![[Feedback]](/icons/banner/feedbackACT.gif)
![[For Subscribers]](/icons/banner/subscriberACT.gif)
![[Archive]](/icons/banner/archiveACT.gif)
![[Search]](/icons/banner/searchACT.gif)
![[Contents]](/icons/banner/tocACT.gif)
Previous Article | Next Article 
Journal of Clinical Microbiology, July 2000, p. 2516-2519, Vol. 38, No. 7
0095-1137/00/$04.00+0
A 5' Nuclease PCR (TaqMan) High-Throughput Assay
for Detection of the mecA Gene in Staphylococci
George E.
Killgore,1,*
Brian
Holloway,2 and
Fred C.
Tenover1
Hospital Infections
Program1 and Scientific Resources
Program,2 Centers for Disease Control and
Prevention, Atlanta, Georgia 30333
Received 27 January 2000/Returned for modification 24 March
2000/Accepted 15 April 2000
 |
ABSTRACT |
In an effort to find a rapid, efficient, and reliable method of
screening large numbers of bacterial isolates for specific antimicrobial resistance genes, we compared conventional PCR results to
the results generated using the TaqMan 5' nuclease PCR kit in
conjunction with an ABI Prism 7700 Sequence Detector for detecting the
mecA gene in various species of staphylococci. DNA was
extracted using two techniques. The first used a high-salt extraction
method suitable for conventional PCR but resulted in a 7.2% rate of
PCR inhibition with the TaqMan technique. PCR inhibition could be overcome by diluting samples 1:5 prior to testing. The second method
used the Qiagen QIAamp Tissue Kit; no instances of PCR inhibition were
encountered with this method. A total of 197 (96%) of the 206 samples
with no inhibition showed agreement between the two methods. Eight of
the nine disagreements were likely the result of low-level DNA cross
contamination caused by frequent specimen handling. Target DNA in all
eight of these samples was first detected in the initial tests only
after >30 PCR cycles, and all were negative upon repeat testing even
after 40 PCR cycles using freshly extracted DNA. Among those positive
samples in agreement, target DNA was invariably detected before 30 PCR
cycles. The TaqMan assay eliminated the need to load, run, stain, and
read agarose gels and provided the advantage of instant detection of
PCR product by laser-activated fluorescence. Thus, final results were
obtained 2 h after PCR was initiated, as opposed to a requirement
of 2 days to examine 96 samples by agarose gel electrophoresis.
| |
INTRODUCTION |
Staphylococci are among the most
frequent isolates from nosocomial infections, particularly from
nosocomial bloodstream infections. They often are resistant to
methicillin and other beta-lactam antimicrobial agents (3, 5, 18,
26). Methicillin-resistant Staphylococcus aureus
strains are found worldwide, predominantly in hospitalized patients,
and can spread rapidly from patient to patient and hospital to hospital
(1-3, 7, 20). Nosocomial methicillin-resistant S. aureus strains are frequently resistant to most other classes of
antimicrobial agents with the exception of glycopeptides
(15); however, a few recent S. aureus strains have been reported to show intermediate levels of resistance to the
glycopeptide vancomycin (11, 22).
The most frequent mechanism of methicillin resistance is mediated by
the mecA gene, which produces a novel penicillin binding protein, PBP 2A, with reduced affinity for beta-lactam agents. An
unusual characteristic, referred to as heterogeneous resistance, of
mecA-containing staphylococci is that there may be a wide
range of levels of resistance to methicillin within a cell population derived from a single isolate. While the majority of cells may show low
levels of resistance, subpopulations, often only 1 in 100,000 cells,
show very high resistance levels that can lead to treatment failure
regardless of phenotypic expression (23). For this reason it
is often desirable to use a DNA-based assay to detect the
mecA gene rather than rely on phenotypic susceptibility tests. PCR is one such DNA-based test that has gained widespread use
(10, 13, 24, 25). While they are very sensitive and specific, conventional PCR techniques that use agarose gel
electrophoresis to detect amplification products are not well suited
for rapid screening of large numbers of samples because of the limited
number of samples that can be analyzed per gel and the time required for loading, running, and staining gels. To overcome these limitations, we investigated the use of the TaqMan 5' nuclease PCR kit
(12) in conjunction with an ABI 7700 Sequence Detector for
rapid detection of the mecA gene in a variety of
staphylococcal isolates. This system uses both PCR primers and a
dye-labeled probe to detect the target sequence and provides an
instantaneous reading of the PCR result. TaqMan PCR has been used
successfully to detect specific DNA sequences from fungi
(4), bacteria (8, 9, 19), and viruses (14,
17, 21) and to quantitate bacterial load in clinical specimens
(6). The goal of this study was to compare the results of
the TaqMan system to those of conventional PCR for accuracy and
efficiency in detecting the mecA gene.
| |
MATERIALS AND METHODS |
Bacterial isolates.
A total of 222 staphylococcal isolates
from patients in four hospitals in three states were examined. These
included 76 nosocomial isolates of S. aureus and 146 coagulase-negative staphylococcal isolates from blood cultures (Table
1). Control organisms included S. aureus ATCC 43300 (mecA-positive control) and S. aureus ATCC 25923 (mecA-negative control).
DNA extraction.
DNA extraction was performed by two methods.
The first was the salting-out procedure modified from that described by
Miller et al. (16), in which bacterial cells approximating
one-quarter of a 10-µl loop were scraped from an overnight blood agar
plate, suspended in 455 µl of TEN buffer (10 mM Tris-HCl [pH 8.0],
1 mM EDTA [pH 8.0], 100 mM NaCl) containing 3 µg of lysostaphin per
ml, and incubated at 37°C for 15 min. Forty-five microliters of a
solution containing 0.8% Sarkosyl and 100 µg of proteinase K per ml
was added, and the tube was incubated at 37°C for 1.5 h. One
hundred microliters of 6 M NaCl was added and mixed by vortexing for
15 s before centrifugation at 750 × g for 15 min. The supernatant was transferred to a fresh tube, two volumes of absolute ethanol were added, and the mixture was centrifuged at 16,000 × g for 15 min. The DNA precipitate was rinsed
with 70% ethanol, centrifuged at 16,000 × g,
decanted, dried, resuspended in 400 to 600 µl of 10 mM Tris-1 mM
EDTA (pH 8.0), treated with RNase at 37°C for 30 min, and stored at
20°C until use.
Isolates were later recultivated, and the DNA was extracted by a second
method that utilized the Qiagen DNeasy 96 Tissue Kit with modifications
for DNA extraction from staphylococci. Briefly, using a 10-µl loop,
one-fourth of a loop of cells from an overnight blood agar plate was
placed in a 1.5-ml tube containing 180 µl of buffer (29 mM Tris-HCl
[pH 8.0], 2 mM EDTA, 1.2% Triton), 200 µg of lysozyme per ml, and
20 µg of lysostaphin per ml. The suspensions were incubated for
1.5 h at 37°C, 25 µl of proteinase K and 200 µl of kit
buffer AL were added and the suspension was mixed by vortexing. The
tubes were placed in a centrifuge block and incubated at 70°C for 30 min, and then 210 µl of ethanol was added to each tube. The tubes
were centrifuged in the block for 10 s at 1,450 × g, and 615-µl portions of the lysates were transferred to a DNeasy 96 plate, sealed with tape, and centrifuged at 5,800 × g for 10 min. The tape was removed, and 500 µl of kit buffer
AW2 was added to each well. The plate was resealed and centrifuged at
5,800 × g for 5 min. The tape was removed, and the
DNeasy 96 plate was placed on top of a collection microtube rack and
incubated at 70°C for 15 min in a dry oven. DNA was eluted by adding
200 µl of kit buffer AE preheated to 70°C, resealing, and
centrifuging at 5,800 × g for 2 min. The DNA solution
was treated with RNase at 37°C for 30 min and stored at 20°C
until use.
Conventional PCR.
PCR for detection of the mecA
gene was performed using primers M1 (TGG CTA TCG TGT CAC AAT CG)
and M2 (CTG GAA CTT GTT GAG CAG AG), described by
Vannuffel et al. (25). One microliter of template DNA was
added to 24 µl of reaction mixture consisting of Perkin-Elmer GeneAmp
PCR buffer II, 0.2 mM each deoxynucleoside triphosphate, 1.5 mM
MgCl2, 25 pmol of each mecA primer, 25 pmol of
each rRNA universal primer (16SRRI [CAG CAG CCG CGG TAA TAC] and 16SRRII [CCG TCA ATT CCT TTG AGT TT]) to check
for presence of template, and 2 U of Taq polymerase.
Amplification was performed in a Perkin-Elmer 9600 thermocycler. The
cycle program was 94°C for 3 min, 25 cycles of 95°C for 1 min,
56°C for 1 min, and 72°C for 1 min; and a final extension at 72°C
for 3 min. PCR product was detected by addition of 5 µl of sample
mixed with 1 µl of loading buffer and dye to a 1.5% agarose gel in
0.5× Tris-borate-EDTA and electrophoresis at 200V in a submarine gel
unit with 18°C circulating coolant. Electrophoresis was continued
until the bromophenol blue dye line migrated 10 cm. Gels were stained
with ethidium bromide and photographed.
TaqMan PCR.
Because of the need for optimal matching of
primer and probe annealing temperatures, a set of primers different
from the conventional PCR primers was prepared for TaqMan PCR. 5'
nuclease PCR primers and the DNA probe for the mecA gene
were selected using Primer Express software. The primers and probe were
prepared by the Centers for Disease Control and Prevention Molecular
Biology Core Facility as follows: Forward primer, 5'
TGCTAAAGTTCAAAAGAGTATTTATAACAACA 3'; reverse primer, 5'
TGTGCTTACAAGTGCTAATAATTCACC 3'; and probe, 5'ATTATGGCTCAGGTACTGCTATCCACCCTCAAA 3'. The PCR mixture was
prepared using TaqMan Universal PCR Master Mix and TaqMan Exogenous IPC reagents according to the manufacturer's instructions, except that the
final PCR mixture volume was 25 µl instead of 50 µl. Five
microliters of template DNA was added to each test well. Amplification
was performed on an ABI Prism 7700 Sequence Detector programmed to hold
at 50°C for 2 min, hold at 95°C for 10 min, and complete 40 cycles
of 95°C for 15 s and 60°C for 60 s. The data were
analyzed in both the real-time and plate read modes.
| |
RESULTS AND DISCUSSION |
Of the 222 staphylococci isolates extracted by the high-salt
method and examined by conventional PCR, all produced the expected 409-bp fragment when universal primers were used, indicating the presence of template DNA. However, 16 (7.2%) DNA samples extracted with the salt method and processed with the TaqMan assay showed PCR
inhibition as detected by the TaqMan internal positive control reagents
(Table 2). This inhibition could be
overcome by diluting the sample 1:5 in H2O or by preparing
a fresh DNA extraction with the Qiagen kit. No Qiagen kit-extracted DNA
showed PCR inhibition in either the PCR or TaqMan assay (Table 2). The
binding and washing steps in the Qiagen procedure result in a cleaner
product than the salting-out method, which uses only relatively
low-speed centrifugation to separate protein and DNA. This likely
accounts for the difference in PCR inhibition between the two
procedures.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Inhibition and false-positive results observed with
initial PCR testing and repeat testing results after 1:5 dilution or
fresh DNA extractiona
|
|
Initial testing included DNA samples from tubes that had been entered
several times, thus providing the opportunity for low-level cross
contamination of minute quantities of DNA that would not be detected by
conventional PCR because of the low cycle amplification number (25 cycles) and relative insensitivity of ethidium bromide for detecting
DNA in agarose. Using the TaqMan assay in plate read mode, the ABI 7700 takes only one reading of test and control wells after all PCR cycles
are completed and reports each test well as positive or negative after
comparing the fluorescence intensities measured in the test wells with
those of the control wells. The TaqMan assay is potentially much more
sensitive than conventional PCR using an agarose gel detection method,
because the TaqMan assay employs 40 amplification cycles, measures
changes in fluorescence intensity, and can detect template
concentrations in the femtogram range (Fig.
1). This enhanced sensitivity may explain
why the eight samples that were negative using the conventional PCR
assay tested positive by the TaqMan PCR assay. All eight samples were
negative by TaqMan when fresh DNA extracts were prepared. The single
sample that was positive by conventional PCR but negative by the TaqMan
assay during initial testing was positive in the TaqMan assay upon
repeat testing (Table 2).
View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1.
Assay sensitivity using a 10× dilution scheme.
 RN = (Rn+) (Rn ), where
Rn+ = (emission intensity of
reporter dye)/(emission intensity of passive reference dye) in PCR with
template and Rn = (emission
intensity of reporter dye)/(emission intensity of passive reference
dye) in PCR without template or early cycles of a real-time reaction.
Ct = threshold cycle, i.e., cycle at which a
statistically significant increase in Rn is first
detected.
|
|
In the real-time mode, the ABI 7700 instrument reads each well every
few seconds and computes a mean baseline reading for early PCR cycles.
Real-time results are reported as cycle threshold (Cj) values, the cycle at which fluorescence
readings exceed the mean baseline readings by 10 standard deviations.
Of the 140 samples that were positive for mecA by
conventional PCR, 139 had Ct values of <30
cycles. The one exception had a Ct value well
below 30 upon retesting. In comparing results, it was observed that the eight samples that were positive in plate read mode but with a real-time Ct value of >30 (Fig.
2) were invariably negative upon retesting using template DNA that was freshly extracted.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
PCR amplification in real-time mode. RN = (Rn+) (Rn), where
Rn+ = (emission intensity of
reporter dye)/(emission intensity of passive reference dye) in PCR with
template and Rn =(emission
intensity of reporter dye)/(emission intensity of passive reference
dye) in PCR without template or early cycles of a real-time reaction.
Ct = threshold cycle, i.e., cycle at which a
statistically significant increase in Rn is
first detected.
|
|
Using the Qiagen DNeasy kit, two 96-well blocks can be processed in 1 day for a total of 192 DNA extractions, compared to about 40 isolates
per day using the salt method. After the DNA was extracted,
conventional PCR and gel electrophoresis using one gel box required a
full day to obtain results for 40 samples. Because the gel
electrophoresis step is eliminated with the ABI Prism 7700 sequencing
detector, the TaqMan PCR and analysis can be performed on DNA samples
in a 96-well plate in 2 h.
The cost for materials and reagents for DNA extraction with the Qiagen
DNeasy kit was approximately $2.00 per sample, and the cost of reagents
for the TaqMan procedure was $2.90 per sample, for a total cost per
isolate of $4.90 (excluding labor). The list price for the ABI 7700 sequence detector is approximately $95,000.00.
The combination of DNA extraction with the Qiagen DNeasy kit and use of
the TaqMan assay kit is well suited to large-scale screening for the
mecA gene in staphylococci. In our laboratory, it increased
output at least threefold. The TaqMan procedure appears to be much more
sensitive than our conventional PCR method for target detection. When
using relatively high copy numbers of target DNA as provided by the
extraction techniques, low-level cross contamination can be a problem
upon repeated entry into a sample. Samples should be aliquoted to avoid
this, and samples that are positive in plate read mode with a real-time
Ct value of >30 should be reevaluated.
| |
ACKNOWLEDGMENTS |
We thank Susie Hubert for providing strains and Chris Steward for
helpful discussions.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Hospital
Infections Program (G08), Centers for Disease Control and Prevention,
1600 Clifton Rd., Atlanta, GA 30333. Phone: (404) 639-0192. Fax: (404) 639-1381. E-mail: gek1{at}cdc.gov.
| |
REFERENCES |
| 1.
|
Aires de Sousa, M.,
I. S. Sanches,
M. L. Ferro,
M. J. Vaz,
Z. Saraiva,
T. Tendeiro,
J. Serra, and H. de Lencastre.
1998.
Intercontinental spread of a multidrug-resistant methicillin-resistant Staphylococcus aureus clone.
J. Clin. Microbiol.
36:2590-2596[Abstract/Free Full Text].
|
| 2.
|
Ayliffe, G. A. J.
1997.
The progressive intercontinental spread of methicillin-resistant Staphylococcus aureus.
Clin. Infect. Dis.
24(Suppl. 1):S74-S79.
|
| 3.
|
Boyce, J. M.
1992.
Methicillin-resistant Staphylococcus aureus in hospitals and longterm care facilities: microbiology, epidemiology, and preventive measures.
Infect. Control Hosp. Epidemiol.
13:725-737[Medline].
|
| 4.
|
Brandt, M. E.,
A. A. Padhye,
L. W. Mayer, and B. P. Holloway.
1998.
Utility of random amplified polymorphic DNA PCR and TaqMan automated detection in molecular identification of Aspergillus fumigatus.
J. Clin. Microbiol.
36:2057-2062[Abstract/Free Full Text].
|
| 5.
|
Cockerill, F. R., III,
J. G. Hughes,
E. A. Vetter,
R. A. Mueller,
A. L. Weaver,
D. M. Ilstrup,
J. E. Rosenblatt, and W. R. Wilson.
1997.
Analysis of 281,797 consecutive blood cultures performed over an eight-year period: trends in microorganisms isolated and the value of anaerobic culture of blood.
Clin. Infect. Dis.
24:403-418[Medline].
|
| 6.
|
Desjardin, L. E.,
Y. Chen,
M. D. Perkins,
L. Teixeira,
M. D. Cave, and K. D. Eisenbach.
1998.
Comparison of the ABI 7700 System (TaqMan) and competitive PCR for quantification of IS6110 DNA in sputum during treatment for tuberculosis.
J. Clin. Microbiol.
36:1964-1968[Abstract/Free Full Text].
|
| 7.
|
Dominguez, M. A.,
H. de Lancaster,
J. Linares, and A. Tomasz.
1994.
Spread of a dominant methicillin-resistant Staphylococcus aureus (MRSA) clone during an outbreak of MRSA disease in a Spanish hospital.
J. Clin. Microbiol.
32:2081-2087[Abstract/Free Full Text].
|
| 8.
|
Everett, K. D. E.,
L. J. Hornung, and A. A. Andersen.
1999.
Rapid detection of the Chlamydiaceae and other families in the order Chlamydiales: three PCR tests.
J. Clin. Microbiol.
37:575-580[Abstract/Free Full Text].
|
| 9.
|
Higgins, J. A.,
J. Ezzell,
J. Hinnebusch,
M. Shipley,
E. A. Henchal, and M. S. Ibrahim.
1998.
5' nuclease PCR assay to detect Yersinia pestis.
J. Clin. Microbiol.
36:2284-2288[Abstract/Free Full Text].
|
| 10.
|
Hiramatsu, K.,
H. Kihara, and T. Yokota.
1992.
Analysis of borderline-resistant strains of methicillin-resistant Staphylococcus aureus using polymerase chain reaction.
Microbiol. Immunol.
36:445-453[Medline].
|
| 11.
|
Hiramatsu, K.,
H. Hanaki,
T. Ino,
K. Yabuta,
T. Oguri, and F. C. Tenover.
1997.
Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility.
J. Antimicrob. Chemother.
40:135-136[Free Full Text].
|
| 12.
|
Holland, P. M.,
R. D. Abramson,
R. Watson, and D. H. Gelfand.
1991.
Detection of specific polymerase chain reaction product by utilizing the 5' to 3' exonuclease activity of Thermus aquaticus DNA polymerase.
Proc. Natl. Acad. Sci. USA
88:7276-7280[Abstract/Free Full Text].
|
| 13.
|
Kobayashi, N.,
H. Wu,
K. Kajima,
K. Taniguchi,
S. Urasawa,
N. Uehara,
Y. Omizu,
Y. Kishi,
A. Yagihashi, and I. Kurokawa.
1994.
Detection of mecA, femA, and femB genes in clinical strains of staphylococci using polymerase chain reaction.
Epidemiol. Infect.
113:259-266[Medline].
|
| 14.
|
Laue, T.,
P. Emmerich, and H. Schmitz.
1999.
Detection of dengue virus RNA in patients after primary or secondary dengue infection by using the TaqMan Automated Amplification System.
J. Clin. Microbiol.
37:2543-2547[Abstract/Free Full Text].
|
| 15.
|
Lowy, F. D.
1998.
Staphylococcus aureus infections.
N. Engl. J. Med.
339:520-532[Free Full Text].
|
| 16.
|
Miller, S. A.,
D. D. Dykes, and H. F. Polesky.
1988.
A simple salting out procedure for extracting DNA from human nucleated cells.
Nucleic Acids Res.
16:1215[Free Full Text].
|
| 17.
|
Morris, T.,
B. Robertson, and M. Gallagher.
1996.
Rapid reverse transcription PCR detection of hepatitis C virus RNA in serum by using the TaqMan fluorogenic detection system.
J. Clin. Microbiol.
34:2933-2936[Abstract].
|
| 18.
|
National Nosocomial Infections Surveillance System.
1998.
National Nosocomial Infections Surveillance (NNIS) report, data summary from October 1986-April 1998, issued June 1998.
Am. J. Infect. Control
26:522-533[CrossRef][Medline].
|
| 19.
|
Pusteria, N.,
J. B. Hunder,
C. M. Leutenegger,
U. Braun,
J. E. Madigan, and H. Lutz.
1999.
Quantitative real-time PCR for detection of members of the Ehrlichia phagocytophila genogroup in host animals and Ixodes ricinus ticks.
J. Clin. Microbiol.
37:1329-1331[Abstract/Free Full Text].
|
| 20.
|
Roman, R. S.,
J. Smith,
M. Walker,
S. Byrne,
K. Ramotar,
B. Dycjk,
A. Kabani, and L. E. Nicolle.
1997.
Rapid geographic spread of a methicillin-resistant Staphylococcus aureus strain.
Clin. Infect. Dis.
25:698-705[Medline].
|
| 21.
|
Ryncarz, A.,
J. Goddard,
A. Wald,
M.-L. Huang,
B. Roizman, and L. Corey.
1999.
Development of a high-throughput quantitative assay for detecting herpes simplex virus DNA in clinical samples.
J. Clin. Microbiol.
37:1941-1947[Abstract/Free Full Text].
|
| 22.
|
Tenover, F. C.,
M. V. Lancaster,
B. C. Hill,
C. D. Steward,
S. A. Stocker,
G. A. Hancock,
C. M. O'Hara,
S. A. McAllister,
N. C. Clark, and K. Hiramatsu.
1998.
Characterization of staphylococci with reduced susceptibilities to vancomycin and other glycopeptides.
J. Clin. Microbiol.
36:1020-1027[Abstract/Free Full Text].
|
| 23.
|
Tomasz, A.,
S. Nachman, and H. Leaf.
1991.
Stable classes of phenotypic expression in methicillin-resistant clinical isolates of staphylococci.
Antimicrob. Agents Chemother.
35:124-129[Abstract/Free Full Text].
|
| 24.
|
Unal, S.,
J. E. Hoskins,
C. Y. E. Iokowitsch,
D. A. Preston, and P. E. Skatrud.
1992.
Detection of methicillin-resistant staphlococci by using the polymerase chain reaction.
J. Gen. Microbiol.
30:1685-1691.
|
| 25.
|
Vannuffel, P.,
J. Gigi,
H. Ezzedine,
B. Vanderman,
M. Delmee,
G. Wauters, and J.-L. Gala.
1995.
Specific detection of methicillin-resistant Staphylococcus species by multiplex PCR.
J. Clin. Microbiol.
33:2864-2867[Abstract].
|
| 26.
|
Weinstein, M. P.,
M. L. Towns,
S. M. Quartey,
S. Mirrett,
L. G. Reimer,
G. Parmigiani, and L. B. Reller.
1997.
The clinical significance of positive blood cultures in the 1990s: a prospective comprehensive evaluation of the microbiology, epidemiology, and outcome of bacteremia and fungemia in adults.
Clin. Infect. Dis.
24:584-602[Medline].
|
Journal of Clinical Microbiology, July 2000, p. 2516-2519, Vol. 38, No. 7
0095-1137/00/$04.00+0
This article has been cited by other articles:
-
Tenover, F. C., McAllister, S., Fosheim, G., McDougal, L. K., Carey, R. B., Limbago, B., Lonsway, D., Patel, J. B., Kuehnert, M. J., Gorwitz, R.
(2008). Characterization of Staphylococcus aureus Isolates from Nasal Cultures Collected from Individuals in the United States in 2001 to 2004. J. Clin. Microbiol.
46: 2837-2841
[Abstract]
[Full Text]
-
Ruimy, R., Dos-Santos, M., Raskine, L., Bert, F., Masson, R., Elbaz, S., Bonnal, C., Lucet, J.-C., Lefort, A., Fantin, B., Wolff, M., Hornstein, M., Andremont, A.
(2008). Accuracy and Potential Usefulness of Triplex Real-Time PCR for Improving Antibiotic Treatment of Patients with Blood Cultures Showing Clustered Gram-Positive Cocci on Direct Smears. J. Clin. Microbiol.
46: 2045-2051
[Abstract]
[Full Text]
-
Espy, M. J., Uhl, J. R., Sloan, L. M., Buckwalter, S. P., Jones, M. F., Vetter, E. A., Yao, J. D. C., Wengenack, N. L., Rosenblatt, J. E., Cockerill, F. R. III, Smith, T. F.
(2006). Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. Clin. Microbiol. Rev.
19: 165-256
[Abstract]
[Full Text]
-
Wisplinghoff, H., Ewertz, B., Wisplinghoff, S., Stefanik, D., Plum, G., Perdreau-Remington, F., Seifert, H.
(2005). Molecular Evolution of Methicillin-Resistant Staphylococcus aureus in the Metropolitan Area of Cologne, Germany, from 1984 to 1998. J. Clin. Microbiol.
43: 5445-5451
[Abstract]
[Full Text]
-
Warren, D. K., Liao, R. S., Merz, L. R., Eveland, M., Dunne, W. M. Jr.
(2004). Detection of Methicillin-Resistant Staphylococcus aureus Directly from Nasal Swab Specimens by a Real-Time PCR Assay. J. Clin. Microbiol.
42: 5578-5581
[Abstract]
[Full Text]
-
Carneiro, L. A.M., Queiroz, M. L.P., Merquior, V. L.C.
(2004). Antimicrobial-resistance and enterotoxin-encoding genes among staphylococci isolated from expressed human breast milk. J Med Microbiol
53: 761-768
[Abstract]
[Full Text]
-
Mothershed, E. A., Cassiday, P. K., Pierson, K., Mayer, L. W., Popovic, T.
(2002). Development of a Real-Time Fluorescence PCR Assay for Rapid Detection of the Diphtheria Toxin Gene. J. Clin. Microbiol.
40: 4713-4719
[Abstract]
[Full Text]
-
Knutsson, R., Lofstrom, C., Grage, H., Hoorfar, J., Radstrom, P.
(2002). Modeling of 5' Nuclease Real-Time Responses for Optimization of a High-Throughput Enrichment PCR Procedure for Salmonella enterica. J. Clin. Microbiol.
40: 52-60
[Abstract]
[Full Text]
Top
Abstract
Introduction
