 h with a voltage of 200 V and a linearly ramped pulse time of 2 to 40 s (3). A lambda ladder (582 to 48.5 kb; Bio-Rad) served as the MW markers for PFGE. The restriction enzyme XbaI has proven useful in the typing of Salmonella (2, 42) and other gram-negative bacteria (3) by PFGE. For isolates with indistinguishable XbaI PFGE DNA patterns, RAPD analysis (23) and a second PFGE using BlnI as the restriction enzyme (57) were done to confirm their genetic relatedness.

Identification of S. enterica serovar Typhimurium DT104 multidrug resistance locus by PCR mapping. Since florfenicol resistance gene flo has been mapped to a site between two type 1 integrons in S. enterica serovar Typhimurium DT104 (11), PCR primers were designed to amplify a portion of flo and antibiotic resistance genes mapping upstream (qacDelta E) and downstream (tetR) of this gene (GenBank accession no. AF071555). Primers flomap1F (GATGTCTAACAATTCGTTCAG) and flomap1R (CAACGTGAGTTGGATCATAG) anneal to positions 2751 of qacDE and 4609 of flo, respectively, to amplify a 1,858-bp DNA fragment. The second set of primers flomap2F (GGGATCGGCGAACTTTAC) and flomap2R (TGTGGTCGGTTCCGTTCTC), anneal at positions 5330 of flo and 6073 of tetR to produce a 744-bp amplicand by PCR. The PCRs were done using the Idaho Technologies Rapidcycler. The 10 PCR mixture consisted of 3 mM MgCl2 (flomap1 primers) or 2 mM MgCl2 (flomap2 primers), 50 mM Tris (pH 7.4), bovine serum albumin at 0.25 mg/ml, 0.1 mM primer, 0.2 mM deoxynucleoside triphosphates (Boehringer Mannheim; Indianapolis, Ind.), 0.5 U of Taq polymerase (Boehringer Mannheim), and 100 ng of the DNA template. The program parameters for the PCR using the flomap1 primers consisted of a hold at 94°C for 15 s; 30 cycles of 94°C for 15 s (denaturation), 40°C for 1 min (annealing), and 72°C for 1 min (extension) with a slope of 2; and a final extension at 72°C for 4 min. The PCR parameters for the flomap2 primers was 30 cycles of 94°C for 1 s (denaturation), 46°C for 1 s (annealing), and 72°C for 15 s at a slope of 2.

Detection of Salmonella virulence genes and antibiotic resistance-associated genes. Four different sets of primers for Salmonella virulence genes invA (54), spvC (54), sefC (7), and pef (7) were used to generate DNA probes by PCR as described by Dodson et al. (15). The conditions for Southern hybridization were followed as previously described (15, 50), with hybridization and washes carried out at 68°C. DNA probes for antibiotic resistance-associated genes intI1 (5, 29), aadA1 (5, 29), and merA (5, 32) were also generated by PCR. Conditions for PCR and Southern analysis were performed as described by Bass et al. (5).

Salmonella cell invasion assay. Budgie abdominal tumor cells (BATCs) were used in the invasion assays with the salmonellae. This is a permanent avian epithelial cell line derived from an abdominal tumor in a parakeet (22). Salmonella invasion was done by the procedure of Henderson et al. (22). The invasion results were reported as a ratio of the bacterial count that invaded the BATCs divided by the inoculum concentration. These values were then normalized such that the positive control, S. enterica serovar Typhimurium SR11, represented 100% invasion. All invasion levels greater than 1% were considered to be positive for invasion of BATCs (15).


    RESULTS AND DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

Clinical syndrome associated with Salmonella infection of nondomestic birds. Salmonella isolates from free-ranging birds were submitted from four southeastern states (Georgia, Florida, West Virginia, and Kentucky) and one western state (Wyoming). Five of the cases in wild birds were epizootics that resulted in morbidity and mortality of numerous birds. The four additional cases involving wild birds were individual animal submissions.

The lesions classically associated with salmonellosis in songbirds consist of necrotic plaques in the esophagus and crop (18, 25). In this study, this multifocal, necrotizing esophagitis and ingluvitis were only seen in passerine species (cowbirds, goldfinches, and English sparrows) (Fig. 1) and S. enterica serovar Typhimurium was isolated from the necrotic foci in all cases. Histologically, the epithelial surface was focally ulcerated, leaving a thick layer of necrotic cellular debris admixed with degenerate and intact leukocytes and myriads of gram-negative bacterial rods. The underlying submucosa had a focally intense infiltrate of heterophils and fewer lymphocytes and plasma cells. No evidence was found of other known pathogens, such as avian poxvirus, that can cause esophageal lesions in passerine species. Trichomonas gallinae, a flagellate protozoan that causes esophageal disease in columbiform species, such as mourning doves and, less commonly, predator birds, has not been reported in songbird species (9).


View larger version (114K):
[in this window]
[in a new window]
 
FIG. 1.   Gross pathology of an American cowbird that died of salmonellosis. The arrows delineate multiple necrotic plaques on the esophageal mucosa from which S. enterica serovar Typhimurium was isolated.

Among all of the examined bird species, the most consistent lesion reported at necropsy was emaciation but autolysis may have obscured subtle lesions in many of the cases (Table 1). Liver lesions, which were found grossly or histologically in 11 of the 22 cases, consisted of randomly scattered, small, pale foci that, histologically, were small foci of hepatocellular necrosis and inflammation. When present, lower gastrointestinal (GI) tract lesions consisted of acute hemorrhagic or necrotizing enteritis or enterocolitis. The caseous cecal plugs occasionally seen in domestic poultry were not found in these nondomestic birds. Other gross lesions less commonly encountered included small 1- to 2-mm caseous granulomas (found in the caudal airsacs of the quail and one cowbird). Other histologic lesions included orchitis and conjunctivitis (both diagnosed in cowbirds), meningitis (diagnosed in the pigeon), and septicemia (diagnosed in a cowbird, the African grey parrot, and the Senegal parrot).

GI lesions are common in the lower GI tract in poultry (20). However, the necrotic esophageal plaques seen in passerine birds have not been reported in domesticated gallinaceous birds. Disease was generally reported for adult birds, which contrasts with salmonellosis in domestic poultry where illness is generally observed in younger (1- to 7-day-old) birds (20). The Salmonella isolates from these diseased birds were genetically typed to determine if there was a pathogenic clone associated with this illness in passerine birds.

Genetic diversity among Salmonella strains associated with nondomestic birds. Five distinct XbaI DNA patterns were observed for the 23 Salmonella isolates typed by PFGE (Table 2). Isolates with seven or more different DNA fragments were assigned to a specific PFGE XbaI genetic type, A to E, as recommended by Tenover et al. (55). The majority (70%) of these Salmonella isolates belonged to PFGE XbaI genetic type A. Within this PFGE group, there were additional differences of four to six DNA fragments within PFGE pattern A to further differentiate these related Salmonella isolates into three subgroupings, A1 to A3. A group of closely related isolates were identified that differed by only two or three DNA fragments to justify a final subcategory, A1A-B. Using a second restriction enzyme, BlnI, we were able to distinguish among Salmonella isolates by PFGE that produced similar or identical PFGE patterns, earlier, with XbaI (Table 2). PFGE using both restriction enzymes XbaI and BlnI identified nine distinct genetic types among Salmonella isolates from nondomestic birds. However, half of these isolates appeared to be possibly related, according to their PFGE pattern. Five distinct genetic types were identified among the Salmonella isolates from Georgia. Four of these five Salmonella genetic types were found only in that state. Likewise, other Salmonella genetic types, as defined by PFGE, appeared to be unique to other locales from which these specimens were obtained. Certain Salmonella genetic types therefore appear to be endemic.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Salmonella isolates used in this study

There are other genetic types, however, that do not appear to be geographically restricted. For example, closely related Salmonella genetic types were identified by PFGE among isolates obtained from Georgia and Wyoming. We were unable to definitively separate Salmonella isolates A7582, 98A-24966-2, and 98-28238 further using another molecular typing tool, RAPD PCR (Table 2). These genetically related salmonellae were all isolated from passerines.

We also noted that Salmonella isolates from the Lorikeet and Senegal parrot were indistinguishable by their PFGE and RAPD patterns as well. Both birds were from the same pet owner. Since Salmonella isolates from the lorikeet and the Senegal parrot had a pentadrug resistance pattern similar to that of S. enterica serovar Typhimurium DT104 (21), we compared their PFGE patterns. S. enterica serovar Typhimurium DT104 isolates are genetically related, producing PFGE patterns that are indistinguishable (1). We noted that our Salmonella isolates had PFGE patterns indistinguishable from the DNA fingerprint of S. enterica serovar Typhimurium DT104 (data not shown). In addition to similarities in PFGE patterns, these Salmonella isolates were similar to S. enterica serovar Typhimurium DT104 with regard to the genetic organization of the multidrug resistance locus (11). The Salmonella isolates from the lorikeet and the Senegal parrot had the florfenicol resistance gene flo, a marker for multidrug-resistant S. enterica serovar Typhimurium DT104 (10). In these isolates, the florfenicol resistance gene flo is flanked by quaternary ammonium resistance gene qacDelta E and tetracycline resistance gene tetR. PCR analysis revealed that the psittacine Salmonella isolates had an arrangement of antibiotic resistance genes similar to that of the S. enterica serovar Typhimurium DT104 multidrug resistance locus. Phage typing confirmed that these isolates were S. enterica serovar Typhimurium DT104.

Antimicrobial susceptibility and drug resistance genes present in Salmonella isolates from nondomestic birds. Most of the Salmonella isolates from nondomestic birds (15 of 22) in this study were sensitive to 16 antibiotics. All of the isolates, including multidrug-resistant Salmonella isolates 98A-3397, 98-3398, 97-9746, and 98A-9551, were sensitive to amikacin, apramycin, ceftiofur, ceftriaxone, cephalothin, ciprofloxacin, gentamicin, nalidixic acid, and trimethoprim. Seven of the 22 Salmonella isolates were resistant to sulfamethoxazole (MIC, >512 µg/ml), and of the seven sulfamethoxazole-resistant Salmonella isolates, four were also resistant to streptomycin (MICs, 64 to >256 µg/ml). We also observed resistance to other drugs, including ampicillin (MIC, >32 µg/ml), tetracycline (MIC, >= 32 µg/ml), chloramphenicol (MIC, >32 µg/ml), and kanamycin (MIC, >64 µg/ml). With one exception, Salmonella isolates from passerine birds were sensitive to antibiotics while those from quail and psittacines were resistant to one or more antibiotics. The drug resistance patterns and percentages were clearly different in Salmonella isolates cultured from nondomestic birds compared to those from poultry (38). In addition to being resistant to sulfamethoxazole and streptomycin, the poultry Salmonella isolates are also resistant to tetracyclines and gentamicin (38).

Rapid dissemination of drug resistance is often attributed to integrons, genetic elements involved in swapping or combining of antibiotic resistance into the integration site (52). Class 1 integrons, and resistance genes associated with them, are widely distributed in nature. In our analysis of Salmonella isolates from nondomestic birds, 9 of the 22 isolates contained the integrase, intI1, gene, a marker for class 1 integrons (Table 3). In addition to intI1, Salmonella isolates also contained other markers associated with class 1 integrons, including the streptomycin-spectinomycin resistance gene aadA1 and the mercuric reductase gene merA (31), but at a lower frequency than intI1. Twelve of the 22 Salmonella isolates did not have intI1 or the other antibiotic resistance-associated genes, aadA1 and merA.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Salmonella genotypes

Virulence potential of Salmonella isolates from nondomestic birds. Salmonella pathogenesis is dictated by a series of genes responsible for colonization (56), invasion (48), and spread (4, 30) within its avian host. Host adaptation is influenced by the distribution of fimbrial and nonfimbrial adhesins among the salmonellae (7). To assess potential virulence of Salmonella isolates by the presence or absence of genes, PCR and Southern hybridization were used to detect Salmonella virulence genes. All of the Salmonella isolates contained the invasion gene invA. Most of the Salmonella isolates (17 of 22) from diseased nondomestic birds also contained the virulence plasmid, as is evident from the incidence of spvC among these isolates (Table 3). Of the 17 Salmonella isolates positive for spvC, 15 also contained the Salmonella plasmid-encoded fimbrial gene pef (7). pef appears to be restricted in its distribution to a few Salmonella serotypes, Typhimurium, Paratyphi, Choleraesuis, and Typhi (7). All of the Salmonella isolates were negative for sefC (data not shown), a fimbrial gene found primarily in the avian-adapted salmonellae, S. enterica subsp. enteritidis, S. enterica subsp. pullorum, and S. enterica subsp. gallinarum (7, 14, 15). The S. enterica serovar Typhimurium isolates from free-ranging birds do not appear to be any different from the broad-host-range S. enterica serovar Typhimurium strains associated with other avian and mammalian hosts with regard to the distribution of adhesion (7) and invasion (54) genes.

We also examined these Salmonella isolates for phenotypic differences in the ability to invade epithelial cells. All of the Salmonella isolates were considered to be invasive for avian epithelial cells, with levels ranging from 8 to 175% invasion compared to the control, S. enterica serovar Typhimurium SR11 (Table 2). These Salmonella isolates were more efficient at invading avian epithelial cells than avian host-specific S. enterica subsp. pullorum (15). Variability in the invasion phenotype did not correlate with a specific genetic type, as defined by PFGE pattern, or virulence genotype.

According to genotype and antibiotic resistance pattern, the Salmonella strains associated with captive and free-ranging nondomestic birds represent a potential threat to humans. Most of the Salmonella isolates possessed the 90-kb virulence plasmid, enabling the organisms to colonize and spread in an avian or nonavian host. The other troubling news is the identification of multidrug-resistant S. enterica serovar Typhimurium DT104 from pet birds. As far as we are aware, this is the first reported case of Salmonella DT104 from exotic birds in the United States. Nondomestic birds can obviously serve as a reservoir for transmission of salmonellae to pet owners and bird watchers. Bird feeders are popular in the United States, and determining the incidence of salmonellae at these feeders is important in order to assess their health risk to the general population.


    ACKNOWLEDGMENTS

This research was funded by a grant from the U.S. Poultry and Egg Association, the State of Georgia's Veterinary Medicine Agricultural Research Grant, and USDA Formula Funds.

We thank Stanley Vezey and Susan Little for their comments and critique of the manuscript. We also thank Sherry Ayers for her technical assistance. Thanks to Elizabeth Williams of the Wyoming State Veterinary Diagnostic Laboratory for providing the four western Salmonella isolates.


    FOOTNOTES

* Corresponding author. Mailing address: The Department of Avian Medicine, The University of Georgia, 953 College Station Rd., Athens, GA 30602. Phone: (706) 542-5071. Fax: (706) 542-5630. E-mail: jmaurer{at}calc.vet.uga.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results and Discussion
References

1. Baggesen, D. L., and F. M. Aarestrup. 1998. Characterization of recently emerged multiple antibiotic-resistant Salmonella enterica serovar Typhimurium DT104 and other multiresistant phage types from Danish pig herds. Vet. Rec. 143:95-97[Abstract/Free Full Text].
2. Baquar, N., A. Burnens, and J. Stanley. 1994. Comparative evaluation of molecular typing of strains from a national epidemic due to Salmonella brandenburg by rRNA gene and IS200 probes and pulsed-field gel electrophoresis. J. Clin. Microbiol. 32:1876-1880[Abstract/Free Full Text].
3. Barrett, T. J., H. Lior, J. H. Green, R. Khakhria, J. G. Wells, B. P. Bell, K. D. Greene, J. Lewis, and P. M. Griffin. 1994. Laboratory investigation of a multistate food-borne outbreak of Escherichia coli O157:H7 by using pulsed-field gel electrophoresis and phage typing. J. Clin. Microbiol. 32:3013-3017[Abstract/Free Full Text].
4. Barrow, P. A., and M. A. Lovell. 1988. The association between a large molecular mass plasmid and virulence in a strain of Salmonella pullorum. J. Gen. Microbiol. 134:2307-2316[Abstract/Free Full Text].
5. Bass, L., C. A. Liebert, M. D. Lee, A. O. Summers, D. G. White, S. G. Thayer, and J. J. Maurer. 1999. The incidence and characterization of integrons, genetic elements mediating multiple drug resistance, in avian Escherichia coli. Antimicrob. Agents Chemother. 43:2925-2929[Abstract/Free Full Text].
6. Battisti, A., G. Di Guardo, U. Agrimi, and A. I. Bozzano. 1998. Embryonic and neonatal mortality from salmonellosis in captive bred raptors. J. Wildl. Dis. 34:64-72[Abstract].
7. Baumler, A., J. Gilde, R. M. Tsolis, A. W. M. van der Velden, B. M. M. Ahmer, and F. Heffron. 1997. Contribution of horizontal gene transfer and deletion events to development of distinctive patterns of fimbrial operons during evolution of Salmonella serotypes. J. Bacteriol. 179:317-322[Abstract/Free Full Text].
8. Bean, N. H., and M. E. Potter. 1992. Salmonella serotypes from human sources, January 1991 through December 1991, p. 488-491. In Proceedings of the 96th Annual Meeting of the U.S. Animal Health Association. U.S. Animal Health Association, Richmond, Va.
9. Boal, C. W., R. W. Mannan, and K. Hudelson. 1998. Trichomoniasis in Cooper's hawks from Arizona. J. Wildl. Dis. 34:590-593[Abstract].
10. Bolton, L. F., L. C. Kelley, M. D. Lee, P. J. Fedorka-Cray, and J. J. Maurer. 1999. Detection of multidrug-resistant Salmonella enterica serotype typhimurium DT104 based on a gene which confers cross-resistance to florfenicol and chloramphenicol. J. Clin. Microbiol. 37:1348-1351[Abstract/Free Full Text].
11. Briggs, C. E., and P. M. Fratamico. 1999. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob. Agents Chemother. 43:846-849[Abstract/Free Full Text].
12. Brittingham, M. C., and S. A. Temple. 1986. A survey of avian mortality at winter feeders. Widl. Soc. Bull. 14:445-450.
13. Cizek, A., I. Literak, K. Hejlicek, F. Treml, and J. Smola. 1994. Salmonella contamination of the environment and its incidence in wild birds. Zentbl. Veterinaermed. (B) 41:320-327.
14. Clouthier, S. C., K. H. Muller, J. L. Doran, S. K. Collison, and W. W. Kay. 1993. Characterization of three fimbrial genes, sefABC, of Salmonella enteriditis. J. Bacteriol. 174:2523-2533.
15. Dodson, S. V., J. J. Maurer, P. S. Holt, and M. D. Lee. 1999. Temporal changes in the population genetics of Salmonella pullorum. Avian Dis. 43:685-695[CrossRef][Medline].
16. Faddoul, G. P., and G. W. Fellows. 1966. A five-year survey of the incidence of salmonellae in avian species. Avian Dis. 10:296-304[CrossRef].
17. Faddoul, G. P., G. W. Fellows, and J. Baird. 1966. A survey on the incidence of salmonellae in wild birds. Avian Dis. 10:89-94.
18. Fichtel, C. C. 1978. A Salmonella outbreak in wild songbirds. N. Am. Bird Bander 3:146-148.
19. Francis, D. W., H. Campbell, and G. R. Newton. 1963. A study of a Salmonella infection in a flock of chukar partridges. Avian Dis. 7:501-507[CrossRef][Medline].
20. Gast, R. K. 1997. Salmonella infections, p. 81-122. In B. W. Calnek (ed.), Diseases of poultry, 10th ed. Iowa State University Press, Ames.
21. Glynn, M. K., C. Bopp, W. Dewitt, P. Dabney, M. Mokhtar, and F. J. Angulo. 1998. Emergence of multidrug-resistant Salmonella enterica serotype typhimurium DT104 infections in the United States. N. Engl. J. Med. 19:1333-1338.
22. Henderson, S. C., D. I. Bounous, and M. D. Lee. 1999. Salmonella pullorum demonstrates tropism for the bursa of Fabricius of chicks representing avian enteric fever. Infect. Immun. 67:3580-3586[Abstract/Free Full Text].
23. Hilton, A. C., J. G. Banks, and C. W. Penn. 1997. Optimization of RAPD for fingerprinting Salmonella. Lett. Appl. Microbiol. 24:243-248[CrossRef][Medline].
24. Hudson, C. B., and D. C. Tudor. 1957. Salmonella typhimurium infection in feral birds. Cornell Vet. 47:394-395[Medline].
25. Hurvell, B., K. Borg, A. Gunnarsson, and J. Jevring. 1974. Studies on Salmonella typhimurium infections in passerine birds in Sweden. Int. Congr. Game Biol. 11:493-497.
26. Ishiguro, N., and G. Sato. 1981. Biotyping of Salmonella typhimurium strains isolated from animals and birds in northern Japan. Am. J. Vet. Res. 42:896-897[Medline].
27. Kirkpatrick, C. E., and B. A. Colvin. 1986. Salmonella spp. in nestling common barn-owls (Tyto alba) from southwestern New Jersey. J. Wildl. Dis. 22:340-343[Abstract].
28. Kirkpatrick, C. E., and V. P. Trexler-Myren. 1986. A survey of free-living falconiform birds for Salmonella. J. Am. Vet. Med. Assoc. 189:997-998[Medline].
29. Levesque, C., and P. H. Roy. 1993. PCR analysis of integrons, p. 590-594. In D. H. Persing, T. F. Smith, F. C. Tenover, and T. J. White (ed.), Diagnostic molecular microbiology: principles and applications. ASM Press, Washington, D.C.
30. Libby, S. J., L. G. Adams, T. A. Ficht, C. Allen, H. A. Whitford, A. A. Buchmeir, A. Bossie, and D. G. Guiney. 1997. The spv genes on the Salmonella dublin virulence plasmid are required for severe enteritis and systemic infection in the natural host. Infect. Immun. 65:1786-1792[Abstract].
31. Liebert, C. A., R. M. Hall, and A. O. Summers. 1999. Transposon Tn21, flagship of the floating genome. Microbiol. Mol. Biol. Rev. 63:507-522[Abstract/Free Full Text].
32. Liebert, C. A., J. Wireman, T. Smith, and A. O. Summers. 1997. Phylogeny of mercury resistance (mer) operons of gram-negative bacteria isolated from the fecal flora of primates. Appl. Environ. Microbiol. 63:1066-1076[Abstract].
33. Locke, L. N., H. M. Ohlendork, R. B. Shillinger, and T. Jareed. 1974. Salmonellosis in a captive heron colony. J. Wildl. Dis. 10:143-145[Abstract/Free Full Text].
34. Locke, L. N., R. B. Shillinger, and T. Jareed. 1973. Salmonellosis in passerine birds in Maryland and West Virginia. J. Wildl. Dis. 9:144-145[Abstract/Free Full Text].
35. MacDonald, J. W., and L. W. Cornelius. 1969. Salmonellosis in wild birds. Br. Birds 62:28-30.
36. Maurer, J. J., M. D. Lee, C. Lobsinger, T. Brown, M. Maier, and S. G. Thayer. 1998. Molecular typing of avian Escherichia coli isolates by random amplification of polymorphic DNA. Avian Dis. 42:431-451[CrossRef][Medline].
37. Mikaelian, I., D. Daignault, M. Duval, and D. Martineau. 1997. Salmonella infection in wild birds from Quebec. Can. Vet. J. 38:385[Medline].
38. National Antimicrobial Susceptibility Monitoring Systems. 1997. Enteric bacteria. Centers for Disease Control, Atlanta, Ga.
39. National Committee for Clinical Laboratory Standards. 1997. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically---fourth edition; approved standard (NCCLS document M7-A4). National Committee for Clinical Laboratory Standards, Villanova, Pa.
40. National Committee for Clinical Laboratory Standards. 1999. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved standard (NCCLS document M31-A). National Committee for Clinical Laboratory Standards, Villanova, Pa.
41. Nesbitt, S. A., and F. H. White. 1974. A Salmonella typhimurium outbreak at a bird feeding station. Fla. Field Nat. 2:46-47.
42. Olsen, J. E., M. N. Skov, O. Angen, E. J. Threlfall, and M. Bisgaard. 1997. Genomic relationships between selected phage types of Salmonella enterica subsp. enterica serotype typhimurium defined by ribotyping, IS200 typing and PFGE. Microbiology 143:1471-1479[Abstract/Free Full Text].
43. Orosz, S. E., M. M. Chengappa, R. A. Oyster, P. J. Morris, S. Trock, and S. Altekruse. 1992. Salmonella enteritidis infection in two species of psittaciformes. Avian Dis. 36:766-769[CrossRef][Medline].
44. Palmgren, H., M. Sellin, S. Bergstrom, and B. Olsen. 1997. Enteropathogenic bacteria in migrating birds arriving in Sweden. Scand. J. Infect. Dis. 29:565-568[Medline].
45. Panigraphy, B., J. E. Grimes, M. I. Rideout, R. B. Simpson, and L. C. Grumbles. 1979. Zoonotic diseases in psittacine birds: apparent increased occurrence of chlamydiosis (psittacosis), salmonellosis, and giardiasis. J. Am. Vet. Med. Assoc. 175:359-361[Medline].
46. Panigraphy, B., and W. C. Gilmore. 1983. Systemic salmonellosis in an African gray parrot and Salmonella osteomyelitis in canaries. J. Am. Vet. Med. Assoc. 183:699-700[Medline].
47. Pinowska, B., G. Chylinski, and B. Gondek. 1976. Studies on the transmitting of salmonellae by house sparrows (Passer domesticus L.) in the region of Zulawy. Pol. Ecol. Stud. 2:113-121.
48. Porter, S. B., and R. Curtiss, III. 1997. Effect of inv mutations on Salmonella virulence and colonization in 1-day-old white Leghorn chicks. Avian Dis. 41:45-57[CrossRef][Medline].
49. Quessy, S., and S. Messier. 1992. Prevalence of Salmonella spp., Campylobacter spp., and Listeria spp. in ring-billed gulls (Larus delawarensis). J. Wildl. Dis. 28:526-531[Abstract].
50. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
51. Schwartz, D. C., and C. R. Cantor. 1984. Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37:67-75[CrossRef][Medline].
52. Stokes, H. W., and R. M. Hall. 1989. A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol. Microbiol. 3:1669-1683[Medline].
53. Stroud, R. K., C. O. Thoen, and R. M. Duncan. 1986. Avian tuberculosis and salmonellosis in a whooping crane. J. Wildl. Dis. 22:106-110[Medline].
54. Swamy, S. C., H. M. Barnhart, M. D. Lee, and D. W. Dreesen. 1996. Virulence determinants invA and spvC in salmonellae isolated from poultry products, wastewater, and human sources. Appl. Environ. Microbiol. 62:3768-3771[Abstract].
55. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239[Medline].
56. Thiagarajan, D., M. Saeed, J. Turek, and E. Asem. 1996. In vitro attachment and invasion of chicken ovarian granulosa cells by Salmonella enteritidis phage type 8. Infect. Immun. 64:5015-5021[Abstract].
57. Thong, K., Y. Ngeow, M. Altwegg, P. Navaratnam, and T. Pang. 1995. Molecular analysis of Salmonella enteritidis by pulsed-field gel electrophoresis and ribotyping. J. Clin. Microbiol. 33:1070-1074[Abstract].
58. Tizard, I. R., N. A. Fish, and J. Harmeson. 1979. Free flying sparrows as carriers of salmonellosis. Can. Vet. J. 20:143-144[Medline].
59. Wilson, J. E., and J. W. MacDonald. 1967. Salmonella infection in wild birds. Br. Vet. J. 123:212-219[Medline].
60. Wittwer, C. T., G. C. Fillmore, and D. R. Hillyard. 1989. Automated polymerase chain reaction capillary tubes with hot air. Nucleic Acids Res. 17:4353-4357[Abstract/Free Full Text].


Journal of Clinical Microbiology, May 2000, p. 1860-1865, Vol. 38, No. 5
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Lu, J., Santo Domingo, J. W., Hill, S., Edge, T. A. (2009). Microbial Diversity and Host-Specific Sequences of Canada Goose Feces. Appl. Environ. Microbiol. 75: 5919-5926 [Abstract] [Full Text]  
  • Kozak, G. K., Boerlin, P., Janecko, N., Reid-Smith, R. J., Jardine, C. (2009). Antimicrobial Resistance in Escherichia coli Isolates from Swine and Wild Small Mammals in the Proximity of Swine Farms and in Natural Environments in Ontario, Canada. Appl. Environ. Microbiol. 75: 559-566 [Abstract] [Full Text]  
  • Hall, A. J., Saito, E. K. (2008). AVIAN WILDLIFE MORTALITY EVENTS DUE TO SALMONELLOSIS IN THE UNITED STATES, 1985-2004. J Wildl Dis 44: 585-593 [Abstract] [Full Text]  
  • Allgayer, M. C., Lima-Rosa, C. A. V., Weimer, T. A., Rodenbusch, C. R., Pereira, R. A., Streck, A. F., Oliveira, S. D., Canal, C. W. (2008). Molecular diagnosis of Salmonella species in captive psittacine birds. Vet Rec. 162: 816-819 [Abstract] [Full Text]  
  • Kocabiyik, A. L., Cangul, I. T., Alasonyalilar, A., Dedicova, D., Karpiskova, R. (2006). Isolation of Salmonella Enteritidis Phage Type 21b from a Eurasian Eagle-Owl (Bubo bubo).. J Wildl Dis 42: 696-698 [Abstract] [Full Text]  
  • Betancor, L., Schelotto, F., Martinez, A., Pereira, M., Algorta, G., Rodriguez, M. A., Vignoli, R., Chabalgoity, J. A. (2004). Random Amplified Polymorphic DNA and Phenotyping Analysis of Salmonella enterica Serovar Enteritidis Isolates Collected from Humans and Poultry in Uruguay from 1995 to 2002. J. Clin. Microbiol. 42: 1155-1162 [Abstract] [Full Text]  
  • Reed, K. D., Meece, J. K., Henkel, J. S., Shukla, S. K. (2003). Birds, Migration and Emerging Zoonoses: West Nile Virus, Lyme Disease, Influenza A and Enteropathogens. Clin Med Res 1: 5-12 [Abstract] [Full Text]  
  • Sanchez, S., McCrackin Stevenson, M. A., Hudson, C. R., Maier, M., Buffington, T., Dam, Q., Maurer, J. J. (2002). Characterization of Multidrug-Resistant Escherichia coli Isolates Associated with Nosocomial Infections in Dogs. J. Clin. Microbiol. 40: 3586-3595 [Abstract] [Full Text]  
  • Goldstein, C., Lee, M. D., Sanchez, S., Hudson, C., Phillips, B., Register, B., Grady, M., Liebert, C., Summers, A. O., White, D. G., Maurer, J. J. (2001). Incidence of Class 1 and 2 Integrases in Clinical and Commensal Bacteria from Livestock, Companion Animals, and Exotics. Antimicrob. Agents Chemother. 45: 723-726 [Abstract] [Full Text]  
  • White, D. G., Hudson, C., Maurer, J. J., Ayers, S., Zhao, S., Lee, M. D., Bolton, L., Foley, T., Sherwood, J. (2000). Characterization of Chloramphenicol and Florfenicol Resistance in Escherichia coli Associated with Bovine Diarrhea. J. Clin. Microbiol. 38: 4593-4598 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hudson, C. R.
Right arrow Articles by Maurer, J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hudson, C. R.
Right arrow Articles by Maurer, J. J.