Previous Article | Next Article 
Journal of Clinical Microbiology, August 2000, p. 2917-2922, Vol. 38, No. 8
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Sequence Analysis of the ank Gene of
Granulocytic Ehrlichiae
Robert F.
Massung,1,*
Jessica H.
Owens,1
David
Ross,1
Kurt D.
Reed,2
Miroslav
Petrovec,3
Anneli
Bjoersdorff,4
Richard T.
Coughlin,5
Gerald A.
Beltz,5 and
Cheryl I.
Murphy5
Division of Viral and Rickettsial Diseases, Centers for
Disease Control and Prevention, Atlanta,
Georgia1; Marshfield Clinic and
Marshfield Medical Research Foundation, Marshfield,
Wisconsin2; Institute of Microbiology
and Immunology, Medical Faculty, University of Ljubljana, Ljubljana,
Slovenia3; Department of Clinical
Microbiology, Kalmar County Hospital, Kalmar,
Sweden4; and Aquila Biopharmaceuticals,
Inc., Framingham, Massachusetts5
Received 3 January 2000/Returned for modification 14 March
2000/Accepted 28 April 2000
 |
ABSTRACT |
The ank gene of the agent of human granulocytic
ehrlichiosis (HGE) codes for a protein with a predicted molecular size
of 131.2 kDa that is recognized by serum from both dogs and humans infected with granulocytic ehrlichiae. As part of an effort to assess
the phylogenetic relatedness of granulocytic ehrlichiae from different
geographic regions and in different host species, the ank
gene was PCR amplified and sequenced from a variety of sources. These
included 10 blood specimens from patients with confirmed human
granulocytic ehrlichiosis (three from New York, four from Wisconsin,
two from Slovenia, and one from Sweden). Also examined was a canine
granulocytic ehrlichia sample obtained from Minnesota, Ehrlichia
equi from California, Ehrlichia phagocytophila from
Sweden, and the granulocytic ehrlichia isolate USG3. The sequences
showed a high level of homology (>95.5% identity), with the lowest
homology occurring between a New York HGE agent and the Swedish
E. phagocytophila. Several 3-bp deletions and a variable number of 51- and 81-bp direct repeats were noted. Although the North
American HGE sequences showed the highest conservation (>98.1% identity), phylogenetic analyses indicated that these samples represent
two separate clades, one including the three New York HGE samples and
the USG3 strain and another with the Wisconsin HGE and Minnesota canine
sequences. Two of the New York samples and the USG3 strain showed 100%
identity over the entire 3,696-bp product. Likewise, three of the
Wisconsin human samples and the Minnesota dog sample were identical
(3,693 bp). Whereas phylogenetic analysis showed that the E. equi sequence was most closely related to the Upper Midwest
samples, analysis of the repeat structures showed it to be more similar
to the European samples. Overall, the genetic analysis based on the
ank gene showed that the granulocytic ehrlichiae are
closely related, appear to infect multiple species, and can be grouped
into at least three different clades, two North American and one European.
 |
INTRODUCTION |
The members of the genus
Ehrlichia are obligate, intracellular bacteria within the
order Rickettsiales. Although ehrlichia infections of
veterinary importance were first described in 1935, the first case of
human ehrlichiosis in the United States was reported in 1987 (17). The human pathogen was subsequently identified as
Ehrlichia chaffeensis (1). In 1994, a second
ehrlichia infection of humans was reported and has been referred to as
human granulocytic ehrlichiosis (HGE) owing to the proclivity of the
agent to infect neutrophils (5). The majority of HGE cases
have been diagnosed in the Northeastern and Upper Midwestern areas of
the United States, although a limited number of cases have been
reported in Europe and in northern California (2, 4, 9-12, 22,
26).
The genus Ehrlichia has been divided into three genogroups
based on analysis of 16S rRNA sequences, and the HGE agent is a member
of the Ehrlichia phagocytophila genogroup (29).
E. phagocytophila is the etiologic agent of tick-borne fever
in ruminants in Europe, and the E. phagocytophila genogroup
also includes Ehrlichia equi, the agent of equine
granulocytic ehrlichiosis. These three granulocytic ehrlichiae (GE) are
very closely related based on numerous criteria including the high
degree of homology of the 16S rRNA and groE DNA sequences
and may represent strains of a single species (5, 14, 25).
However, the analysis of genetic elements less conserved than the 16S
and groE sequences is needed to accurately assess the
phylogenetic relationship of these agents and the degree of variability
at the subspecies level. Recently, several genes that may encode
structural proteins were identified from an HGE agent (USG3 strain)
expression library and were recognized by serum from humans and canines
infected with GE (24). One of these is referred to as the
ank gene, owing to a series of repeats within the predicted
131.2-kDa protein product that are similar to the repeats within the
human erythrocyte ankyrin protein (24). We have PCR
amplified and sequenced the complete ank gene open reading frame and 28 bp 5' of the initiating methionine and 13 bp downstream from the termination codon. Samples examined were the HGE agent from 10 confirmed cases (3 from New York, 4 from Wisconsin, 1 from Sweden, and
2 from Slovenia), a canine granulocytic ehrlichiosis agent from a
Minnesota dog, E. equi, and E. phagocytophila
from a Swedish cow.
 |
MATERIALS AND METHODS |
Samples and sample preparation.
All samples, except for the
USG3 strain, were obtained as EDTA blood specimens. Human samples were
from HGE cases confirmed by seroconversion or by amplification and DNA
sequencing of the 16S rRNA gene. The Swedish sample was from a
32-year-old previously healthy woman who presented at an outpatient
clinic in Ronneby (Blekinge County, southern Sweden), with a 5-day
history of fever (38 to 39°C), chills, headache, and myalgia. The
patient worked part-time as a farmer, and she had recently been
involved in the hunting and handling of a slaughtered roebuck. She also
reported that she had sustained five or six tick bites during the month prior to admission. The patient's acute-phase blood showed a
reciprocal titer of 1:160 and was PCR positive when tested at the
Centers for Disease Control and Prevention using the 16S rRNA gene as the target (data not shown).
DNA was extracted directly from the North American and Swedish blood
samples by using a QIAamp blood extraction kit (Qiagen, Chatsworth,
Calif.). The protocol followed was that suggested by the manufacturer.
Briefly, detergent lysis was performed in the presence of proteinase K
for 10 min at 70°C. The lysed material was applied to a spin column
containing a silica gel-based membrane and washed twice. Purified DNA
was eluted from the columns in 200 µl of Tris (10 mM, pH 8.0) and
stored at 4°C until used as template for PCR amplification.
DNA was extracted from the Slovenian EDTA blood samples using a
modification of the manufacturer's protocol for the QIAamp
tissue kit
(Qiagen) as previously described (
22). The USG3 strain
preparation and the determination of the sequence of the
ank
gene
have been described previously (GenBank accession no.
AF020521)
(
24). Horse blood infected with
E. equi was
kindly provided
by Richard Corstevet (Louisiana State
University).
PCR analysis.
Both nested and direct PCR protocols were
used. Direct PCR amplifications consisted of 40 cycles with each cycle
including a 30-s denaturation at 94°C, a 30-s annealing at 55°C,
and a 1-min extension at 72°C. The 40 cycles were preceded by a 2-min
denaturation at 95°C and followed by a 5-min extension at 72°C. PCR
amplifications were performed in a Perkin-Elmer 9600 thermal cycler
(Perkin-Elmer, Applied Biosystems Division, Foster City, Calif.), and
reagents were from the GeneAmp PCR Kit with AmpliTaq DNA polymerase
(Perkin-Elmer). Primary reactions used 5 µl of purified DNA as
template in a total volume of 50 µl. Amplifications contained 200 µM (each) deoxynucleotide triphosphates (dATP, dCTP, dGTP, and dTTP),
1.25 U of Taq polymerase, and 0.5 µM (each) primer.
Reaction products were subsequently maintained at 4°C until analyzed
by agarose gel electrophoresis or used as template for nested reactions.
Nested amplifications used 1 µl of the primary PCR product as
template in a total volume of 50 µl. Each nested amplification
contained 200 µM (each) deoxynucleoside triphosphates (dATP, dCTP,
dGTP, and dTTP), 1.25 U of
Taq polymerase, and 0.2 µM
(each) primer.
Nested cycling conditions were as described for the
primary amplification,
except that 30 cycles were used. Reaction
mixtures were subsequently
maintained at 4°C until analyzed by
agarose gel electrophoresis
or purified for DNA
sequencing.
Primers used for PCR amplification and sequencing were as follows: 1F,
ATGTTACGCTGTAATAGCATGGAC; 1R, TGCCCCAGCTTCTACAACAC;
2F1, CTGATGTAAATGCGTCTCCA; 2R1,
ACCATTTGCTTCTTGAGGAG; 3F, GTCTCGAAAGCATTTGTCAAAC;
3R, TTTCTCCCTTAGATGACGCC; 4F1,
GCTGCAATTACTTCCGAGGC; 4R1, GCGACCTCCTTTTACAGACTTAG;
U3, GAGGGCAATCGCGAGTGTGCAG; U5,
GAACAAGCACGTGAGAAGGCAGG; U7, GCGTCTGTAAGGCAGATTGTG;
U8, TAAGATAGGTTTAGTAAGACG; 1R1,
TATACACCTGGAGTAGGAAC; 1R2, AATAACTACTCTTCCTTCC;
1R4, CATACTGTACTGCACTCATCC; 1R7,
TGCATCGTCATTACGCACAAGGTC; 4F2,
TGCTCCGGATTCTACCAAAG;
4F3, AAGGAACTAACAAAAGCTCC; D1, TATTGATCAAAGTAC
CTCAGCG; and D2,
GCCTAAATACTCAGAAGCGCG.
DNA sequencing and data analysis.
DNA sequencing reactions
used fluorescently labeled dideoxynucleotide technology (dye terminator
cycle sequencing ready reaction kit; Perkin-Elmer). Sequencing reaction
products were separated, and data were collected using an ABI 377 automated DNA sequencer (Perkin-Elmer). The sequence was fully
determined for both strands of each DNA template to ensure maximum
accuracy of the data. Sequences were edited and assembled using the
Staden software programs (6) and analyzed using the
Wisconsin Sequence Analysis Package (Genetics Computer Group, Madison,
Wis.) (8).
Sequences were aligned using the Pileup program of the GCG package
(
8). Phylogenetic analysis was performed with the PAUP
program (version 4.0.0d64) on a Power Macintosh 9500/132. The
maximum
parsimony optimality criterion was used for a heuristic
search, and the
resulting unrooted tree was the product of 100
bootstrap
replicates.
Nucleotide sequence accession numbers.
GenBank accession
numbers for the ank gene sequences are as follows: EE
(E. equi), AF100882; NY1, AF100883; NY2, AF100884; NY3,
AF100885; Sl-HG1, AF100886; Sl-HG2, AF100887; Sw-HG, AF100888; EP
(E. phagocytophila), AF100889; WI1, AF100890; WI2, AF100891;
WI3, AF100892; WI4, AF100893; and MN-dog, AF100894.
 |
RESULTS |
PCR amplification.
The complete ank gene, including
28 bp upstream of the start codon and 16 bp downstream from the stop
codon, was amplified by using a combination of multiple primers and a
nested PCR strategy. PCR primers were initially designed based on the
ank gene sequence of the USG3 strain (24).
Additional sequencing of the ank gene from this strain
revealed that the open reading frame consists of 3,696 and not 2,244 bp
as originally reported (24). The ank gene was
divided into seven overlapping regions of 550 to 600 bp, and primer
sets were designed to specifically amplify each of these regions. The
locations of primers used for PCR and sequencing are shown in Fig.
1. A nested PCR strategy was used to
amplify the ank gene for two reasons. First, the initial
direct PCR amplification attempts resulted in little or no product with
many of the templates (data not shown) because many of the clinical
samples used in this study contained a low concentration of the
ehrlichial agents. Second, several samples were limited by the volume
of the sample. Therefore, a nested protocol that allowed both increased
sensitivity and conservation of limited amounts of samples was
developed. The primary reactions used primers U7 and 1R1 to amplify the
5' portion of the gene and primers 1F and 4R1 for the 3' region. The
products of these reactions were used as templates for each of the
specific nested or heminested reactions for the seven regions. The
downstream regions were subsequently amplified independently by using
primary reactions with 4F2 and D2 followed by nested reactions using
4F3 and D1.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Primers used for amplification of the ank
gene and topography of the deduced Ank protein. The rectangle
represents the coding region in 5'-to-3' orientation. The length
indicated for the open reading frame (3,696 bp) is for the USG3 strain.
The location and orientation of the primers used for PCR amplification
and DNA sequencing are shown relative to the ank gene coding
region. The products of each primer pair are shown as dashed lines.
Superimposed on the coding region are the ankyrin-repeat region and the
region of the coding sequence containing the three types of repetitive
elements in the deduced Ank protein for the USG3 strain of the HGE
agent.
|
|
DNA sequence analysis.
The samples that were used for PCR
amplification and sequencing of the ank gene are shown in
Table 1. The total number of base pairs
sequenced from each specimen and the predicted number of amino acids
encoded within the gene are also shown in Table 1. The 28 bp upstream
of the predicted initiating codon and 16 bp downstream of the stop
codon were identical in length for each sample used in this study. Each
of the three human samples from New York showed an ank
coding region equal in length to that of the USG3 reference strain
(3,696 bp), and the nucleotide sequences for two of the New York
samples (NY1 and NY2) were identical to the nucleotide sequence of the
USG3 strain. Likewise, each of the samples from the Upper Midwest (WI1,
WI2, WI3, WI4, and MN-dog) showed sequences of equal size
(ank coding region of 3,693 bp), and the E. equi
and E. phagocytophila sequences were of equal size (3,615 bp). In contrast, each of the three European HGE sequences showed
unique sizes: 3,618 bp for the Swedish HGE agent and 3,669 and 3,720 bp
for the Slovenian samples. A feature unique to the Northeastern U.S.
samples (New York and USG3) is a 3-bp insertion (TTT) at nucleotide
position 2470 that is absent in all other samples examined in this
study. This single codon insertion is also responsible for the 3-bp
difference in size between the New York (3,696-bp) and the Upper
Midwest (3,693-bp) samples.
The nucleotide sequences were aligned, and the calculated percent
identities are shown in Table
2. The
nucleotide homology
among the North American HGE samples was very high,
with a range
of 98.16 to 100%. The sequences for four of the five
samples from
the Upper Midwest (WI2, WI3, WI4, and MN-dog) were
identical.
The remaining Upper Midwest sample (human WI1) showed
99.95% identity
to each of the other Midwestern sample sequences
because of a
2-bp difference. Regarding the samples from the
Northeastern United
States, the NY1, NY2, and USG3 samples were
identical and differed
from the NY3 sample by a single nucleotide
(99.97% identity).
Comparing the North American HGE sequences to the
European HGE
sequences showed a range of 95.54% (for NY3 and Sl-HG2)
to 97.22%
(WI2 and Sw-HG) identity. The
E. equi sequence
showed highest
homology to the sequences of the Wisconsin and Minnesota
samples
(99.18 to 99.24%), less homology to the New York samples
(97.90
to 97.92%), and least homology to the European HGE and
E. phagocytophila samples (96.70 to 97.46%). Conversely, the
E. phagocytophila sequence
was most homologous to the
European HGE sequences (97.76 to 97.79%)
and showed less homology to
the sequences from the North American
samples (95.90 to 96.56%).
Protein sequence analysis.
The predicted amino acid sequences
were also aligned, and the percent identities are shown in Table 2.
Similar to the nucleotide sequence results, the amino acid sequences
clearly could be classified as belonging in one of two groups, either
North American or European, and the North American group could be
further subdivided into either Upper Midwest or Northeastern samples.
Interestingly, the percent identities between the groups were lower for
the amino acid sequences than for the nucleotide sequences, indicating
that many of the nucleotide changes represent nonsilent mutations that result in protein sequence variations. Amino acid homology between the
Upper Midwest and Northeastern samples ranged from 96.34 to 96.43%. In
contrast, the amino acid sequences of each of the four samples from the
Northeast were identical, and only a single amino acid difference was
noted among the Upper Midwest samples (99.92% identity). The homology
within the European HGE group was also very high and ranged from 99.92 to 100%. The Swedish E. phagocytophila sequence (EP) showed
lower homology, with a range from 92.61 to 93.61% identity to members
of the North American group and from 95.44 to 95.52% identity to the
European HGE group. The highest percent identity noted between members
of the European and North American groups was 95.27% (Sw-HG and WI2).
The nucleotide and amino acid sequence analyses described above and
shown in Table
2 suggest the existence of three distinct
groups of the
HGE agent (Northeast United States, Upper Midwest
United States, and
European), with a high degree of homology within
each group and lesser
homology between groups. The homologies
among these three groups of the
HGE agent were examined further
by dividing the Ank protein into two
regions: an 850-residue amino-terminal
region (849 residues for Upper
Midwest samples) that includes
the ankyrin repeat elements and a
carboxyl-terminal region ranging
from 356 residues (Sw-HG) to 390 residues (Sl-HG2) that contains
the 27-, 17-, and 11-residue repeats.
In comparison of only the
residues that were conserved among each
member of a given group,
the protein coding changes were relatively
evenly distributed
between the amino-terminal and carboxyl-terminal
regions in comparing
the European group to either of the North American
groups. The
corresponding N-terminal region comparison showed
identities ranging
from 92% (European to Northeastern United States)
to 94.7% (European
to Midwestern United States), while the C-terminal
region homology
was 94.3% (European to either Northeastern or
Midwestern United
States). In contrast, the same comparison between the
two North
American groups showed that the N-terminal regions of the
proteins
were considerably more variable (93.8% identity) than the
C-terminal
regions of the proteins (99.7%
identity).
Repetitive elements.
The sequence of the ank gene
for the USG3 strain showed two copies of an 81-bp (27-amino-acid)
repeat beginning at nucleotide position 2828 (23). This
repeat was also found in the ank gene sequence for each of
the North American HGE agent samples and the Minnesota canine sample.
However, only a single copy of the 81-bp sequence was found in the
E. equi sequence, resulting in an 81-bp deletion in the
E. equi ank gene relative to the other North American
samples that were tested. Similarly, a single copy of the 81-bp element
was present in each of the European samples. The Slovenian
ank gene sequences also showed a variable number of copies
of a 51-bp (17-amino-acid) repetitive element located directly adjacent
to and downstream from the 81-bp element. Whereas each of the North
American, Swedish HGE (Sw-HG), and E. phagocytophila (EP)
samples showed a single copy of this 51-bp sequence, the Slovenian HGE
samples (Sl-HG1 and Sl-HG2) showed two and three copies of the element,
respectively. Two 11-amino-acid repeats were conserved in all samples
examined. The arrangement of these repetitive elements (represented by
the number of amino acids) within the ank gene for each
sample examined is shown in Fig. 2.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2.
Variable number of repetitive elements within the
ank gene. The number of 81-bp (27-amino-acid) and 51-bp
(17-residue) repeats and the arrangement of the repeats are shown for
the GE examined. N.A., North American; E. phag., E. phagocytophila.
|
|
Phylogenetic analysis.
The ank gene sequences were
used as a phylogenetic tool to assess the relationship of the GE that
were examined in this study. Samples with sequences that were identical
were removed from the analysis but are shown in the phylogram in Fig.
3. These results separate the North
American samples into two clades, one including the New York HGE and
USG3 samples and another with the Wisconsin HGE and Minnesota dog
samples. Likewise, the phylogram effectively positions the four
European samples in a separate clade. The position of the E. equi sequence in the Upper Midwest clade is supported by 72 bootstrap replicates.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3.
Phylogenetic analysis of the GE based on the
ank gene DNA sequences using maximum parsimony as the
optimality criterion. The number of bootstrap replicates (from a total
of 100) that were in agreement are shown on each branch. Branches
without bootstrap values represent polytomies that could not be
resolved because the sequences were too similar.
|
|
 |
DISCUSSION |
Members of the GE genogroup have been shown to cause disease in
numerous vertebrate species including dogs, cattle, sheep, horses, and
humans. To date, analysis of the members of this group at the molecular
level has consisted primarily of examination of the DNA sequence of the
16S rRNA gene. These analyses have shown very little difference within
the 16S rRNA sequences, suggesting that the HGE agent, E. equi, and E. phagocytophila represent strains of a
single species. Additionally, the 16S rRNA sequences determined for the
HGE agent from confirmed human cases from both North America (Upper
Midwest and Northeast) and Europe, including those used in this study,
have been identical, suggesting that the agent causing human disease in
these areas may represent a single strain. Recently, two human cases
were reported from northern California that showed 16S rRNA sequences
differing from the HGE agent by 1 bp and identical to the E. equi sequence, suggesting that an E. equi-like strain
may be causing infections in northern California (10). In
contrast to the 16S rRNA data, studies using DNA sequence and Western
blot analyses of the major antigenic proteins have suggested a high
degree of variability among HGE isolates from both the Northeastern and
Upper Midwestern United States (13, 32, 33). Although
analysis of the 16S rRNA gene sequence is a powerful tool for
identifying novel agents and for determining relatedness at the genus
and species level, the strong conservation of the 16S rRNA makes it
less than ideal for differentiation of closely related species or
subspecies. Sequences of genetic elements more variable than the highly
conserved ribosomal subunits and housekeeping genes, such as genes
encoding structural proteins, are often needed to make these
determinations. Recently, the sequences of several genes encoded by the
GE strain USG3 were determined, one of these being the ank
gene. Analysis of the predicted peptide sequence suggested that the
ank gene may encode a structural protein, and in this study
the complete sequence of the ank gene was determined for 13 members of the E. phagocytophila genogroup including samples from 10 confirmed HGE cases.
Phylogenetic analysis of the ank gene sequences separated
the HGE agent into three distinct clades representing the U.S.
Northeast and Upper Midwest and Europe. Analysis of the ank
gene sequence thereby represents the first epidemiologic tool able to
differentiate the HGE agent based on geographic origin of the sample
and the first to indicate that the etiologic agents of HGE present in each of these locations are evolving independently. The sequence conservation noted for the HGE agent sequences within each of the three
clades was remarkably high, with both nucleotide and amino acid
identities of >99.9%. This was in contrast to nucleotide and amino
acid sequence homologies among members of the three clades that were
significantly lower (nucleotide sequence identity of <98.2%; amino
acid identity of <96.5%). Numerous identical sequences were noted for
members within the same clade, including three of the four samples from
the U.S. Northeast. Likewise, three of the four HGE agent samples from
the Upper Midwest were identical. The samples from the Northeast were
also collected in three different years, 1993 (USG3), 1994 (NY2), and
1996 (NY1 and NY3), suggesting that there is minimal year-to-year
variation within this population. Furthermore, PCR amplification and
DNA sequencing of a 500-bp region of the ank gene from
additional samples collected from confirmed HGE cases in Minnesota,
Wisconsin, and Connecticut support the results described herein and the
conclusion that two distinct clonal populations of the HGE agent exist
in the United States, defined by geographic location, Northeast and
Upper Midwest (data not shown).
The USG3 strain was isolated from a canine infected by allowing
Ixodes scapularis ticks collected from Westchester County, N.Y., and Montgomery County, Pa., to feed. The isolation of this strain
has raised questions concerning the authenticity of the USG3 strain as
a representative of the HGE agent and the efficacy of using this strain
as an antigen for serodiagnostic purposes (19, 31). However,
the sequence determined for the ank gene of the USG3 strain
was identical to that of two of the samples from confirmed HGE cases in
New York, suggesting that the USG3 strain likely represents a strain of
the HGE agent. Similarly, the sequence determined for the Minnesota dog
sample was identical to three of the four Wisconsin HGE samples,
suggesting that a single strain, or a very closely related one, is
capable of infecting and causing clinical illness in both human and
canine species. In addition, portions of at least six genes other than
the 16S rRNA, groE, and p44 have been sequenced
from the USG3 strain and were identical to those from a New York human
isolate (C. I. Murphy et al., unpublished observations).
The ank gene sequences were determined and analyzed for
single representatives of E. equi and E. phagocytophila and were found to be no more closely related to
each other than to the North American and European HGE agent sequences.
In fact, the lowest homology found between any two amino acid sequences
(92.37%) was between the predicted E. equi and E. phagocytophila proteins. While the E. phagocytophila
nucleotide and amino acid sequences were clearly more closely related
to the European HGE agent sequences than to those of any of the North
American samples, the E. equi sequences showed highest
homology to those from the Upper Midwest samples. Additional
representatives of both of these species need to be examined before
drawing any conclusions, particularly for E. phagocytophila,
where previous studies of the groE heat shock operon
sequences showed significant variability between E. phagocytophila strains relative to the high conservation noted for
the 16S rRNA gene (25). However, a partial sequence of the
ank gene from a Swiss E. phagocytophila sample
showed >99% identity to the Swedish E. phagocytophila
examined in this study and suggests a close relationship between
European strains of E. phagocytophila (data not shown).
One of the more distinctive features within the ank gene
sequence is a region containing a variable number of direct repeats with no ankyrin homology located in the last third of the gene. The
result of these repeats at the protein level is a 27-amino-acid sequence that is repeated twice in each of the North American samples,
with the exception of E. equi. The European samples and E. equi show a single copy of the 27-amino-acid element,
suggesting that this organism may be more closely related to European
GE than are the other North American GE. In fact, the number and arrangement of repetitive elements for E. equi are identical
to those noted for both the Swedish HGE agent and E. phagocytophila. However, the partial sequence of the
ank gene for the BDS strain of E. equi (GenBank
accession no. AF047897) shows a repeat structure identical to that of
the North American HGE agents and suggests that the number of copies of
the 27-amino-acid repeat in E. equi strains can be variable.
Directly adjacent to and downstream from the 27-amino-acid unit is a
17-amino-acid element that is present as a single copy in each of the
North American HGE samples, E. equi, the Swedish HGE agent,
and E. phagocytophila. Only the European HGE samples from
Slovenia show multiple copies of the 17-amino-acid element, with either
two or three copies present, and thereby appear to represent a feature
unique to the HGE agent in Slovenia.
A comparison of the members of the three clades of the HGE agent (U.S.
Northeast and Upper Midwest and Europe) showed that the degree of
homology is not uniform across the length of the ank gene or
the predicted protein. Analysis of the amino-terminal region of the
protein sequence for the members of each clade showed a similar degree
of identity among the three clades (92.0 to 94.7%). In contrast, the
carboxyl-terminal region of the protein is very highly conserved
between the members of the two North American clades (>99.7%
identity), while the European clade members show only 94.3% identity
to each of the North American clades. These data suggest that there are
constraints on the evolution of the carboxyl-terminal portion of the
protein in the North American strains that are not being exerted on the
more variable amino-terminal region. It is the amino-terminal region of
the protein that contains the ankyrin-like repeats from which the name
of the gene is derived. Ankyrin-related proteins have been described
for bacteria, plants, and animals, and the most common function
attributed to ankyrin-like repeats involves protein-protein
interactions (3, 16). The diversity within the
amino-terminal region of the HGE agent Ank protein indicates that,
although the length of the amino-terminal region is conserved, the
content is flexible. The fact that there are between 14 and 18 copies
of ankyrin-like repeats may allow for minor variations within the
repeats to have little or no effect on the overall function of the
protein, thereby allowing more diversity within this region of the protein.
The life cycle of the HGE agent involves a complex interaction between
the natural host(s) or reservoirs and vectors that progress through
multiple life stages and may transmit infections to humans.
Additionally, tick species that rarely bite humans, including
nidicolous members of the genus Ixodes, such as Ixodes trianguliceps in Europe, are likely involved as vectors for
maintaining enzootic infectious cycles (20). This requires
that the agent have the ability to adapt to these multiple environments
and environmental pressures. The differences noted for the Ank protein
among members of the three clades may reflect adaptation to differences
between the vectors and/or reservoirs of the agent. While the presumed vector, I. scapularis ticks, and the major reservoir,
Peromyscus leucopus, are present in both the Upper
Midwestern and Northeastern regions of the United States, the genetic
and biologic diversity between these populations living in distinct
geographic locations has not been fully explored. There are also
potentially significant differences between the vectors and reservoirs
that are involved in the life cycles of the agents in North America and
Europe. Whereas I. scapularis is the primary vector in the
United States, a different species of Ixodid tick, Ixodes
ricinus, has been suggested as the vector in Europe (7, 15,
18, 20-23, 28). Whereas P. leucopus has been shown to
be a competent natural reservoir in the United States (27,
30), the corresponding reservoir in Europe has not been defined
although Ogden et al. (20) identified GE closely related to
the HGE agent in Apodemus sylvaticus wood mice and
Clethrionomys glareolus bank voles in the United Kingdom, and Liz et al. (15) found the highest prevalence of GE in
C. glareolus in Switzerland. Resolution of the mechanisms
that are driving the evolution of the ank gene will require
additional studies addressing the expression of the gene and
characterization of the functional properties of the encoded protein,
as well as a better understanding of the vectors and reservoirs of the
HGE agent in the United States and Europe. Whereas the present study focused on the examination of the ank gene amplified from
confirmed human cases and suggests that this gene provides an excellent epidemiologic tool for differentiating HGE agent isolates, the diversity noted within the gene should prove useful for examining the
heterogeneity of GE in veterinary and arthropod populations.
 |
ACKNOWLEDGMENTS |
We are grateful to the Biotechnology Core Facility of the
National Center for Infectious Diseases for the synthesis of
oligonucleotides and to Dana Jones for assistance with the phylogenetic analysis.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Centers for
Disease Control and Prevention, 1600 Clifton Rd., MS G-13, Atlanta, GA 30333. Phone: (404) 639-1082. Fax: (404) 639-4436. E-mail:
rfm2{at}cdc.gov.
 |
REFERENCES |
| 1.
|
Anderson, B. E.,
J. E. Dawson,
D. C. Jones, and K. H. Wilson.
1991.
Ehrlichia chaffeensis, a new species associated with human ehrlichiosis.
J. Clin. Microbiol.
29:2838-2842[Abstract/Free Full Text].
|
| 2.
|
Bakken, J. S.,
J. S. Dumler,
S.-M. Chen,
M. R. Eckman,
L. L. Van Etta, and D. H. Walker.
1994.
Human granulocytic ehrlichiosis in Upper Midwest United States. A new species emerging?
JAMA
272:212-218[Abstract/Free Full Text].
|
| 3.
|
Bork, P.
1993.
Hundreds of ankyrin-like repeats in functionally diverse proteins: mobile modules that cross phyla horizontally.
Proteins Struct. Funct. Genet.
17:363-374[CrossRef][Medline].
|
| 4.
|
Broqui, P.,
J. S. Dumler,
R. Lienhard,
M. Brossard, and D. Raoult.
1995.
Human granulocytic ehrlichiosis in Europe.
Lancet
346:782-783[Medline].
|
| 5.
|
Chen, S.-M.,
J. S. Dumler,
J. S. Bakken, and D. H. Walker.
1994.
Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease.
J. Clin. Microbiol.
32:589-595[Abstract/Free Full Text].
|
| 6.
|
Dear, S., and R. Staden.
1991.
A sequence assembly and editing program for efficient management of large projects.
Nucleic Acids Res.
19:3907-3911[Abstract/Free Full Text].
|
| 7.
|
Des Vignes, F., and D. Fish.
1997.
Transmission of the agent of human granulocytic ehrlichiosis by host-seeking Ixodes scapularis (Acari: Ixodidae) in southern New York state.
J. Med. Entomol.
34:379-382[Medline].
|
| 8.
|
Devereux, J.,
P. Haeberli, and O. Smithies.
1984.
A comprehensive set of sequence analysis programs for the VAX.
Nucleic Acids Res.
12:387-395.
|
| 9.
|
Dumler, J. S., and J. S. Bakken.
1995.
Ehrlichial diseases of humans: emerging tick-borne infections.
Clin. Infect. Dis.
20:1102-1110[Medline].
|
| 10.
|
Foley, J. E.,
L. Crawford-Miksza,
J. S. Dumler,
C. Glaser,
J.-S. Chae,
E. Yeh,
D. Schnurr,
R. Hood,
W. Hunter, and J. E. Madigan.
1999.
Human granulocytic ehrlichiosis in Northern California: two case descriptions with genetic analysis of the ehrlichiae.
Clin. Infect. Dis.
29:388-392[Medline].
|
| 11.
|
Gewirtz, A. S.,
P. J. Cornbleet,
D. J. Vugia,
C. Traver,
J. Niederhuber,
C. P. Kolbert, and D. H. Persing.
1996.
Human granulocytic ehrlichiosis: report of a case in northern California.
Clin. Infect. Dis.
23:653-654[Medline].
|
| 12.
|
Hardalo, C. J.,
V. Quagliarello, and J. S. Dumler.
1995.
Human granulocytic ehrlichiosis in Connecticut: report of a fatal case.
Clin. Infect. Dis.
21:910-914[Medline].
|
| 13.
|
Kim, H.-Y., and Y. Rikihisa.
1998.
Characterization of monoclonal antibodies to the 44-kilodalton major outer membrane protein of the human granulocytic ehrlichiosis agent.
J. Clin. Microbiol.
36:3278-3284[Abstract/Free Full Text].
|
| 14.
|
Kolbert, C. P.,
E. S. Bruinsma,
A. S. Abdulkarim,
E. K. Hofmeister,
R. B. Tompkins,
S. R. Telford III,
P. D. Mitchell,
J. Adams-Stich, and D. H. Persing.
1997.
Characterization of an immunoreactive protein from the agent of human granulocytic ehrlichiosis.
J. Clin. Microbiol.
35:1172-1178[Abstract].
|
| 15.
|
Liz, J. S.,
L. Anderes,
J. W. Sumner,
R. F. Massung,
L. Gern,
B. Rutti, and M. Brossard.
2000.
PCR detection of granulocytic ehrlichiae in Ixodes ricinus ticks and wild small mammals in western Switzerland.
J. Clin. Microbiol.
38:1002-1007[Abstract/Free Full Text].
|
| 16.
|
Lux, S. E.,
K. M. John, and V. Bennett.
1990.
Analysis of cDNA for human erythrocyte ankyrin indicates a repeated structure with homology to tissue-differentiation and cell-cycle control proteins.
Nature (London)
344:36-42[Medline].
|
| 17.
|
Maeda, K.,
N. Markowitz,
R. C. Hawley,
M. Ristic,
D. Cox, and J. E. McDade.
1987.
Human infection with Ehrlichia canis, a leukocytic rickettsia.
N. Engl. J. Med.
316:853-856[Medline].
|
| 18.
|
Magnarelli, L. A.,
K. C. Stafford III,
T. N. Mather,
M.-T. Yeh,
K. D. Horn, and J. S. Dumler.
1995.
Hemocytic rickettsia-like organisms in ticks: serologic reactivity with antisera to ehrlichiae and detection of DNA of agent of human granulocytic ehrlichiosis by PCR.
J. Clin. Microbiol.
33:2710-2714[Abstract].
|
| 19.
|
Nicholson, W. L.,
J. A. Comer,
J. W. Sumner,
C. Gingrich-Baker,
R. T. Coughlin,
L. A. Magnarelli,
J. G. Olson, and J. E. Childs.
1997.
An indirect immunofluorescence assay using a cell culture-derived antigen for detection of antibodies to the agent of human granulocytic ehrlichiosis.
J. Clin. Microbiol.
35:1510-1516[Abstract].
|
| 20.
|
Ogden, N. H.,
K. Brown,
B. K. Horrocks,
Z. Woldehiwet, and M. Bennett.
1998.
Granulocytic Ehrlichiae infection in Ixodid ticks and mammals in woodlands and uplands of the U.K.
Med. Vet. Entomol.
12:423-429[CrossRef][Medline].
|
| 21.
|
Pancholi, P.,
C. P. Kolbert,
P. D. Mitchell,
K. D. Reed,
J. S. Dumler,
J. S. Bakken,
S. R. Telford, and D. H. Persing.
1995.
Ixodes dammini as a potential vector of human granulocytic ehrlichiosis.
J. Infect. Dis.
172:1007-1012[Medline].
|
| 22.
|
Petrovec, M.,
S. L. Furlan,
T. A. Zupanc,
F. Strle,
P. Broqui,
V. Roux, and J. S. Dumler.
1997.
Human disease in Europe caused by a granulocytic Ehrlichia species.
J. Clin. Microbiol.
35:1556-1559[Abstract].
|
| 23.
|
Pusterla, N.,
J. B. Huder,
C. M. Leutenegger,
U. Braun,
J. E. Madigan, and H. Lutz.
1999.
Quantitative real-time PCR for detection of members of the Ehrlichia phagocytophila genogroup in host animals and Ixodes ricinus ticks.
J. Clin. Microbiol.
37:1329-1331[Abstract/Free Full Text].
|
| 24.
|
Storey, J. R.,
L. A. Doros-Richert,
C. Gingrich-Baker,
K. Munroe,
T. N. Mather,
R. T. Coughlin,
G. A. Beltz, and C. I. Murphy.
1998.
Molecular cloning and sequencing of three granulocytic Ehrlichia genes encoding high-molecular-weight immunoreactive proteins.
Infect. Immun.
66:1356-1363[Abstract/Free Full Text].
|
| 25.
|
Sumner, J. W.,
W. L. Nicholson, and R. F. Massung.
1997.
PCR amplification and comparison of nucleotide sequences from the groESL heat shock operon of Ehrlichia species.
J. Clin. Microbiol.
35:2087-2092[Abstract].
|
| 26.
|
Sumption, K. J.,
D. J. M. Wright,
S. J. Cutler, and B. A. S. Dale.
1995.
Human ehrlichiosis in the UK.
Lancet
346:1487-1488[Medline].
|
| 27.
|
Telford, S. R., III,
J. E. Dawson,
P. Katavolos,
C. K. Warner,
C. P. Kolbert, and D. H. Persing.
1996.
Perpetuation of the agent of human granulocytic ehrlichiosis in a deer tick-rodent cycle.
Proc. Natl. Acad. Sci. USA
93:6209-6214[Abstract/Free Full Text].
|
| 28.
|
von Stedingk, L. V.,
M. Gürtelschmid,
H. S. Hanson,
R. Gustafson,
L. Dotevall,
E. O. Engvall, and M. Granström.
1997.
The human granulocytic ehrlichiosis (HGE) agent in Swedish ticks.
Clin. Microbiol. Infect.
3:573-574[Medline].
|
| 29.
|
Walker, D. H., and J. S. Dumler.
1996.
Emergence of human ehrlichioses as human health problems.
Emerg. Infect. Dis.
2:18-29[Medline].
|
| 30.
|
Walls, J. J.,
B. Greig,
D. F. Neitzel, and J. S. Dumler.
1997.
Natural infection of small mammal species in Minnesota with the agent of human granulocytic ehrlichiosis.
J. Clin. Microbiol.
35:853-855[Abstract].
|
| 31.
|
Yeh, M.-T.,
T. N. Mather,
R. T. Coughlin,
C. Gingrich-Baker,
J. W. Sumner, and R. F. Massung.
1997.
Serologic and molecular detection of granulocytic ehrlichiosis in Rhode Island.
J. Clin. Microbiol.
35:944-947[Abstract].
|
| 32.
|
Zhi, N.,
N. Ohashi, and Y. Rikihisa.
1999.
Multiple p44 genes encoding major outer membrane proteins are expressed in the human granulocytic ehrlichiosis agent.
J. Biol. Chem.
274:17828-17836[Abstract/Free Full Text].
|
| 33.
|
Zhi, N.,
Y. Rikihisa,
H. Y. Kim,
G. P. Wormser, and H. W. Horowitz.
1997.
Comparison of major antigenic proteins of six strains of the human granulocytic ehrlichiosis agent by Western immunoblot analysis.
J. Clin. Microbiol.
35:2606-2611[Abstract].
|
Journal of Clinical Microbiology, August 2000, p. 2917-2922, Vol. 38, No. 8
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Zeman, P., Jahn, P.
(2009). An entropy-optimized multilocus approach for characterizing the strains of Anaplasma phagocytophilum infecting horses in the Czech Republic. J Med Microbiol
58: 423-429
[Abstract]
[Full Text]
-
Massung, R. F., Levin, M. L., Munderloh, U. G., Silverman, D. J., Lynch, M. J., Gaywee, J. K., Kurtti, T. J.
(2007). Isolation and Propagation of the Ap-Variant 1 Strain of Anaplasma phagocytophilum in a Tick Cell Line. J. Clin. Microbiol.
45: 2138-2143
[Abstract]
[Full Text]
-
Shukla, S. K., Aswani, V., Stockwell, P. J., Reed, K. D.
(2007). Contribution of Polymorphisms in ankA, gltA, and groESL in Defining Genetic Variants of Anaplasma phagocytophilum. J. Clin. Microbiol.
45: 2312-2315
[Abstract]
[Full Text]
-
Bown, K. J., Lambin, X., Ogden, N. H., Petrovec, M., Shaw, S. E., Woldehiwet, Z., Birtles, R. J.
(2007). High-Resolution Genetic Fingerprinting of European Strains of Anaplasma phagocytophilum by Use of Multilocus Variable-Number Tandem-Repeat Analysis. J. Clin. Microbiol.
45: 1771-1776
[Abstract]
[Full Text]
-
de la Fuente, J., Massung, R. F., Wong, S. J., Chu, F. K., Lutz, H., Meli, M., von Loewenich, F. D., Grzeszczuk, A., Torina, A., Caracappa, S., Mangold, A. J., Naranjo, V., Stuen, S., Kocan, K. M.
(2005). Sequence Analysis of the msp4 Gene of Anaplasma phagocytophilum Strains. J. Clin. Microbiol.
43: 1309-1317
[Abstract]
[Full Text]
-
Lin, Q., Rikihisa, Y., Massung, R. F., Woldehiwet, Z., Falco, R. C.
(2004). Polymorphism and Transcription at the p44-1/p44-18 Genomic Locus in Anaplasma phagocytophilum Strains from Diverse Geographic Regions. Infect. Immun.
72: 5574-5581
[Abstract]
[Full Text]
-
Levin, M. L., Coble, D. J., Ross, D. E.
(2004). Reinfection with Anaplasma phagocytophilum in BALB/c Mice and Cross-Protection between Two Sympatric Isolates. Infect. Immun.
72: 4723-4730
[Abstract]
[Full Text]
-
Lin, Q., Rikihisa, Y., Felek, S., Wang, X., Massung, R. F., Woldehiwet, Z.
(2004). Anaplasma phagocytophilum Has a Functional msp2 Gene That Is Distinct from p44. Infect. Immun.
72: 3883-3889
[Abstract]
[Full Text]
-
von Loewenich, F. D., Baumgarten, B. U., Schroppel, K., Geissdorfer, W., Rollinghoff, M., Bogdan, C.
(2003). High Diversity of ankA Sequences of Anaplasma phagocytophilum among Ixodes ricinus Ticks in Germany. J. Clin. Microbiol.
41: 5033-5040
[Abstract]
[Full Text]
-
Lin, Q., Rikihisa, Y., Ohashi, N., Zhi, N.
(2003). Mechanisms of Variable p44 Expression by Anaplasma phagocytophilum. Infect. Immun.
71: 5650-5661
[Abstract]
[Full Text]
-
Inokuma, H., Brouqui, P., Dumler, J. S., Raoult, D.
(2003). Serotyping Isolates of Anaplasma phagocytophilum by Using Monoclonal Antibodies. CVI
10: 969-972
[Abstract]
[Full Text]
-
Dumler, J. S., Asanovich, K. M., Bakken, J. S.
(2003). Analysis of Genetic Identity of North American Anaplasma phagocytophilum Strains by Pulsed-Field Gel Electrophoresis. J. Clin. Microbiol.
41: 3392-3394
[Abstract]
[Full Text]
-
Maurin, M., Bakken, J. S., Dumler, J. S.
(2003). Antibiotic Susceptibilities of Anaplasma (Ehrlichia) phagocytophilum Strains from Various Geographic Areas in the United States. Antimicrob. Agents Chemother.
47: 413-415
[Abstract]
[Full Text]
-
Kim, H.-Y., Mott, J., Zhi, N., Tajima, T., Rikihisa, Y.
(2002). Cytokine Gene Expression by Peripheral Blood Leukocytes in Horses Experimentally Infected with Anaplasma phagocytophila. CVI
9: 1079-1084
[Abstract]
[Full Text]
-
Bjoersdorff, A., Bagert, B., Massung, R. F., Gusa, A., Eliasson, I.
(2002). Isolation and Characterization of Two European Strains of Ehrlichia phagocytophila of Equine Origin. CVI
9: 341-343
[Abstract]
[Full Text]
-
Inokuma, H., Brouqui, P., Drancourt, M., Raoult, D.
(2001). Citrate Synthase Gene Sequence: a New Tool for Phylogenetic Analysis and Identification of Ehrlichia. J. Clin. Microbiol.
39: 3031-3039
[Abstract]
[Full Text]
-
Carter, S. E., Ravyn, M. D., Xu, Y., Johnson, R. C.
(2001). Molecular Typing of the Etiologic Agent of Human Granulocytic Ehrlichiosis. J. Clin. Microbiol.
39: 3398-3401
[Abstract]
[Full Text]