This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leung, W. K.
Right arrow Articles by Samaranayake, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leung, W. K.
Right arrow Articles by Samaranayake, L. P.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, June 2000, p. 2219-2226, Vol. 38, No. 6
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.

Oral Colonization, Phenotypic, and Genotypic Profiles of Candida Species in Irradiated, Dentate, Xerostomic Nasopharyngeal Carcinoma Survivors

W. Keung Leung,1,* Ranil S. Dassanayake,1 Joyce Y. Y. Yau,1 Li Jian Jin,1 Wing Cheong Yam,2 and Lakshman P. Samaranayake1

Faculty of Dentistry1 and Department of Microbiology, Faculty of Medicine,2 The University of Hong Kong, Hong Kong SAR, China

Received 22 December 1999/Returned for modification 26 January 2000/Accepted 6 April 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The aim of this study was to investigate oral yeast colonization and oral yeast strain diversity in irradiated (head and neck), dentate, xerostomic individuals. Subjects were recruited from a nasopharyngeal carcinoma clinic and were segregated into group A (age, <60 years [n = 25; average age ± standard deviation {SD}, 48 ± 6 years; average postirradiation time ± SD, 5 ± 5 years]) and group B (age, >= 60 years [n = 8; average age ± SD, 67 ± 4 years; average postirradiation time ± SD, 2 ± 2 years]) and were compared with age- and sex-matched healthy individuals in group C (age, <60 years [n = 20; average age ± SD, 44 ± 12 years] and group D (age, >= 60 years [n = 10; average age, 70 ± 3 years]). Selective culture of oral rinse samples was carried out to isolate, quantify, and speciate yeast recovery. All test subjects underwent a 3-month comprehensive oral and preventive care regimen plus topical antifungal therapy, if indicated. A total of 12 subjects from group A and 5 subjects from group B were recalled for reassessment of yeast colonization. Sequential (pre- and posttherapy) Candida isolate pairs from patients were phenotypically (all isolate pairs; biotyping and resistotyping profiles) and genotypically (Candida albicans isolate pairs only; electrophoretic karyotyping by pulsed-field gel electrophoresis, restriction fragment length polymorphism [RFLP], and randomly amplified polymorphic DNA [RAPD] assays) evaluated. All isolates were Candida species. Irradiated individuals were found to have a significantly increased yeast carriage compared with the controls. The isolation rate of Candida posttherapy remained unchanged. A total of 9 of the 12 subjects in group A and 3 of the 5 subjects in group B harbored the same C. albicans or Candida tropicalis phenotype at recall. Varying degrees of congruence in the molecular profiles were observed when these sequential isolate pairs of C. albicans were analyzed by RFLP and RAPD assays. Variations in the genotype were complementary to those in the phenotypic characteristics for some isolates. In conclusion, irradiation-induced xerostomia seems to favor intraoral colonization of Candida species, particularly C. albicans, which appeared to undergo temporal modifications in clonal profiles both phenotypically and genotypically following hygienic and preventive oral care which included topical antifungal therapy, if indicated. We postulate that the observed ability of Candida species to undergo genetic and phenotypic adaptation could strategically enhance its survival in the human oral cavity, particularly when salivary defenses are impaired.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Nasopharyngeal carcinoma (NPC) is prevalent among people living in southern China. For instance, in Hong Kong, the age-standardized incidence rates of NPC are 23 and 9 per 100,000 for males and females, respectively (13). Radiotherapy is the treatment of choice for this condition, as surgical resection of the lesion is rarely possible. Such irradiation, however, inevitably involves oral and facial structures, including the major salivary glands, that cross the irradiation path. One major sequel of radiotherapy is prolonged xerostomia (7). Human saliva helps regulate oral health by its moisturizing, lubricating, buffering, and antimicrobial properties (43), and qualitative and quantitative changes in saliva inevitably affect oropharyngeal physiology, defense, and microbial ecology (5, 37).

Oral candidiasis is one of the most common fungal infections of man and is manifested in a variety of clinical presentations. Candida albicans is the main Candida species residing in the oral cavity and is responsible for the majority of such infections, although non-C. albicans species are sometimes implicated (30). The former opportunistic, dimorphic fungus is notable for causing local or systemic infections in an ever-increasing number of medically compromised individuals (2, 30). These include individuals undergoing chemotherapy, immunosuppressive treatment, or long-term broad-spectrum antibiotic therapy; patients with human immunodeficiency virus infection or advanced neoplasms; and organ transplant recipients. Being opportunistic pathogens, Candida species flourish and cause a spectrum of diseases in these individuals (2, 29), especially when immunological defenses are impeded (12).

Oral candidiasis is common in individuals with head, neck, and other malignancies, especially when radiotherapy is used as the mainstay of treatment (8, 28, 37). It is thought that irradiation-induced histologic changes leading to oral mucositis, together with quantitative and qualitative changes in saliva and salivary flow, facilitate yeast infection (9). In a very recent study which monitored the weekly oral yeast carriage in 30 patients with head and neck cancers undergoing irradiation therapy, Redding and coworkers (28) noted oral Candida carriage in 73% of patients on at least one visit and when those positive for Candida were recalled, the researchers noted oral Candida carriage at 51% of the recall visits (28). Further, they reported that almost identical Candida strains consistently colonized the oral cavity despite the use of antifungals by 27% of the study population. However, there are others who were unable to note any discernible differences in oral yeast colonization in control and test subjects after radiation therapy (38). Possible reasons for such discrepant results may be the intrinsic differences in the study populations and the irradiation protocols used (8, 9, 28, 38).

The aims of the present study, therefore, were to investigate the oral colonization profile of yeasts (i) in a homogenous cohort with a history of NPC managed using a similar irradiation protocol, at least 6 months following irradiation therapy, and (ii) before and after professional oral hygienic care either with or without antifungal therapy. In addition, the phenotypic and genotypic characteristics of sequential yeast isolates from a subgroup of studied individuals were monitored to explore the degree of similarity between isolates.


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Study group. A total of 33 patients who survived NPC (confirmed by two consecutive negative biopsies 10 weeks apart starting at week 8 postirradiation) 6 or more months posttreatment were recruited from the Department of Clinical Oncology, Queen Mary Hospital, the University of Hong Kong (34). All subjects underwent almost identical radiotherapy protocols, and the total irradiation dose received was similar (34). The irradiated subjects were divided into two cohorts according to age (group A [<60 years] and group B [>= 60 years]), with reference to a previous study design (14, 16). Age- and sex-matched nonirradiated individuals were selected for the control groups, as follows: 20 subjects younger than 60 years old were randomly selected from the Outpatient Dental Clinic, Faculty of Dentistry, the University of Hong Kong (group C) and 10 healthy males 60 years of age or older were randomly selected from more than 100 attendees at a local senior community center (group D).

Clinical examination, treatment, and recall. At baseline, a comprehensive clinical examination was carried out for all subjects. The detailed data from this examination, including the plaque index (35) and gingival index (17), which are indicators of personal oral hygiene, have been reported elsewhere (34). All subjects in groups A and B were given comprehensive oral health care which included oral hygiene education, daily home fluoride gel application, scaling and polishing of the teeth, restoration of carious lesions, and topical antifungal therapy for those with clinically evident oral candidiasis; jaw muscle exercises were prescribed for subjects with trismus. Three months after completion of this comprehensive oral care regime, all subjects in groups A and B were invited for a review of their oral cleanliness and to repeat the oral rinse sampling (see below).

Sampling. To evaluate yeast carriage, oral rinse samples were obtained as described by Samaranayake et al. (31), with slight modifications. In brief, the subjects were asked to rinse their mouth for 60 s with 10 ml of sterile 0.01 M phosphate-buffered saline, pH 7.2. Denture-wearing subjects did not remove their prostheses. After 60 s the subjects expectorated the oral rinse into a sterile universal container, which was then immediately transported to the laboratory for processing.

Culture and identification of isolates. All samples from groups C and D were centrifuged at 1,700 × g for 10 min. The pellet was resuspended in 2.5 ml of phosphate-buffered saline, pH 7.2, and vortexed at the maximum setting for 30 s (Autovortex Mixer SA2; Stuart Scientific, London, United Kingdom). Samples from groups A and B were used neat, as a pilot study indicated very high numbers of yeast in the oral rinse samples, rendering the concentration step unnecessary (data not shown). Volumes (50 µl) of each of the unconcentrated (groups A and B) and the resuspended (groups C and D) oral rinses were spiral plated (model DU; Spiral Systems Inc., Cincinnati, Ohio) onto duplicate Sabouraud's dextrose agar (Oxoid, Hampshire, United Kingdom) and incubated for 18 h at 37°C. The number of CFU for each sample was quantified, and five colonies per sample were randomly selected and subcultured to obtain a pure growth (in specimens with five or fewer colonies, all CFU were subcultured).

The organisms were identified and speciated based on the following: colony morphology, cell morphology, gram staining reaction, and germ tube test (18); API 20C AUX and API ZYM tests (Analytical Profile Index; Bio Mérieux SA, Marcy l'Etoile, France). Isolates from a single sample yielding identical API 20C AUX and API ZYM profiles were considered the same yeast strain. Broth cultures of pure isolates were aliquoted and stored as stock cultures at -70°C and were later retrieved for biotyping, resistotyping, and molecular characterization.

Biotyping. All C. albicans isolates from pre- and post-antifungal and/or hygienic therapy were biotyped using the API 20C AUX and API ZYM (Analytical Profile Index; Bio Mérieux SA) systems according to the methods described by Williamson et al. (46) and Matee et al. (21). All tests were performed according to the manufacturer's instructions using a standardized inoculum, temperature, and duration of incubation. Repeat biotyping was performed three times to ascertain the reproducibility of the results.

Resistotyping. All Candida isolates were resistotyped by the method of McCreight et al. (23) using acrylamide, boric acid, cetrimide, chlorhexidine, copper (II) sulphate, sodium chloride, sodium periodate, and sodium selenite. The concentration of each chemical (except chlorhexidine) which inhibited the growth of up to 50% of the isolates was recorded as the breakpoint concentration. The ability of the isolates to grow on MacConkey agar was also tested. The resistotyping profile of each isolate was confirmed by repeat experiments on three separate occasions.

Preparation of Candida DNA for molecular analysis. C. albicans isolates obtained from the stock culture were subcultured on yeast-peptone-dextrose medium (1% peptone, 1% yeast extract, 2% glucose, 1.5% agar) at 37°C for 24 h. A single colony was transferred to 20 ml of yeast-peptone-dextrose broth and incubated at 30°C in air with constant shaking until the early stationary phase (monitored by measurement of optical density at 600 nm) was reached. The yeast cells were harvested by centrifugation at 4,000 × g for 5 min and then washed in 1 M sorbitol (4). For randomly amplified polymorphic DNA (RAPD) or restriction fragment length polymorphism (RFLP) analysis, the yeast pellet was resuspended in 1.5 ml of SE buffer (1.2 M sorbitol-0.1 M EDTA, pH 8.0) containing 3 µl of beta -mercaptoethanol (Sigma, St. Louis, Mo.) and 0.5 mg of yeast lytic enzyme (lyticase; Sigma) and incubated at 37°C for up to 1 h until spheroplasts were noted. The spheroplasts were harvested by centrifugation at 2,500 × g for 5 min, washed twice in SE buffer, and resuspended in 1.5 ml of 0.15 M NaCl-0.1 M EDTA, pH 8.0. They were then lysed by the addition of proteinase K (final concentration, 500 µg/ml) and sodium dodecyle sulfate (final concentration, 1% [wt/vol]), along with RNase (final concentration, 500 µg/ml), at 55°C for 1 h. The lysed C. albicans spheroplasts were pelleted at 13,000 × g for 5 min, and then the supernatant was extracted twice with phenol and once with phenol-chloroform prior to DNA precipitation by the addition of an equal volume of 2-propanol. The precipitated DNA was redissolved in 100 µl of TE buffer (0.1 mM EDTA-10 mM Tris, pH 8.0) (4).

Chromosomal analysis by pulsed-field gel electrophoresis (PFGE). Cell suspensions in 1 M sorbitol prepared as described above were washed twice in 50 mM EDTA-10 mM Tris, pH 7.6, and resuspended to a concentration of 109 cells/ml in 50 mM EDTA, pH 8.0. A 500-µl volume of this suspension was mixed with 50 µl of 3 mg of lyticase (Sigma) per ml of solution (900 U of lyticase/ml) and 550 µl of 1% low-melting-point agarose in 20 mM NaCl-0.5 M EDTA-10 mM Tris, pH 7.6. The resulting agarose plugs were incubated in 50 volumes of 7.5% beta -mercaptoethanol-0.5 M EDTA-10 mM Tris, pH 7.6, two times for 24 h each time for spheroplast generation. The plugs (100 µl) were then suspended in 100 µl of solution containing 1% laurylsarcosine and 100 mg of proteinase K and then incubated first at 50°C for 24 h and then at 50°C for 24 h in 100 mg of proteinase K solution alone (26, 32). Alternatively, after the lyticase digestion, the agarose plugs containing the spheroplasts were lysed in 1% sodium dodecyl sulfate-20 mM NaCl-0.5 M EDTA-10 mM Tris, pH 7.6, at 37°C overnight. Then the plugs were washed thrice with 50 mM EDTA, pH 8.0, and loaded onto 0.8% (wt/vol) chromosome-grade Ultra-pure agarose gel (Bio-Rad Laboratories, Hercules, Calif.) in TBE buffer (0.5× TBE buffer is 2.5 mM EDTA-89 mM boric acid-89 mM Tris, pH 8.0) (26, 32).

The chromosomes of C. albicans were separated employing the contour-clamped homogeneous electric field (CHEF) technique using the CHEF-DR III variable angle system (Bio-Rad) in 0.5× TBE buffer at 14°C. The electrophoretic conditions used were as follows: two-state mode with linear ramping factors; run time, 48 h; initial and final switching times, 90 s and 325 s, respectively; constant voltage of 4 V/cm, switching angle, 120 degrees. Hansenula wingei chromosomes (Bio-Rad) were used as the molecular size standard. The resulting gel was stained with ethidium bromide (0.5 µg/ml of distilled water; Sigma) for 15 min and destained in distilled water for 3 h. DNA bands were visualized and photographed under UV transillumination. Each specimen was analyzed on at least three separate occasions.

RFLP. Total genomic DNA of the C. albicans isolates was digested to completion with the restriction enzyme HinfI according to the method described by Smith et al. (36). In brief, after quantification of the DNA specimens (32), 10 µg of the DNA was incubated with 10 U of HinfI (Pharmacia) for 6 h at 37°C according to the manufacturer's instructions. The digests were electrophoresed in a 1.2% (wt/vol) agarose gel containing ethidium bromide in 0.5× TBE buffer at 50 V for 4 h and visualized under UV transillumination (4). The RFLP analysis was repeated on two more separate occasions.

RAPD analysis. The custom-synthesized primers (Gibco BRL; Hong Kong) used in the study were NA (the initials of N. Akopyanz) (5'GCGATCCCCA3') (1), JWFR (the initials of J. W. Fell plus R for reverse) (5'GGTCCGTGTTTCAAGACG3') (10), and JWFF (F for forward) (5'GCATATCAATAAGCGGAGGAAAAG3') (10). Thermocycling was performed in a minicycler machine (models PTC-150-16 and 25; MJ Research, Watertown, Mass.). A 50-µl volume of the PCR master mix contained approximately 200 ng of yeast DNA template, 5 µl of PCR buffer (10× PCR buffer is 0.5 M KCl-0.2 M Tris (pH 8.4), a 200 µM concentration of each dNTP, 25 mM MgCl2, a 1 µM concentration of primer, and 1.5 U of Taq polymarase (Life Technologies, Frederick, Md.). The first five cycles of PCR protocol included 30 s of denaturation at 94°C and 2 min of annealing at 27°C (primer NA) or 52°C (primers JWFR and JWFF); this was followed first by 2 min of primer extension and then by 45 cycles of 30 s of denaturation at 94°C, 2 min of annealing at 32°C (primer NA) or at 57°C (primers JWFR and JWFF), and 2 min of primer extension at 72°C. The reaction was held at 72°C for 15 min. Control tubes without template DNA were included in each run, and reproducibility was checked for each reaction (39). The PCR products were electrophoresed in an 0.8% agarose gel in TBE buffer, stained with ethidium bromide, and visualized under UV transillumination. The RAPD analysis was repeated on two further separate occasions with strains recovered from the stock kept at -70°C.

Statistics. The demographic and microbiological data of the subjects were analyzed by Statview 4.5 for Macintosh computer. Differences between individual groups were tested by Bonferroni's multiple comparison for nonparametric data, analysis of variance, or Fisher exact test, as appropriate. Groups were regarded as significantly different from each other if P was <0.05.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The demographic data of the subjects recruited in the first part of the study, including the length of the postirradiation period, are shown in Table 1. On initial examination, 42% (group A [n = 10], 40%; group B [n = 4], 50%) of the irradiated individuals were diagnosed as having oral candidiasis.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 1.   Demographic data of the cohorts studied

All isolates belonged to Cryptococcoideae and were Candida species. The species isolated were C. albicans (group A [n = 19], 76%; group B [n = 5], 62.5%; group C [n = 2], 10%; group D [n = 4], 40%), C. tropicalis (group A [n = 5], 20%; group B [n = 4], 50%; groups C and D [n = 0], 0%), Candida parapsiolosis (group A [n = 2], 8%; group C [n = 1], 5%; groups B and D, [n = 0], 0%), Candida famata (group A [n = 1], 4%; groups B, C, and D [n = 0], 0%). Two species of Candida were isolated from each of two rinse samples from group A and one rinse sample from group B. Significantly higher prevalences of C. albicans, C. tropicalis, and total Candida species were noted in the irradiated individuals (groups A and B) than in the healthy individuals (groups C and D) (Fisher exact test, P < 0.05). The total counts (in CFU per milliliter of oral rinse) of yeast species isolated are summarized in Table 2. The oral rinse samples of irradiated individuals, (i.e., groups A and B), yielded a mean of at least one yeast species as opposed to less than 0.5 yeast species recovered from groups C and D (Table 2). The quantities (in CFU per milliliter) of total Cryptococcoideae recovered from Group B subjects were significantly elevated compared with those recovered from the other three cohorts (Table 2).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 2.   Quantity of Cryptococcoideae isolated from oral rinse samplesa

Altogether, 12 (6 males; average age ± SD, 45.9 ± 5.8 years; average postirradiation time ± SD, 5.0 ± 3.1) and 5 (all males; average age ± SD, 67.1 ± 3.4 years; average postirradiation time ± SD, 2.0 ± 1.1 years) subjects from groups A and B, respectively, participated in the recall reassessment for yeast colonization. The remainder either missed the recall, attended their own general dentist, or succumbed to illness. Clinically, most of the subjects exhibited a fair standard of oral hygiene, i.e., >= 81% of the studied sites had a plaque index score of <= 1 during both examination events, with the number of plaque-free sites increasing from 12% to 33% at the second examination. As for periodontal health, >= 69% of the studied sites exhibited clinically healthy or mild marginal gingival swelling without bleeding on probing; 95% of sites were free of calculus at the initial examination. On first presentation 35.3% (group A, n = 4; group B, n = 2), i.e., 6 of the 17 individuals were clinically diagnosed with candidiasis and received topical antifungal therapy (100,000 U of nystatin per gram of ointment, three times a day [20]), whereas at the recall session, 23.5% (group A, n = 3; group B, n = 1), i.e., 4 of the original 6 subjects remained affected by candidasis, albeit with markedly smaller lesions. Antifungal therapy was helpful in eradicating the yeast or reducing the yeast numbers to below detectable levels in only 1 of the 6 individuals. In four cases, the colonization pattern remained unchanged while in one case C. albicans was replaced by C. tropicalis on the second sampling visit. None of the affected individuals complained of discomfort related to the residual lesions at the recall session.

Eight of the 11 asymptomatic individuals harbored the same biotype of Candida in the sequential oral rinse samples (C. albicans, n = 7; C. tropicalis, n = 1), while the remainder yielded different Candida species on the second visit (one yielded C. albicans and then C. tropicalis, one yielded C. tropicalis and then C. albicans, and one yielded C. albicans and then C. glabrata).

The prevalences of yeast species in oral rinse samples at baseline and recall sessions is summarized in Table 3. The quantity of yeast species isolated from both groups (total or individual counts), from the first or second oral rinse samples, irrespective of antifungal therapy, fell within a similar range. The range and median values (in CFU per milliliter of oral rinse) were determined for C. albicans before (range, 0 to 4.8 × 104; median, 132) and after (range, 0 to 1.2 × 104; median, 711) treatment and for C. tropicalis before (range, 0 to 2.3 × 104; median, 0) and after (range, 0 to 4.5 × 103; median, 0) treatment. There was no significant difference in either the yeast recovery patterns or the yeast harvests between the two visits.

                              
View this table:
[in this window]
[in a new window]
 
TABLE 3.   Frequencies of yeast species isolated from oral rinse samples of irradiated individuals before and after antifungal and/or hygienic therapy

The 10 sequential isolate-pairs of C. albicans were biotyped using the API 20C AUX and API ZYM kits. All were found to belong to the primary biotype type J of the classification system of Williamson et al. (46) (Table 4), indicating that they all possessed alkaline phosphatase, acid phosphatase, esterase, lipase esterase, leucine arylamidase, valine arylamidase, phosphoamidase, alpha -glucosidase and N-acetyl-beta -glucosaminidase activity (data not shown). Eight sequential isolate pairs belonged to the secondary biotype 1 (per API 20C AUX), while the remainder were of biotypes 11 and 24 (21) (Table 4).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 4.   Phenotypic characteristics of sequential isolate pairs of Candida spp. derived from oral rinse samples

The resistotype profiles of the 12 sequential isolate pairs of C. albicans and C. tropicalis are also shown in Table 4. The susceptibilities of the isolate pairs to various chemicals differed to varying extents. Five of the 12 isolate pairs tested were of resistotypes that were considerably different (>3 of 9 tests) from those of their counterparts. It was found that among individuals receiving only hygienic therapy C. albicans isolate pairs with fewer phenotypic differences were significantly more prevalent than they were among subjects that received antifungal therapy (Table 4).

The 10 sequential C. albicans isolate pairs from the irradiated patients were subjected to three different molecular typing methods, namely, PFGE, RFLP, and RAPD analyses. Identical banding patterns were observed in specimens from the same stock culture (data not shown). Electrophoretic karyotyping using PFGE revealed six to eight chromosomes per C. albicans isolate tested, with chromosome sizes ranging from 1 to 3.2 Mb. All but two isolate-pairs (L1-L1' and L2-L2') revealed stringent conservation of karyotypes (Fig. 1). When comparing PFGE patterns of isolates from different subjects, only isolates from subjects L8 and L10 showed identical PFGE profiles (Fig. 1B). The restriction enzyme HinfI was employed to further profile the isolates by genotype (3, 6, 36). Enzymatic digestion of sequential C. albicans isolate pair DNA specimens by HinfI revealed that 7 of 10 patients carried genetically different strains after the antifungal and/or hygienic therapy as illustrated by the polymorphism of restriction fragments at the higher-molecular-weight region, i.e., 2 to 10 kb (6). The remaining 30% of the DNA profiles exhibited almost identical restriction fragment length patterns (Table 5; Fig. 2).


View larger version (73K):
[in this window]
[in a new window]
 
FIG. 1.   Pulsed-field gel electrophoretic separation of chromosome-sized DNA of sequential C. albicans isolate pairs from oral rinse samples. (A) Karyotypes of isolates from subjects 1 to 5 before (lanes L1, L2, L3, L4, and L5) and after (lanes L1', L2', L3', L4', and L5') antifungal and/or hygienic therapy. (B) Karyotypes of isolates from subjects 6 to 10 before (lanes L6, L7, L8, L9, and L10) and after (lanes L6', L7', L8', L9', and L10') antifungal and/or hygienic therapy. Karyotyping was carried out on an 0.8% agarose gel. Lane M, H. wingei chromosome molecular size standard (Bio-Rad).

                              
View this table:
[in this window]
[in a new window]
 
TABLE 5.   Genotypic similarities of C. albicans sequential isolate pairs derived from oral rinse samples



View larger version (118K):
[in this window]
[in a new window]
 
FIG. 2.   RFLP of C. albicans DNA digested by HinfI. Shown are DNA fragments obtained from digestion of DNA extracted from five patients, subjects 6 to 10, before (lanes L6, L7, L8, L9, and L10) and after (lanes L6', L7', L8', L9', and L10') antifungal and/or hygienic therapy. DNA bands were visualized by electrophoretic separation on a 1.2% agarose gel. Lane M, lambda  DNA HindIII digestion standard.

When the 10 sequential C. albicans isolate-pairs were analyzed by RAPD, remarkable genetic variation was observed (Table 5). The three different primers yielded isolate-specific arrays of 10 to 15 prominent fragments under the PCR conditions employed (Fig. 3). Only one isolate pair was found to possess identical DNA profiles when the primers NA and JWFR were used (Fig. 3). However, with the primer JWFF, four C. albicans isolate pairs were found to be identical, although none of these was the pair which was deemed identical with NA and JWFR (Table 5).


View larger version (62K):
[in this window]
[in a new window]
 
FIG. 3.   RAPD fingerprinting patterns of sequential C. albicans isolate pairs with primers NA (5'GCGATCCCCA3') (A) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6', L7', L8', L9', and L10'] antifungal and/or hygienic therapy), JWFR (5'GGTCCGTGTTTCAAGACG3') (B) (amplification patterns of isolates from five patients, subjects 1 to 5, before [lanes L1, L2, L3, L4, and L5] and after [lanes L1', L2', L3', L4', L5'] antifungal and/or hygienic therapy), and JWFF (5'GCATATCAATAAGCGGAGGAAAAG3') (C) (amplification patterns of isolates from five patients, subjects 6 to 10, before [lanes L6, L7, L8, L9, and L10] and after [lanes L6', L7', L8', L9', and L10'] antifungual and/or hygienic therapy). PCR products were electrophoretically separated on a 1.2% agarose gel. Lane M, 123-bp DNA ladder (Sigma) (in panel A); PCR marker (Sigma) (in panels B and C).


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

The prevalence and quantity of cultivable oral yeasts and their colonization patterns in a homogenous group of NPC survivors subjected to therapeutic head and neck irradiation were investigated by using a cross-sectional study design. To our knowledge this is the first study to characterize sequential oral Candida isolates from irradiated individuals suffering from solid tumors similar in nature and subjected to the same therapeutic irradiation protocol. The baseline data obtained were compared with data for age- and sex-matched nonirradiated healthy individuals. The oral yeast colonization pattern of the irradiated subjects after antifungal and/or hygienic therapy was reassessed, and the phenotypic and genotypic characteristics of biochemically identical, sequential oral yeast isolate pairs were studied.

The oral yeast colonization profile, including the candidal prevalence and the predominant Candida species isolated, from our test cohort was similar to most previous reports from irradiated subjects with various head and neck tumors (20, 27). According to some reports, early oral candidal colonization in these patients coincides with the commencement of irradiation therapy (28). In our study topical antifungal therapy effectively reduced lesion sizes and resolved clinical symptoms in approximately one-third of the recalled patients with candidasis, although the oral yeast prevalence was persistently high (Table 3). Similarly, Ramirez-Amador et al. (27) have shown that systemic antifungal therapy eradicated clinical oral infection in only five of eight irradiated patients. In another recent study Redding et al. (28) reported that progressive, incremental systemic antifungal dosage could eliminate only 27% of clinical Candida infections, and oral yeast carriage cannot be totally eradicated. Based on these observations, and mindful of the selection and emergence of drug-resistant strains, both groups expressed caution in using prophylactic antifungals during irradiation therapy (27, 28).

It is well established that Candida species are oral commensals in diseased individuals such as the irradiated subjects in the current study. Hence, one premise of our study was that the Candida strains isolated on the recall visit were persistent oral strains derived from the original parent stock but subjected to exogenous insult such as postirradiation xerostomia. Particular attention was paid in studying these sequential yeast isolates in an attempt to trace their phenotypic and genotypic lineage. Thus, we found that 59% of the recalled subjects harbored C. albicans and 12% harbored C. tropicalis, respectively, at both time points studied. Although the introduction of exogenous Candida strains into the oral cavity between the sampling intervals cannot be totally ruled out, this would be minimal, as all subjects suffered from the same type of tumor (NPC), successfully treated with a single course of irradiation therapy without resorting to surgery, immunosuppressants, or long-term steroid therapy. Second, the subjects were all from southern China, having comparable dietary habits. All had undergone similar, professionally delivered oral hygiene therapy.

Although, it would have been desirable to follow up both the control and the test group to decipher the lineage of sequential oral Candida isolates, we did not, due to the low prevalence of oral yeasts in control group C (age, <= 60 years). Furthermore, the fact that the denture-wearing habit, which fosters yeast colonization, was more prevalent in control group D (age, >= 60 years) reinforced our decision to abort such a parallel study.

Resistotyping allows differentiation of C. albicans isolates from clinical samples and has been used in clinical epidemiology studies (24). This method is based on the susceptibility of the test strains to a select group of organic and inorganic compounds incorporated into specific culture media. The resistotype profiles of the isolate pairs studied showed varying degrees of difference (Table 4). Distinctly different resistotypes were obtained with C. albicans isolate pairs L4-L4', L8-L8', L9-L9', and L10-L10'; the last three being from subjects who had received topical antifungal therapy. The rest of the isolate pairs were found to be moderately or minimally different from their partner strain. The C. tropicalis isolate pair, L11-L11', was found to differ in resistotype after hygienic therapy, while the isolate pair L12-L12' was minimally different despite antifungal therapy (Table 4).

Due to the potential inconsistencies of the phenotyping methods, several molecular typing methods have been widely used in epidemiologic studies of C. albicans. These include RAPD (22), RFLP analysis of total genomic DNA (40), Southern hybridization analysis using a number of different probes (11, 33), and electrophoretic karyotyping using PFGE (25). However, the resolution, specificity, and discriminatory power of each of these methods differ greatly, thus affecting their utility. For instance, electrophoretic karyotyping of chromosome-size DNA elements of medically important yeasts is often used to evaluate species and strain profiles (26) and this technique is considered one of the better molecular typing methods available to study the genetics of C. albicans (15). A relatively less technically demanding approach for strain differentiation of C. albicans is RFLP analysis (36). HinfI used in the latter method produces a clear background and less-ambiguous band patterns (36), and this indeed was the case in our studies. The fragments of interest (in the region of 4 to 9 kb) generated by HinfI digestion of total genomic DNA are derived from the spacer region of the DNA repeat sequences of C. albicans (19). Smith et al. (36) postulated that the above-mentioned spacer region was not genetically conserved, hence generating the diversity observed.

As opposed to PFGE and RFLP, PCR-based protocols have become popular in recent years for genotyping Candida (3). Among them, RAPD is the most favored, probably due to its relatively simple and quick protocol. One limitation, however, is that no universally established guidelines are available for the selection of primers and the subsequent interpretation of the data generated. Whereas some have used combined profiles derived from multiple primers (45), others suggest the use of a single primer in combination with different molecular typing methods for profiling Candida genotypes (41). Bart-Delabesse and coworkers (3) appreciated these difficulties and suggested that minor variations of RAPD profiles of isolates derived from the same individual should be disregarded. We followed these guidelines in the current study, together with recommendations of Sullivan and coworkers (41), who suggested the selection of at least three different molecular typing methods for adequate characterization of C. albicans.

At the karyotype level, only C. albicans isolate pairs L1-L1' and L2-L2' appeared to yield disparate profiles, in contrast to all other isolate pair profiles, which were identical (Fig. 1). A total of 11 unique C. albicans karyotypes were observed in this study, including four isolates (isolate pairs L8-L8' and L10-L10') with the same karyotype profile (Fig. 1; Table 5). Interestingly, isolate pairs L8-L8' and L10-L10' were dissimilar with regard to their (API 20C AUX) biotype.

The banding profiles of C. albicans we obtained using PFGE were similar in size range to those observed by Bostock et al. (4). Minor differences noted in the profiles of isolates L1, L1', L2, and L2' (Fig. 1A) could possibly be due to chromosome translocation giving rise to the chromosome length polymorphism (44). Another possibility is that genetically similar, yet slightly divergent, C. albicans strains were colonizing these individuals on two different occasions.

With respect to the HinfI RFLP profiles of the C. albicans isolate pairs, it was intriguing to note the wide variations of the sequence of the spacer region of the ribosomal DNA (rDNA) repeat (Table 5). According to this protocol, only 3 of 10 isolate pairs were similar, whereas in the PFGE protocol 8 of 10 pairs showed close resemblance. Furthermore, congruence of isolate pairs when using both the PFGE and RFLP methods was seen only with the isolate pairs L8-L8' and L10-L10'.

When the RAPD protocol was used to further characterize the Candida, all three primers yielded more or less similar numbers of fragments (Fig. 3). The primers used in our study were derived from a battery of primers employed for characterization of Candida dubliniensis (42), and were of varying size and GC content, i.e., NA, JWFR, and JWFF contained 10 bases with a GC content of 70%, 18 bases with a GC content of 55%, and 24 bases with a GC content of 42%, respectively. The rationale for using primers JWFR and JWFF was their previous utility in the analyses of the V3 variable region of the large ribosomal subunit genes of C. albicans (10, 42). In the current study, JWFR and JWFF were used individually rather than in tandem as previously described (10, 42) in an attempt to generate an extra set of RAPD profiles. NA has also been previously employed for RAPD fingerprinting of C. albicans (1). All primers employed appeared to well suit the present analyses, as they yielded effectively similar annealing frequencies in most of the C. albicans isolates tested.

Drawing together the phenotypic and genotypic characteristics of the C. albicans isolate pairs studied, we could make the following conclusions. The chromosomal attributes of the sequential C. albicans isolate pairs appear relatively subject specific (except for the two pairs L8-L8' and L10-L10'). There was no significant disparity in the chromosome-size bands derived from PFGE, except for the possibility of chromosomal translocations observed in two isolate pairs. As for RAPD analyses, identical genotypic characteristics could be detected only in six isolate pairs with all three primers. Further, the utility of the HinfI RFLP regimen for profiling C. albicans genotype appears questionable, as there was no correlation between the latter and the HinfI RFLP profile for any of the isolate pairs tested (Tables 4 and 5). This may be due to the characteristics of the highly variable rDNA spacer region, the use of which may confer minimal effects on the C. albicans phenotype.

In conclusion, we postulate that the irradiation-induced changes of the intraoral environment, such as xerostomia, lead to increased intraoral colonization by Candida species. The question of whether clonal selection and propagation of Candida occurs in these patients either due to irradiation and/or to concomitant antifungal therapy is still unresolved. A comprehensive study of a large cohort using precise analytical tools appears to be necessary to resolve this issue.


    ACKNOWLEDGMENTS

We thank Jonathan S.T. Sham of Clinical Oncology, the University of Hong Kong, for assistance in subject recruitment, Grace Yung for technical assistance, and Nerissa Chan and Esmonde F. Corbet for help with the manuscript preparation.

This project was supported by the Committee for Research and Conference Grants of the University of Hong Kong and the Research Grants Council, Hong Kong SAR Government.


    FOOTNOTES

* Corresponding author. Mailing address: The University of Hong Kong, Faculty of Dentistry, Room 3B39, 34 Hospital Rd., Hong Kong SAR, China. Phone: (852) 2859-0417. Fax: (852) 2858-7874. E-mail: ewkleung{at}hkucc.hku.hk.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Akopyanz, N., N. O. Bukanov, T. U. Westblom, S. Kresovisch, and D. E. Berg. 1992. DNA diversity among clinical isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting. Nucleic Acids Res. 20:5137-5142[Abstract/Free Full Text].
2. Anaissie, E. J. 1992. Opportunistic mycoses in the immunocompromised host: experience at a cancer centre and review. Clin. Infect. Dis. 14(Suppl. 1):S43-S53.
3. Bart-Delabesse, E., H. van-Deventer, W. Goessens, J. L. Poirot, N. Lioret, A. van Belkum, and F. Dromer. 1995. Contribution of molecular typing methods and antifungal susceptibility testing to the study of a candidemia cluster in a burn care unit. J. Clin. Microbiol. 33:3278-3283[Abstract].
4. Bostock, A., M. N. Khattak, R. Matthews, and J. Burnie. 1993. Comparison of PCR fingerprinting, by random amplification of polymorphic DNA, with other molecular typing methods for Candida albicans. J. Gen. Microbiol. 139:2179-2184[Abstract/Free Full Text].
5. Brown, L. R., S. Dreizen, T. E. Daly, J. B. Drane, S. Handler, L. J. Riggan, and D. A. Johnston. 1978. Interrelations of oral microorganisms, immunoglobulins, and dental caries following radiotherapy. J. Dent. Res. 57:882-893[Abstract/Free Full Text].
6. Carlotti, A., G. Zambardi, A. Couble, N. Lefrancois, X. Martin, and J. Villard. 1994. Nosocomial infection with Candida albicans in a pancreatic transplant recipient investigated by means of restriction enzyme analysis. J. Infect. 29:157-164[CrossRef][Medline].
7. Chen, K. Y., and G. H. Fletcher. 1971. Malignant tumours of nasopharynx. Radiology 99:165-171[Medline].
8. Chen, T. Y., and J. H. Webster. 1974. Oral monilia study on patients with head and neck cancer during radiotherapy. Cancer 34:246-249[CrossRef][Medline].
9. Epstein, J. B., M. M. Freilich, and N. D. Le. 1993. Risk factors for oropharyngeal candidiasis in patients who receive radiation therapy for malignant conditions of the head and neck. Oral Surg. Oral Med. Oral Pathol. 76:169-174[CrossRef][Medline].
10. Fell, J. W. 1993. Rapid identification of yeast species using three primers in a polymerase chain reaction. Mol. Mar. Biol. Biotechnol. 2:174-180[Medline].
11. Fox, B. C., H. L. T. Mobley, and J. C. Wade. 1989. The use of a DNA probe for epidimiological studies of candidiasis in immunocompromised hosts. J. Infect. Dis. 159:488-494[Medline].
12. Fraser, V. J., M. Jones, J. Dunkel, S. Storfer, G. Medoff, and W. C. Dunagan. 1992. Candidemia in a tertiary care hospital: epidemiology, risk factors and predictors of mortality. Clin. Infect. Dis. 15:414-421[Medline].
13. Hong Kong Cancer Registry. 1992. Annual report. Department of Health, Hong Kong, Hong Kong.
14. Kleinegger, C. L., S. R. Lockhart, K. Vargas, and D. R. Soll. 1996. Frequency intensity, species, and strains of oral Candida vary as a function of host age. J. Clin. Microbiol. 34:2246-2254[Abstract].
15. Lasker, B. A., G. F. Carle, G. S. Kobuyashi, and G. Medoff. 1989. Comparison of the separation of Candida albicans chromosome-size DNA by pulsed-field gel electrophoresis techniques. Nucleic Acids Res. 17:3783-3793[Abstract/Free Full Text].
16. Lockhart, S. R., S. Joly, K. Vargas, J. Swails-Wenger, L. Enger, and D. R. Soll. 1999. Natural defenses against Candida colonization breakdown in the oral cavities of the elderly. J. Dent. Res. 78:857-868[Abstract/Free Full Text].
17. Löe, H., and J. Silness. 1963. Periodontal disease in pregnancy. I. Prevalence and severity. Acta Odontol. Scand. 21:533-551[Medline].
18. Mackenzie, D. W. R. 1962. Serum tube identification of Candida albicans. J. Clin. Pathol. 15:563-565.
19. Magee, P. T., L. Bowdin, and J. Staudinger. 1992. Comparison of molecular typing methods for Candida albicans. J. Clin. Microbiol. 30:2674-2679[Abstract/Free Full Text].
20. Martin, M. V., U. Al-Tikriti, and P. A. Bramley. 1981. Yeast flora of the mouth and skin during and after irradiation for oral and laryngeal cancer. J. Med. Microbiol. 14:457-467[Abstract/Free Full Text].
21. Matee, M. I., L. P. Samaranayake, F. Scheutz, E. Simon, E. F. Lyamuya, and J. Mwinula. 1996. Biotypes of oral Candida albicans isolates in a Tanzanian child population. APMIS 104:623-628[Medline].
22. Matthews, R., and J. Burnie. 1989. Assessment of DNA finger-printing for rapid identification of outbreaks of systemic candidiasis. Br. Med. J. 298:354-357.
23. McCreight, M. C., D. W. Warnock, and M. V. Martin. 1985. Resistogram typing of Candida albicans isolates from oral and cutaneous sites in irradiated patients. Sabouraudia 23:403-406[Medline].
24. Merz, W. G. 1990. Candida albicans strain delineation. Clin. Microbiol. Rev. 3:321-334[Abstract/Free Full Text].
25. Merz, W. G., C. Connelly, and P. Hieter. 1988. Variation of electrophoretic karyotypes among clinical isolates of Candida albicans. J. Clin. Microbiol. 26:842-845[Abstract/Free Full Text].
26. Pfaller, M. A., J. Rhine-Chalberg, S. W. Redding, J. Smith, G. Farinacci, A. W. Fothergill, and M. G. Rinaldi. 1994. Variation in fluconazole susceptibility and electrophoretic karyotype among oral isolates of Candida albicans from patients with AIDS and oral candidiasis. J. Clin. Microbiol. 32:59-64[Abstract/Free Full Text].
27. Ramirez-Amador, V., S. Silverman, Jr., P. Mayer, M. Tyler, and J. Quivey. 1997. Candidal colonization and oral candidiasis in patients undergoing oral and pharyngeal radiation therapy. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 84:149-153[CrossRef][Medline].
28. Redding, S. W., R. C. Zellars, W. R. Kirkpatrick, R. K. McAtee, M. A. Caceres, A. W. Fothergill, J. L. Lopez-Ribot, C. W. Bailey, M. G. Rinaldi, and T. F. Patterson. 1999. Epidemiology of oropharyngeal Candida colonization and infection in patients receiving radiation for head and neck cancer. J. Clin. Microbiol. 37:3896-3900[Abstract/Free Full Text].
29. Richardson, M. D. 1991. Opportunistic and pathogenic fungi. J. Antimicrob. Chemother. 28(Suppl. A):1-11[Free Full Text].
30. Samaranayake, L. P. 1992. Oral mycoses in HIV infection. Oral Surg. Oral Med. Oral Pathol. 73:171-180[CrossRef][Medline].
31. Samaranayake, L. P., T. W. MacFarlane, P.-J. Lamey, and M. M. Ferguson. 1986. A comparison of oral rinse and imprint sampling techniques for the detection of yeast, coliform and Staphylococcus aureus carriage in the oral cavity. J. Oral Pathol. 15:386-388[CrossRef][Medline].
32. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual., 2nd ed., p. 55-56. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
33. Scherer, S., and D. A. Stevens. 1988. A Candida albicans dispersed, repeated gene family and its epidemiologic application. Proc. Natl. Acad. Sci. USA 85:1452-1456[Abstract/Free Full Text].
34. Schwarz, E., G. K. C. Chiu, and W. K. Leung. 1999. Oral health status of Southern Chinese following head and neck irradiation therapy for nasopharyngeal carcinoma. J. Dent. 27:21-28[CrossRef][Medline].
35. Silness, J., and H. Löe. 1964. Periodontal disease in pregnancy. II. Correlation between oral hygiene and periodontal condition. Acta Odontol. Scand. 24:747-759[CrossRef].
36. Smith, R. A., C. A. Hitchcock, E. G. V. Evans, C. J. N. Lacey, and D. J. Adams. 1989. The identification of Candida albicans strains by restriction fragment length polymorphism analysis of DNA. J. Med. Vet. Mycol. 27:431-434[Medline].
37. Spiechowicz, E., K. Rusiniak-Kubik, E. Skopinska-Rózewska, I. Sokolinicka, K. Zabuska-Jablonska, W. Brajczewska-Fischer, D. Rolski, B. Ciechowicz, M. Gil, and R. P. Renner. 1994. Immunological status of patients with denture stomatitis and yeast infection after treatment of maxillofacial tumors. Arch. Immunol. Ther. Exp. (Warsz) 42:263-267[Medline].
38. Spijervet, F. K. L. 1991. Irradiation mucositis. Prevention and treatment. Munksgaard, Copenhagen, Denmark.
39. Steffan, P., J. A. Vazquez, D. Boikov, C. Xu, J. D. Sobel, and R. A. Akins. 1997. Identification of Candida species by randomly amplified polymorphic DNA fingerprinting of colony lysates. J. Clin. Microbiol. 8:2031-2039.
40. Stevens, D. A., F. C. Odds, and S. Scherer. 1990. Application of DNA typing methods to Candida albicans epidemiology and correlations with phenotype. Rev. Infect. Dis. 12:258-266[Medline].
41. Sullivan, D. J., D. E. Bennett, M. Henman, P. Harwood, S. Flint, F. Mulcahy, D. Shanley, and D. C. Coleman. 1993. Oligonucleotide fingerprinting of isolates of Candida species other than C. albicans and of atypical Candida species from human immunodeficiency virus-positive and AIDS patients. J. Clin. Microbiol. 31:2124-2133[Abstract/Free Full Text].
42. Sullivan, D. J., T. J. Westerneng, K. A. Haynes, D. E. Bennet, and D. C. Coleman. 1995. Candida dubliniensis sp. nov.: phenotypic and molecular characterization of a novel species associated with oral candidosis in HIV-infected individuals. Microbiology 141:1507-1521[Abstract/Free Full Text].
43. Tenovuo, J. O. 1989. Human saliva: clinical chemistry and microbiology, vol. 1. CRC Press, Boca Raton, Fla.
44. Thrash-Bingham, C., and J. A. Gorman. 1992. DNA translocations contribute to chromosome length polymorphisms in Candida albicans. Curr. Genet. 22:93-100[CrossRef][Medline].
45. van Belkum, A., J. Kluytmans, W. van Leeuwen, R. Bax, W. Quint, E. Peters, A. Fluit, C. Vandenbroucke-Grauls, A. van den Brule, H. Koeleman, W. Melchers, J. Meis, A. Elaichouni, M. Vaneechoutte, F. Moonens, N. Maes, M. Struelens, F. Tenover, and H. Verbrugh. 1995. Multicentre evaluation of arbitrarily primed PCR for typing of Staphylococcus aureus strains. J. Clin. Microbiol. 33:1537-1547[Abstract].
46. Williamson, M. I., L. P. Samaranayake, and T. W. MacFarlane. 1987. A new simple method for biotyping Candida albicans. Microbios 51:159-167[Medline].


Journal of Clinical Microbiology, June 2000, p. 2219-2226, Vol. 38, No. 6
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Tsang, C. S. P., Chu, F. C. S., Leung, W. K., Jin, L. J., Samaranayake, L. P., Siu, S. C. (2007). Phospholipase, proteinase and haemolytic activities of Candida albicans isolated from oral cavities of patients with type 2 diabetes mellitus. J Med Microbiol 56: 1393-1398 [Abstract] [Full Text]  
  • Reichart, P. A., Samaranayake, L. P., Samaranayake, Y. H., Grote, M., Pow, E., Cheung, B. (2002). High Oral Prevalence of Candida krusei in Leprosy Patients in Northern Thailand. J. Clin. Microbiol. 40: 4479-4485 [Abstract] [Full Text]  
  • Bartie, K. L., Williams, D. W., Wilson, M. J., Potts, A. J. C., Lewis, M. A. O. (2001). PCR Fingerprinting of Candida albicans Associated with Chronic Hyperplastic Candidosis and Other Oral Conditions. J. Clin. Microbiol. 39: 4066-4075 [Abstract] [Full Text]  
  • Samaranayake, Y. H., Samaranayake, L. P., Pow, E. H. N., Beena, V. T., Yeung, K. W. S. (2001). Antifungal Effects of Lysozyme and Lactoferrin against Genetically Similar, Sequential Candida albicans Isolates from a Human Immunodeficiency Virus-Infected Southern Chinese Cohort. J. Clin. Microbiol. 39: 3296-3302 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leung, W. K.
Right arrow Articles by Samaranayake, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leung, W. K.
Right arrow Articles by Samaranayake, L. P.