Previous Article | Next Article 
Journal of Clinical Microbiology, September 2000, p. 3219-3225, Vol. 38, No. 9
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Cloning of the Rhesus Lymphocryptovirus Viral
Capsid Antigen and Epstein-Barr Virus-Encoded Small RNA Homologues and
Use in Diagnosis of Acute and Persistent Infections
Pasupuleti
Rao,
Hua
Jiang, and
Fred
Wang*
Department of Medicine, Brigham and Women's
Hospital, Harvard Medical School, Boston, Massachusetts 02115
Received 27 January 2000/Returned for modification 28 April
2000/Accepted 11 June 2000
 |
ABSTRACT |
Epstein-Barr virus (EBV) is the most common cause of infectious
mononucleosis and is associated with the development of several human
malignancies. A closely related herpesvirus in the same lymphocryptovirus (LCV) genera as EBV naturally infects rhesus monkeys
and provides an important animal model for studying EBV pathogenesis.
We cloned the small viral capsid antigen (sVCA) homologue from the
rhesus LCV and developed a peptide enzyme-linked immunosorbent assay
(ELISA) to determine whether epitopes in the rhesus LCV sVCA are a
reliable indicator of rhesus LCV infection. In order to define a
"gold standard" for rhesus LCV infection, we also cloned the
EBV-encoded small RNA 1 (EBER1) and EBER2 homologues from rhesus LCV
and developed a reverse transcription (RT)-PCR assay to detect
persistent LCV infection in rhesus monkey peripheral blood lymphocytes.
Animals from a conventional and a hand-reared colony were studied to
compare the prevalence of rhesus LCV infection in the two groups. There
was a 100% correlation between the peptide ELISA and EBER RT-PCR
results for rhesus LCV infection. In addition, specificity for LCV
infection and exclusion of potential cross-reactivity to the rhesus
rhadinovirus sVCA homologue could be demonstrated using sera from
experimentally infected animals. These studies establish two novel
assays for reliable diagnosis of acute and persistent rhesus LCV
infections. The rhesus LCV sVCA peptide ELISA provides a sensitive and
reliable assay for routine screening, and these studies of the
hand-reared colony confirm the feasibility of raising rhesus LCV-naive animals.
 |
INTRODUCTION |
Epstein-Barr virus (EBV) is a human
gammaherpesvirus in the lymphocryptovirus (LCV) genera which is
associated with the development of several different malignancies,
including Burkitt's lymphoma, B-cell lymphomas in immunosuppressed
hosts, nasopharyngeal carcinomas, Hodgkin's disease, and gastric
carcinomas (16). Closely related herpesviruses in the same
LCV genera naturally infect a number of Old World primate species, and
experimental infection of rhesus monkeys with the rhesus LCV is the
only animal model which accurately reproduces the pathogenesis of acute
and persistent EBV infections (24). Simian LCV infection is
also associated with B-cell lymphomas in many Old World primate species
and can cause lethal malignant disease in macaques experimentally
infected and immunosuppressed with simian immunodeficiency virus (SIV)
(8, 26). Thus, accurate diagnostic assays for LCV infection
in Old World primates, and rhesus monkeys in particular, would be an
important tool for primate care and for identifying LCV-naive animals
for experimental studies.
The simian LCV and EBV genomes are colinear and appear to contain a
similar repertoire of lytic and latent infection genes. The rhesus LCV
latent infection genes have shown a surprising amount of sequence
divergence from EBV, with only 20 to 50% amino acid identity (3,
4, 9, 10, 25, 28). The few lytic infection genes from simian LCV
cloned to date have demonstrated better homology, with 50 to 90% amino
acid identity (15a, 23, 46). Currently rhesus LCV diagnosis
is made by detecting simian antibodies which are cross-reactive with
EBV-lytic infection proteins. The cross-reactivity with EBV serologic
assays can be useful for identifying animals with high antibody titers
but can be difficult for excluding infection and identifying truly
seronegative, naive animals. Serologic screening for herpes B virus
infection has been successfully used to establish
specific-pathogen-free colonies (6, 13). A simple,
sensitive, and specific serologic screening assay for LCV infection
would be a valuable tool for breeding LCV-naive macaque colonies.
LCV-naive animals would have less risk of LCV-induced malignancies
associated with experimentally induced immunosuppression, e.g.,
transplant and SIV experiments, and would provide a reliable source of
animals for experimental infection and pathogenesis studies.
EBV infection is associated with a lifelong antibody response to lytic
infection viral capsid antigens (VCA) and EBV latent infection nuclear
antigens (EBNA) (27). An immunoglobulin G (IgG) antibody
response to either is a reliable indicator of previous infection in
humans. There are six different EBNA expressed in EBV-immortalized
cells which are recognized by antibodies in EBV-immune human sera. The
highest antibody titers are usually generated against EBNA-1 (12,
21), but these are still quite low compared to titers of antibody
against VCA (34, 41-43). In addition, antibodies to EBNA-1
may not appear for several weeks or months after acute infection and
may be low or difficult to detect in patients with immunodeficiency
(12).
Three different EBV open reading frames are known to code for viral
capsid proteins, BcLF1 (p135), BdRF1 (p40), and BFRF3 (p18 or p21)
(31, 41, 43). Epitopes within EBV BFRF3, or small VCA
(sVCA), are known to be immunodominant for the humoral response in
EBV-infected humans and are routinely used in diagnostic serologic
assays for EBV infection (34, 40-42). High sVCA antibody titers can be detected relatively early in acute primary EBV infection, i.e., infectious mononucleosis, and typically persist at high levels
even in immunosuppressed hosts (20, 41). Therefore, we
cloned the sVCA homologue from the rhesus LCV and developed a peptide
enzyme-linked immunosorbent assay (ELISA) to determine whether antibody
responses to the rhesus LCV sVCA are a sensitive and reliable indicator
of rhesus LCV infection.
 |
MATERIALS AND METHODS |
Cell lines.
LCL 8664 is a rhesus monkey LCV (cercopithicine
herpesvirus 15)- infected B-cell line derived from retro-orbital B-cell
lymphoma in a rhesus monkey (26). LCL 8664 was grown in RPMI
medium supplemented with 10% fetal bovine serum. COS-7 cells were
grown in Dulbecco's modified Eagle medium supplemented with 10% fetal
bovine serum.
Cloning of the rhesus LCV BFRF3 and EBER homologues.
Genomic
DNA from LCL 8664 cells was digested with a SalI-constructed
cosmid library and screened as described previously (28). Rhesus LCV sVCA was cloned by PCR amplification from the rhesus LCV
cosmid clone QA15, using EBV-specific primers (5'
GAGGTAGAATTGCCACCTGG 3' and 5' TTCGTGAGCCAGCTTCGCCG 3')
at reduced stringency. Multiple PCR products were cloned to
derive the nucleotide sequence, and the open reading frame was cloned
into pSG5 (Stratagene) for eukaryotic expression. The rhesus LCV
EBV-encoded small RNA 1 (EBER1) and EBER2 homologues were identified by
screening subclones of the rhesus LCV CC1 cosmid by cross-hybridization
with the EBV EcoRI J DNA fragment encoding the EBERs.
Expression of rhesus LCV sVCA and Western blot analysis.
Recombinant sVCA expression constructs (30 µg) were transfected into
COS-7 cells by electroporation. Twenty-four hours after transfection,
cells were washed with phosphate-buffered saline (PBS) and lysed in 1×
Laemmli buffer. Total cellular proteins were resolved by sodium dodecyl
sulfate-15% polyacrylamide gel electrophoresis, transferred to
nitrocellulose filters (Schleicher & Schuell), and immunoblotted with a
1:100 dilution of rhesus sera. A cassette Mini-protean II system
(Bio-Rad) was used to screen multiple rhesus sera at one time. Filters
were subsequently incubated with a goat anti-human IgG reagent coupled
to horseradish peroxidase and detected with enhanced luminol and
oxidizing reagents (NEN Life Science).
Peptide synthesis.
Two peptides representing the
carboxy-terminal domains of rhesus LCV sVCA were synthesized by
standard fluorenylmethoxycarbonyl chemistry. Peptide 1, AASAPAATPAVSSSISSLRAATSGAAASSA, corresponds to amino acids
(aa) 117 to 146 of the rhesus LCV sVCA. Peptide 2, AVDTGSGGGAQPQDTSTRGARKKQ, corresponds to aa 147 to 170 of
rhesus LCV sVCA. Peptides were purified to >80% purity by
reverse-phase high-performance liquid chromatography.
Peptide ELISA.
Peptides 1 and 2 were resuspended in
bicarbonate buffer (50 mM; pH 9.6) and used (0.5 µg in 200 µl) for
overnight coating of Immulon 1 microtiter wells (Dynatech Laboratories,
Inc., Chantilly, Va.) at 4°C. Unbound peptides were washed with PBS
containing 0.1% Tween 20 and blocked with PBS (0.1% Tween 20, 3%
bovine serum albumin [BSA]) for 2 h at room temperature. Rhesus
monkey serum was diluted 1:100 in PBS (0.1% Tween 20, 3% BSA) before
incubation and added to 96-well plates. After 1 h at room
temperature the wells were washed and incubated with horseradish
peroxidase-conjugated antiserum to human IgG diluted in PBS (0.1%
Tween 20, 3% BSA). Peroxidase activity of bound conjugated antibodies
was developed using O-phenylenediamine dihydrochloride
tablets (Sigma Biosciences, St. Louis, Mo.). The absorbance at 450 nm
was read after a 30-min incubation using a Bio-Rad microplate reader.
Cutoff values were set at 3 standard deviations above the mean
absorbance from triplicate wells with secondary antibody and no sera.
Real-time RT-PCR.
A two-step reverse transcription (RT)-PCR
was optimized for the quantitation of rhesus LCV EBER1 using TaqMan
technology (Roche Molecular Systems, Inc.) and a GeneAmp sequence
detector (model 5700) during the PCR. The EBER1 forward and reverse
primer sequences were 5' GGAGGAGATGAGTGTGACTTAAATCA 3'
and 5' TGAACCGAAGAGAGCAGAAACC 3', and the probe
sequence was labeled with a fluorescent reporter (FAM) at the 5'
end and a fluorescent quencher (TAMRA) at the 3' end
(5' CCCGTCTTCACCACCCGGGA 3').
Total RNA was isolated from 5 million Ficoll-Hypaque-purified
peripheral blood mononuclear cells (PBMC) using TRIzol reagent (GIBCO
BRL). The first step of the RT reaction was carried out using random
hexamers and 400 ng of total RNA in a volume of 50 µl according to
the manufacturer's protocol (PE Applied Biosystems). The PCR mixture
was prepared as follows: 2× TaqMan universal PCR master mix, 10 µl
of cDNA, 200 nM EBER1 probe, and a 75 nM concentration of each primer
were mixed in a final volume of 50 µl and PCR amplified for 40 cycles
(15 s at 94°C, 30 s at 60°C, 30 s at 72°C). Serial dilutions of a recombinant rhesus LCV EBER plasmid of known
concentration were used as a PCR standard. The limit of detection for
the real-time RT-PCR assay was determined to be 50 copies. Rhesus EBER1
RT-PCR products were also analyzed by electrophoresis through a 3%
agarose gel. The DNA was transferred to a nylon membrane and probed
with a 32P-labeled EBER1 oligonucleotide at 65°C. The
blots were washed with 6× SSC (1× SSC is 0.15 M NaCl plus 0.015 M
sodium citrate) (with 0.5% sodium dodecyl sulfate) at 65°C three
times for 15 min.
Nucleotide sequence accession numbers. The nucleotide
sequences for the rhesus LCV sVCA, EBER1, and EBER2 homologues
have
been submitted to GenBank (accession no.
AF227123,
AF227124,
and
AF227125).
 |
RESULTS |
Cloning of rhesus LCV sVCA.
The rhesus LCV homologue for the
EBV sVCA was cloned by PCR amplification using EBV-specific primers at
reduced stringency from a rhesus LCV cosmid clone, QA15. Three PCR
clones were sequenced to derive the nucleotide and amino acid sequence
shown in Fig. 1A. Overall the rhesus LCV
sVCA shows 69% amino acid identity with the EBV sVCA (Fig. 1B). To
determine whether the antibody response in rhesus LCV-immune animals is
directed at the sVCA gene product, the rhesus LCV sVCA was expressed
after transfection of COS-7 cells, and lysates of vector control- or
rhesus LCV sVCA-transfected cells were used for Western blotting with
sera from five randomly selected rhesus monkeys in the conventional
colony at the New England Regional Primate Research Center (NERPRC). As
shown in Fig. 2, a unique 18- to 21-kDa
band is detected by all five sera in rhesus LCV sVCA-transfected cells
(Fig. 2A) but not in vector control-transfected cells (Fig. 2B). Thus,
the rhesus LCV sVCA appears to be immunogenic in rhesus monkeys.
However, the high background levels relative to the specific signal in
these Western blots were emblematic of the difficulties that may arise
in distinguishing between naive animals and those with lower antibody
responses.

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 1.
Sequence analysis of the rhesus LCV sVCA. (A) Nucleotide
and predicted amino acid sequence of the rhesus LCV sVCA. (B) Amino
acid comparison between rhesus LCV sVCA and EBV VCA p18 (p21).
Identical amino acids are represented by an asterisk, similar amino
acids are represented by a period, and gaps are indicated with a
hyphen.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 2.
Expression of rhesus LCV sVCA in COS-7 cells. (A)
Immunoblot strips with cell lysates of pSG5 rhesus LCV sVCA-transfected
cells; (B) cell lysates of pSG5-transfected cells. Immunoblots
containing cell lysates positive (A) and negative (B) for rhesus LCV
sVCA were probed with five different LCV-immune rhesus sera (lanes 1 to
5) using a cassette Mini-protean II system (Bio-Rad).
|
|
Rhesus LCV sVCA ELISA.
In order to develop a more rapid, less
labor-intensive, and more discriminating assay, we tested the potential
utility of a rhesus LCV peptide ELISA. EBV sVCA is known to be an
important target for the human antibody response to EBV infection, and
the immunodominant epitopes are known to reside in the carboxy terminus (aa 119 to 176) (42). Therefore, we synthesized two peptides from similar regions of the rhesus LCV sVCA carboxy terminus (peptide 1, aa 117 to 146, and peptide 2, aa 147 to 170) (Fig. 1B). We used
these peptides individually and in combination to test serologic responses in two populations of rhesus monkeys. The first population consisted of 20 randomly selected animals from the conventional colony
at the NERPRC. Rhesus LCV infection was known to be highly prevalent in
this colony (4). The second population was selected from a
colony of hand-reared animals (6). These animals were separated early from their mother, reared by hand, and then raised in
isolated colonies. This colony was serologically screened to exclude
herpes B and D retrovirus infection. These animals were not
specifically screened for LCV infection, but we hypothesized that these
handling procedures were likely to result in a low prevalence of rhesus
LCV infection. The average age of these animals was 1.5 years.
As shown in Fig.
3, none of the
hand-reared animals had a detectable rhesus LCV sVCA serologic response
by ELISA using peptides
1 and 2 alone or in combination. These animals
were also tested
for sVCA antibodies by Western blotting using sVCA
protein expressed
in COS-7 cells, and the results were negative (data
not shown).
In the conventional colony, sera from 14 of 20 animals
reacted
to peptide 1 with an optical density greater than 3 standard
deviations
above background levels. Sera from all 20 animals from the
conventional
colony had stronger reactivity to peptide 2 and could be
easily
distinguished from those from the hand-reared colony. The
combination
of peptides 1 and 2 did not provide any significant
advantage
over the results with peptide 2 alone. Previous studies of
the
rhesus LCV strains present in the oropharyngeal washes of the
animals from the conventional colony showed an equal prevalence
of type
1 and type 2 rhesus LCV (
4). Thus, the carboxy terminus
of
the rhesus LCV sVCA contains immunodominant antibody epitopes
independent of viral type.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
Rhesus LCV sVCA peptide ELISA results for serum samples
from animals in the conventional (C) and hand-raised (H) colonies. The
dotted line near the bottom of each panel represents the cutoff value
in the ELISA. ELISA optical density values shown are the average of
triplicate values in a representative assay.
|
|
Currently, there is no "gold standard" for identifying rhesus LCV
infection, making it difficult to validate the sensitivity
and
specificity of these peptide ELISA results. LCV infection
persists for
life. However, oropharyngeal shedding of virus is
episodic, and PCR
detection from oropharyngeal washes is positive
for only a fraction of
adult, EBV-seropositive humans (
45).
EBV infection also
persists in 1 per 10
5 to 10
6 peripheral blood B
cells, a level which is difficult to detect
by DNA PCR of PBMC
(
22). However, the EBERs are expressed at
a high copy
number, 10
6 to 10
7 copies per infected cell,
and could potentially increase the
sensitivity of detecting
persistent viral infection in the peripheral
blood
(
37). Therefore, we cloned the rhesus LCV EBER homologues
and tested whether an EBER RT-PCR could effectively detect
persistent
LCV infection in rhesus PBMC as an independent test for
rhesus
LCV
infection.
RT-PCR for rhesus LCV EBER expression in rhesus monkey PBMC.
The rhesus LCV EBER1 has 73 and 68% nucleotide identity with the EBV
and the baboon LCV EBER1 genes, respectively. The EBER2 genes are less
well conserved, with only 42 and 38% identity with the EBV and baboon
LCV EBER2 (Fig. 4). EBER1 was targeted
since EBER1 is more abundant than EBER2 in EBV- and baboon LCV-infected cells (5, 14, 17) and better conserved. PCR primers were designed from EBER1 sequences conserved among all three species to
minimize the potential effect of strain-dependent sequence variation.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of the EBV, rhesus LCV, and baboon DNA
(14) sequences encoding EBER1 (A) and EBER2 (B). Nucleotides
conserved among all viruses are represented with an asterisk, well
conserved nucleotides are represented with a period, and gaps are
indicated with a hyphen.
|
|
RT-PCR amplification for EBER1 RNA followed by Southern blot
hybridization with an internal oligonucleotide probe was positive
for
20 of 20 animals from the conventional colony (results from
16 animals
shown in Fig.
5A, lanes 1 to 16). Signal intensity
varied among these
samples, and the signal was weakly detected
in one animal on repeated
assays (Fig.
5A, lane 6). All hand-reared
animals were negative for EBER1 expression by RT-PCR amplification
from
peripheral blood lymphocytes (results from 16 animals shown
in Fig.
5B,
lanes 1 to 16). These results were identical to the
rhesus LCV sVCA
peptide ELISA results and suggested a nearly 100%
prevalence of rhesus
LCV infection in the conventional colony
and absence of rhesus LCV
infection in the hand-reared colony.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 5.
RT-PCR for EBER1 expression in rhesus monkey PBMC. (A)
Southern blot analysis of RT-PCR-amplified products from conventional
colony animals. Lanes 1 to 16 represent 16 animals randomly selected
from the conventional colony. Positive (lane 19) and negative (lanes 17 and 18) controls are shown. (B) Southern blot analysis of
RT-PCR-amplified products from hand-reared colony animals. Lanes 1 to
16 represent 16 randomly selected hand-reared animals. Positive (lanes
17 and 18) and negative (lane 19) controls are shown. (C)
Semiquantitation of rhesus LCV EBER1 by real-time RT-PCR. The EBER1
copy number per 80 ng of total cellular RNA is shown. The limit of
detection (50 copies/80 ng of total RNA) is shown by the dotted line.
|
|
In order to get a better appreciation of the relative magnitude of EBER
RNA expression, samples were quantified by real-time
PCR. As shown in
Fig.
5C, 19 out of 20 animals were positive for
EBER expression, with
levels above the cutoff value. The relative
EBER copy number determined
by real-time PCR differed by almost
4 logs. One animal had undetectable
EBER RNA by real-time PCR,
and this was the same animal whose sample
was weakly positive
by Southern blot hybridization of the RT-PCR
products and strongly
positive by peptide ELISA. Therefore, this animal
was likely rhesus
LCV infected, and the weak or absent EBER signal by
Southern blot
hybridization and real-time PCR may be due to low viral
load or
sequence
variation.
In order to determine the potential effect of strain-dependent sequence
variation, RT-PCR products from four animals were
cloned and sequenced.
The sequences from two animals known to
be infected with the type 1 rhesus LCV (
4) were identical to
the EBER1 sequence derived
from the type 1 rhesus LCV cosmid clone.
The sequences from two animals
known to be infected with the type
2 rhesus LCV (
4) were
identical to each other and differed
from the type 1 rhesus LCV
sequence in 7 of 80 nucleotides. Since
both rhesus LCV strains are
equally prevalent in this colony (
4),
these sequence data
and the ability to detect EBERs in nearly
all animals suggest that
strain-dependent sequence variation is
unlikely to be a major
problem.
Sensitivity and specificity of the rhesus LCV sVCA ELISA during
acute rhesus LCV and RRV infection.
In order to further test the
sensitivity and specificity of the rhesus LCV sVCA peptide ELISA, we
examined the serologic response in an experimentally infected rhesus
macaque. As shown in Fig. 6A, a rhesus
macaque experimentally inoculated with rhesus LCV in the oropharynx
(24) developed a brisk antibody response to the rhesus LCV
sVCA, with a peak response developing by day 10. Rhesus macaques are
also commonly infected with rhesus rhadinovirus (RRV), a
gammaherpesvirus in the rhadinovirus subgroup (19, 44).
Therefore, to rule out the remote possibility that serologic responses
detected with the rhesus LCV sVCA might be due to cross-reactive antibodies specific for the RRV capsid protein, we tested sera from
macaques experimentally inoculated with RRV. We obtained acute- and
convalescent-phase sera from four animals with documented RRV
seroconversion after experimental RRV inoculation (19) and tested these samples in the rhesus LCV sVCA peptide ELISA. Two animals
were seropositive for rhesus LCV sVCA antibodies prior to infection,
and the antibody titers did not change after RRV inoculation (Fig. 6B).
Two animals were rhesus LCV seronegative prior to RRV inoculation and
remained negative as shown by the rhesus LCV sVCA peptide ELISA. The
previously documented RRV seroconversion in these specimens
(19) confirmed that antibodies to the RRV VCA do not
cross-react with the rhesus LCV sVCA.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 6.
Rhesus LCV sVCA peptide ELISA results from an animal
experimentally inoculated with rhesus LCV (A) and from four animals
experimentally inoculated with RRV (B). The dotted line represents the
ELISA cutoff value.
|
|
 |
DISCUSSION |
We have developed highly sensitive and reproducible assays for
acute and persistent rhesus LCV infections. As in humans, LCV infection
is highly prevalent in nonhuman primates and is associated with
B-cell malignancies in immunosuppressed hosts (8, 26). In
addition, experimental infection of rhesus monkeys with the rhesus LCV
provides the only animal model which accurately reproduces many aspects
of acute and persistent EBV infections in humans (24). As
these studies demonstrate, it is possible to breed a rhesus LCV-naive
colony which would reduce the risk of LCV-induced malignancies in
immunosuppressed animals and provide naive animals for pathogenesis and
vaccine studies after experimental rhesus LCV infection.
The rhesus LCV sVCA is moderately well conserved with the EBV sVCA
(69% amino acid identity), falling approximately halfway between the
most and least well conserved lytic genes studied to date (90 to 50%
amino acid identity) (15a, 23). The greatest sequence divergence is in the middle of the protein and overlaps positionally with our peptide 1 (aa 117 to 146), whereas the region represented by peptide 2 was more well conserved. In rhesus macaques the antibody responses to peptide 2 were clearly more prevalent in
rhesus LCV-infected animals, whereas human antibody responses to the
regions represented by peptides 1 and 2 are equally prevalent (42). The observed sequence divergence and potential
differences in immunodominant epitopes may contribute to a loss of
sensitivity when using the EBV sVCA as a cross-reactive antigen for
detecting rhesus LCV-immune sera. The rhesus LCV VCA peptide 2 epitope
was particularly useful since it not only identified all positive animals but also was associated with an extremely robust signal, clearly separating positive and negative results.
The sensitivity and specificity of the VCA peptide ELISA were also
tested using sera from experimentally infected animals. First, a brisk
antibody response was detected in an animal experimentally infected
with rhesus LCV, similar to that previously detected by immunoblotting
(24). Second, the specificity of the assay was checked using
sera from animals experimentally infected with RRV. Rhadinoviruses are
the herpesviruses most closely related to the LCV subgroup, and RRV
infection is also highly prevalent in rhesus monkeys (19, 30,
44). The RRV VCA homologue shares only 24% amino acid identity
(30), and the absence of any cross-reactivity could be
confirmed by studying two animals who remained rhesus LCV seronegative
after experimental RRV infection and documented RRV
seroconversion (19). This specificity is similar to the lack
of serologic cross-reactivity reported between the sVCAs of
Kaposi's sarcoma-associated herpesvirus and EBV (18).
Since we had no gold standard for rhesus LCV infection, we also cloned
the rhesus LCV EBER1 and EBER2 homologues and developed an EBER1 RT-PCR
assay as an independent parameter for rhesus LCV infection. These two
assays measuring different aspects of rhesus LCV lytic and latent
infections gave identical results which further validate the accuracy
of these assays. The ability to directly measure rhesus LCV RNA in the
peripheral blood will also be an important tool for studying LCV
pathogenesis in experimental infections. The RT-PCR assay is a
sensitive indicator for persistent infection since EBER RNA expression
could be detected in at least 95% of the animals. This rapid assay
will be an important tool for experimental pathogenesis studies in
which viral mutants with specific genetic lesions will be tested for
their ability to establish persistent infection. The relatively broad
range of EBER RNA expression levels was somewhat surprising and
probably reflects a combination of different precursor frequencies
of LCV-infected cells in the peripheral blood and different
amounts of EBER RNA per quantity of infected cells. Therefore, it may
be difficult to identify quantitative effects on viral persistence
using simple quantitation of EBER RNA levels in the peripheral blood,
given this broad range of EBER expression levels. Detecting more subtle
quantitative effects on viral persistence will likely require limiting
dilution analysis scored by an EBER RT-PCR assay to determine the
precursor frequency of virus-infected cells (22).
Conservation of the EBER genes also suggests that they play an
important role for the pathogenesis of LCV infection in vivo. The EBERs
are expressed in LCV-immortalized B-cell lines in vitro, but genetic
studies demonstrate that they can be deleted from the EBV genome with
no detectable effect on virus replication or B-cell immortalization in
tissue culture (36). Thus, one predicts that the EBERs must
provide a function which is important for successful LCV infection in
vivo but not necessarily in vitro. The EBERs have sequence similarity
and can functionally replace the adenovirus VA RNAs (29),
which block interferon-induced responses by inhibiting activation of an
interferon-induced protein kinase and phosphorylation of the protein
synthesis initiation factor eIF2 alpha (1, 2). The EBERs
have also been reported to bind the interferon-inducible protein kinase
PKR (33), the ribosomal protein L22 (7, 38, 39),
cellular La protein (11, 15, 17), and (2'-5') oligoadenylate
synthetase (32). However, there is no obvious differential
phenotype observed when B cells infected with wild-type EBV or EBER
deletion mutant EBV are challenged with interferon in vitro (35,
36). The cloning and identification of the EBER genes from rhesus
LCV are the first step towards generating an EBER deletion mutant of
rhesus LCV and using the rhesus animal model to test the hypothesis
that the EBERs are essential for successful LCV infection in vivo.
 |
ACKNOWLEDGMENTS |
This work was funded by grants from the American Heart
Association and U.S. Public Health Service (CA68051 and
CA65319). Animal resources were supported by the
NERPRC (USPHS P51RR00168).
We thank Ronald Desrosiers and Sue Czajak for kindly providing sera
from rhesus macaques experimentally infected with RRV. We thank Ashok
Khatri and the peptide core facility at the Partners Center of AIDS
Research for assistance with the peptide synthesis.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Channing
Laboratories, 181 Longwood Ave., Boston, MA 02115. Phone: (617)
525-4258. Fax: (617) 525-4257. E-mail:
fwang{at}rics.bwh.harvard.edu.
 |
REFERENCES |
| 1.
|
Bhat, R. A., and B. Thimmappaya.
1983.
Two small RNAs encoded by Epstein-Barr virus can functionally substitute for the virus-associated RNAs in the lytic growth of adenovirus 5.
Proc. Natl. Acad. Sci. USA
80:4789-4793[Abstract/Free Full Text].
|
| 2.
|
Bhat, R. A., and B. Thimmappaya.
1985.
Construction and analysis of additional adenovirus substitution mutants confirm the complementation of VAI RNA function by two small RNAs encoded by Epstein-Barr virus.
J. Virol.
56:750-756[Abstract/Free Full Text].
|
| 3.
|
Blake, N. W.,
A. Moghaddam,
P. Rao,
A. Kaur,
R. Glickman,
Y. G. Cho,
A. Marchini,
T. Haigh,
R. P. Johnson,
A. B. Rickinson, and F. Wang.
1999.
Inhibition of antigen presentation by the glycine/alanine repeat domain is not conserved in simian homologues of Epstein-Barr virus nuclear antigen 1.
J. Virol.
73:7381-7389[Abstract/Free Full Text].
|
| 4.
|
Cho, Y. G.,
A. V. Gordadze,
P. D. Ling, and F. Wang.
1999.
Evolution of two types of rhesus lymphocryptovirus similar to type 1 and type 2 Epstein-Barr virus.
J. Virol.
73:9206-9212[Abstract/Free Full Text].
|
| 5.
|
Clarke, P. A.,
N. A. Sharp, and M. J. Clemens.
1992.
Expression of genes for the Epstein-Barr virus small RNAs EBER-1 and EBER-2 in Daudi Burkitt's lymphoma cells: effects of interferon treatment.
J. Gen. Virol.
73:3169-3175[Abstract/Free Full Text].
|
| 6.
|
Desrosiers, R. C.
1997.
The value of specific pathogen-free rhesus monkey breeding colonies for AIDS research.
AIDS Res. Hum. Retrovir.
13:5-6[Medline].
|
| 7.
|
Dobbelstein, M., and T. Shenk.
1995.
In vitro selection of RNA ligands for the ribosomal L22 protein associated with Epstein-Barr virus-expressed RNA by using randomized and cDNA-derived RNA libraries.
J. Virol.
69:8027-8034[Abstract].
|
| 8.
|
Feichtinger, H.,
S. L. Li,
E. Kaaya,
P. Putkonen,
K. Grunewald,
K. Weyrer,
D. Bottiger,
I. Ernberg,
A. Linde,
G. Biberfeld, et al.
1992.
A monkey model for Epstein Barr virus-associated lymphomagenesis in human acquired immunodeficiency syndrome.
J. Exp. Med.
176:281-286[Abstract/Free Full Text].
|
| 9.
|
Franken, M.,
B. Annis,
A. N. Ali, and F. Wang.
1995.
5' coding and regulatory region sequence divergence with conserved function of the Epstein-Barr virus LMP2A homolog in herpesvirus papio.
J. Virol.
69:8011-8019[Abstract].
|
| 10.
|
Franken, M.,
O. Devergne,
M. Rosenzweig,
B. Annis,
E. Kieff, and F. Wang.
1996.
Comparative analysis identifies conserved tumor necrosis factor receptor-associated factor 3 binding sites in the human and simian Epstein-Barr virus oncogene LMP1.
J. Virol.
70:7819-7826[Abstract].
|
| 11.
|
Glickman, J. N.,
J. G. Howe, and J. A. Steitz.
1988.
Structural analyses of EBER1 and EBER2 ribonucleoprotein particles present in Epstein-Barr virus-infected cells.
J. Virol.
62:902-911[Abstract/Free Full Text].
|
| 12.
|
Henle, W.,
G. Henle,
J. Andersson,
I. Ernberg,
G. Klein,
C. A. Horwitz,
G. Marklund,
L. Rymo,
C. Wellinder, and S. E. Straus.
1987.
Antibody responses to Epstein-Barr virus-determined nuclear antigen (EBNA)-1 and EBNA-2 in acute and chronic Epstein-Barr virus infection.
Proc. Natl. Acad. Sci. USA
84:570-574[Abstract/Free Full Text].
|
| 13.
|
Hilliard, J. K., and J. A. Ward.
1999.
B-virus specific-pathogen-free breeding colonies of macaques (Macaca mulatta): retrospective study of seven years of testing.
Lab. Anim. Sci.
49:144-148[Medline].
|
| 14.
|
Howe, J. G., and M. D. Shu.
1988.
Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.
J. Virol.
62:2790-2798[Abstract/Free Full Text].
|
| 15.
|
Howe, J. G., and J. A. Steitz.
1986.
Localization of Epstein-Barr virus-encoded small RNAs by in situ hybridization.
Proc. Natl. Acad. Sci. USA
83:9006-9010[Abstract/Free Full Text].
|
| 15a.
|
Jiang, H.,
Y. Cho, and F. Wang.
2000.
Structural, functional, and genetic comparisons of Epstein-Barr virus nuclear antigen 3A, 3B, and 3C homologues encoded by the rhesus lymphocryptovirus.
J. Virol.
74:5921-5932[Abstract/Free Full Text].
|
| 16.
|
Kieff, E., and D. Liebowitz.
1990.
Epstein-Barr virus and its replication, p. 1889-1920.
In
D. Knipe, B. Fields, and R. Chanock (ed.), Virology. Raven Press, New York, N.Y.
|
| 17.
|
Lerner, M. R.,
N. C. Andrews,
G. Miller, and J. A. Steitz.
1981.
Two small RNAs encoded by Epstein-Barr virus and complexed with protein are precipitated by antibodies from patients with systemic lupus erythematosus.
Proc. Natl. Acad. Sci. USA
78:805-809[Abstract/Free Full Text].
|
| 18.
|
Lin, S. F.,
R. Sun,
L. Heston,
L. Gradoville,
D. Shedd,
K. Haglund,
M. Rigsby, and G. Miller.
1997.
Identification, expression, and immunogenicity of Kaposi's sarcoma-associated herpesvirus-encoded small viral capsid antigen.
J. Virol.
71:3069-3076[Abstract].
|
| 19.
|
Mansfield, K. G.,
S. V. Westmoreland,
C. D. DeBakker,
S. Czajak,
A. A. Lackner, and R. C. Desrosiers.
1999.
Experimental infection of rhesus and pig-tailed macaques with macaque rhadinoviruses.
J. Virol.
73:10320-10328[Abstract/Free Full Text].
|
| 20.
|
Margalith, M.,
B. Sarov,
I. Sarov,
C. Rinaldo,
R. Detels,
J. Phair,
R. Kaslow,
H. Ginsberg, and A. Saah.
1990.
Serum IgG and IgA antibodies specific to Epstein-Barr virus capsid antigen in a longitudinal study of human immunodeficiency virus infection and disease progression in homosexual men.
AIDS Res. Hum. Retrovir.
6:607-616[Medline].
|
| 21.
|
Milman, G.,
A. L. Scott,
M. S. Cho,
S. C. Hartman,
D. K. Ades,
G. S. Hayward,
P. F. Ki,
J. T. August, and S. D. Hayward.
1985.
Carboxyl-terminal domain of the Epstein-Barr virus nuclear antigen is highly immunogenic in man.
Proc. Natl. Acad. Sci. USA
82:6300-6304[Abstract/Free Full Text].
|
| 22.
|
Miyashita, E. M.,
B. Yang,
K. M. Lam,
D. H. Crawford, and D. A. Thorley-Lawson.
1995.
A novel form of Epstein-Barr virus latency in normal B cells in vivo.
Cell
80:593-601[CrossRef][Medline].
|
| 23.
|
Moghaddam, A.,
J. Koch,
B. Annis, and F. Wang.
1998.
Infection of human B lymphocytes with lymphocryptoviruses related to Epstein-Barr virus.
J. Virol.
72:3205-3212[Abstract/Free Full Text].
|
| 24.
|
Moghaddam, A.,
M. Rosenzweig,
D. Lee-Parritz,
B. Annis,
R. P. Johnson, and F. Wang.
1997.
An animal model for acute and persistent Epstein-Barr virus infection.
Science
276:2030-2033[Abstract/Free Full Text].
|
| 25.
|
Peng, R.,
A. V. Gordadze,
E. M. Fuentes Panana,
F. Wang,
J. Zong,
G. S. Hayward,
J. Tan, and P. D. Ling.
2000.
Sequence and functional analysis of EBNA-LP and EBNA2 proteins from nonhuman primate lymphocryptoviruses.
J. Virol.
74:379-389[Abstract/Free Full Text].
|
| 26.
|
Rangan, S. R.,
L. N. Martin,
B. E. Bozelka,
N. Wang, and B. J. Gormus.
1986.
Epstein-Barr virus-related herpesvirus from a rhesus monkey (Macaca mulatta) with malignant lymphoma.
Int. J. Cancer
38:425-432[Medline].
|
| 27.
|
Rickinson, A. B., and E. Kieff.
1996.
Epstein-Barr virus, p. 2397-2446.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 28.
|
Rivailler, P.,
C. Quink, and F. Wang.
1999.
Strong selective pressure for evolution of an Epstein-Barr virus LMP2B homologue in the rhesus lymphocryptovirus.
J. Virol.
73:8867-8872[Abstract/Free Full Text].
|
| 29.
|
Rosa, M. D.,
E. Gottlieb,
M. R. Lerner, and J. A. Steitz.
1981.
Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII.
Mol. Cell. Biol.
1:785-796[Abstract/Free Full Text].
|
| 30.
|
Searles, R. P.,
E. P. Bergquam,
M. K. Axthelm, and S. W. Wong.
1999.
Sequence and genomic analysis of a rhesus macaque rhadinovirus with similarity to Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8.
J. Virol.
73:3040-3053[Abstract/Free Full Text].
|
| 31.
|
Serio, T. R.,
A. Angeloni,
J. L. Kolman,
L. Gradoville,
R. Sun,
D. A. Katz,
W. Van Grunsven,
J. Middeldorp, and G. Miller.
1996.
Two 21-kilodalton components of the Epstein-Barr virus capsid antigen complex and their relationship to ZEBRA-associated protein p21 (ZAP21).
J. Virol.
70:8047-8054[Abstract].
|
| 32.
|
Sharp, T. V.,
D. A. Raine,
D. R. Gewert,
B. Joshi,
R. Jagus, and M. J. Clemens.
1999.
Activation of the interferon-inducible (2'-5') oligoadenylate synthetase by the Epstein-Barr virus RNA, EBER-1.
Virology
257:303-313[CrossRef][Medline].
|
| 33.
|
Sharp, T. V.,
M. Schwemmle,
I. Jeffrey,
K. Laing,
H. Mellor,
C. G. Proud,
K. Hilse, and M. J. Clemens.
1993.
Comparative analysis of the regulation of the interferon-inducible protein kinase PKR by Epstein-Barr virus RNAs EBER-1 and EBER-2 and adenovirus VAI RNA.
Nucleic Acids Res.
21:4483-4490[Abstract/Free Full Text].
|
| 34.
|
Shedd, D.,
A. Angeloni,
J. Niederman, and G. Miller.
1995.
Detection of human serum antibodies to the BFRF3 Epstein-Barr virus capsid component by means of a DNA-binding assay.
J. Infect. Dis.
172:1367-1370[Medline].
|
| 35.
|
Swaminathan, S.,
B. S. Huneycutt,
C. S. Reiss, and E. Kieff.
1992.
Epstein-Barr virus-encoded small RNAs (EBERs) do not modulate interferon effects in infected lymphocytes.
J. Virol.
66:5133-5136[Abstract/Free Full Text].
|
| 36.
|
Swaminathan, S.,
B. Tomkinson, and E. Kieff.
1991.
Recombinant Epstein-Barr virus with small RNA (EBER) genes deleted transforms lymphocytes and replicates in vitro.
Proc. Natl. Acad. Sci. USA
88:1546-1550[Abstract/Free Full Text].
|
| 37.
|
Tierney, R. J.,
N. Steven,
L. S. Young, and A. B. Rickinson.
1994.
Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state.
J. Virol.
68:7374-7385[Abstract/Free Full Text].
|
| 38.
|
Toczyski, D. P.,
A. G. Matera,
D. C. Ward, and J. A. Steitz.
1994.
The Epstein-Barr virus (EBV) small RNA EBER1 binds and relocalizes ribosomal protein L22 in EBV-infected human B lymphocytes.
Proc. Natl. Acad. Sci. USA
91:3463-3467[Abstract/Free Full Text].
|
| 39.
|
Toczyski, D. P., and J. A. Steitz.
1991.
EAP, a highly conserved cellular protein associated with Epstein-Barr virus small RNAs (EBERs).
EMBO J.
10:459-466[Medline].
|
| 40.
|
Tranchand-Bunel, D.,
H. Gras-Masse,
B. Bourez,
L. Dedecker, and C. Auriault.
1999.
Evaluation of an Epstein-Barr virus (EBV) immunoglobulin M enzyme-linked immunosorbent assay using a synthetic convergent peptide library, or mixotope, for diagnosis of primary EBV infection.
J. Clin. Microbiol.
37:2366-2368[Abstract/Free Full Text].
|
| 41.
|
van Grunsven, W. M.,
A. Nabbe, and J. M. Middeldorp.
1993.
Identification and molecular characterization of two diagnostically relevant marker proteins of the Epstein-Barr virus capsid antigen complex.
J. Med. Virol.
40:161-169[Medline].
|
| 42.
|
van Grunsven, W. M.,
W. J. Spaan, and J. M. Middeldorp.
1994.
Localization and diagnostic application of immunodominant domains of the BFRF3-encoded Epstein-Barr virus capsid protein.
J. Infect. Dis.
170:13-19[Medline].
|
| 43.
|
van Grunsven, W. M.,
E. C. van Heerde,
H. J. de Haard,
W. J. Spaan, and J. M. Middeldorp.
1993.
Gene mapping and expression of two immunodominant Epstein-Barr virus capsid proteins.
J. Virol.
67:3908-3916[Abstract/Free Full Text].
|
| 44.
|
Wong, S. W.,
E. P. Bergquam,
R. M. Swanson,
F. W. Lee,
S. M. Shiigi,
N. A. Avery,
J. W. Fanton, and M. K. Axthelm.
1999.
Induction of B cell hyperplasia in simian immunodeficiency virus-infected rhesus macaques with the simian homologue of Kaposi's sarcoma-associated herpesvirus.
J. Exp. Med.
190:827-840[Abstract/Free Full Text].
|
| 45.
|
Yao, Q. Y.,
A. B. Rickinson, and M. A. Epstein.
1985.
Oropharyngeal shedding of infectious Epstein-Barr virus in healthy virus-immune donors. A prospective study.
Chin. Med. J.
98:191-196[Medline]. (In English.)
|
| 46.
|
Yates, J. L.,
S. M. Camiolo,
S. Ali, and A. Ying.
1996.
Comparison of the EBNA1 proteins of Epstein-Barr virus and herpesvirus papio in sequence and function.
Virology
222:1-13[CrossRef][Medline].
|
Journal of Clinical Microbiology, September 2000, p. 3219-3225, Vol. 38, No. 9
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Fogg, M. H., Garry, D., Awad, A., Wang, F., Kaur, A.
(2006). The BZLF1 Homolog of an Epstein-Barr-Related {gamma}-Herpesvirus Is a Frequent Target of the CTL Response in Persistently Infected Rhesus Macaques. J. Immunol.
176: 3391-3401
[Abstract]
[Full Text]
-
Fogg, M. H., Kaur, A., Cho, Y.-G., Wang, F.
(2005). The CD8+ T-Cell Response to an Epstein-Barr Virus-Related Gammaherpesvirus Infecting Rhesus Macaques Provides Evidence for Immune Evasion by the EBNA-1 Homologue. J. Virol.
79: 12681-12691
[Abstract]
[Full Text]
-
Fogg, M. H., Carville, A., Cameron, J., Quink, C., Wang, F.
(2005). Reduced Prevalence of Epstein-Barr Virus-Related Lymphocryptovirus Infection in Sera from a New World Primate. J. Virol.
79: 10069-10072
[Abstract]
[Full Text]
-
Rivailler, P., Carville, A., Kaur, A., Rao, P., Quink, C., Kutok, J. L., Westmoreland, S., Klumpp, S., Simon, M., Aster, J. C., Wang, F.
(2004). Experimental rhesus lymphocryptovirus infection in immunosuppressed macaques: an animal model for Epstein-Barr virus pathogenesis in the immunosuppressed host. Blood
104: 1482-1489
[Abstract]
[Full Text]
-
Kutok, J. L., Klumpp, S., Simon, M., MacKey, J. J., Nguyen, V., Middeldorp, J. M., Aster, J. C., Wang, F.
(2004). Molecular Evidence for Rhesus Lymphocryptovirus Infection of Epithelial Cells in Immunosuppressed Rhesus Macaques. J. Virol.
78: 3455-3461
[Abstract]
[Full Text]
-
Kaur, A., Kassis, N., Hale, C. L., Simon, M., Elliott, M., Gomez-Yafal, A., Lifson, J. D., Desrosiers, R. C., Wang, F., Barry, P., Mach, M., Johnson, R. P.
(2003). Direct Relationship between Suppression of Virus-Specific Immunity and Emergence of Cytomegalovirus Disease in Simian AIDS. J. Virol.
77: 5749-5758
[Abstract]
[Full Text]
-
Rivailler, P., Cho, Y.-g., Wang, F.
(2002). Complete Genomic Sequence of an Epstein-Barr Virus-Related Herpesvirus Naturally Infecting a New World Primate: a Defining Point in the Evolution of Oncogenic Lymphocryptoviruses. J. Virol.
76: 12055-12068
[Abstract]
[Full Text]
-
Rivailler, P., Jiang, H., Cho, Y.-g., Quink, C., Wang, F.
(2002). Complete Nucleotide Sequence of the Rhesus Lymphocryptovirus: Genetic Validation for an Epstein-Barr Virus Animal Model. J. Virol.
76: 421-426
[Abstract]
[Full Text]