INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

Disseminated trichosporonosis is an opportunistic infection occasionally found in immunocompromised patients, particularly those with hematological malignancies or cancers who are treated with chemotherapy or those who are on immunosuppressants following organ transplantation (3, 8, 10, 13, 15, 18, 20, 21). Trichosporon asahii and Trichosporon mucoides are the most common strains of fungi known to cause disseminated trichosporonosis (5, 8). It is believed that these fungi enter the body via areas where indwelling vascular catheters and drainage tubes are inserted, damaged areas on the skin of burn patients, and microbial translocation from the intestinal mucosa (17, 18, 20). However, it is not fully clear how these fungi cause disseminated trichosporonosis.

Since this disease can cause death within a very short time, it is generally considered an acutely disseminating infection (15, 18). Accordingly, animal models for disseminated trichosporonosis have been prepared by intravenous inoculation of large numbers of fungi in immunocompromised hosts (1, 2, 4, 7, 9, 14, 22, 25). However, in clinical practice, it is unlikely for large numbers of fungi to enter the blood at once. Therefore, the designed animal models for disseminated trichosporonosis are not suitable for analysis of the progression of this disease but rather for estimation of pathogenicity and drug efficacy.

We postulated that small numbers of fungi enter the bloodstream and in the presence of low immunological status, these fungi proliferate in the host and induce disseminated trichosporonosis. In other words, the process of trichosporonosis commences as asymptomatic trichosporonemia, but the risk of disseminated trichosporonosis is increased when immunological competence diminishes by exacerbation of the underlying disease or following the administration of chemotherapy. To test this hypothesis, we developed a new experimental animal model and investigated the progression of disseminated trichosporonosis. Our results demonstrated that disseminated trichosporonosis is induced by immunosuppression in hosts with latent trichosporonemia. Furthermore, we found that there is a critical period for the progression of disseminated trichosporonosis after entry of fungi into the bloodstream.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

Fungi. T. asahii OMU239, isolated in blood cultures from a patient with acute myelogenous leukemia at Oita Medical University Hospital, was used in all experiments. The strain was identified based on DNA sequence homology and accepted by the Teikyou University Research Center for Medical Mycology as T. asahii TIMM4014.

Inoculum Preparation. T. asahii was stored in a skim milk suspension at 80°C until use. It was thawed and then cultured on Sabouraud dextrose agar (SDA; Eiken Chemical Co., Tokyo, Japan) at 37°C for 48 h. To ensure purity and fungal activity, it was incubated again at 37°C for 48 h on fresh SDA. Mature fungi were harvested using a platinum loop and suspended in sterile distilled water. The cell suspension was filtered through 12 layers of sterile gauze to remove hyphae. The filtered fungal suspension was diluted 10-fold using sterile distilled water, and fungal cells were counted using a hemocytometer. To confirm the count by hemocytometer, diluted cell suspensions were cultured on SDA at 37°C for 48 h. Finally, a cell suspension containing 10⁷ CFU of T. asahii per ml including more than 90% as conidial forms was prepared.

Animals. In all experiments, 8-week-old male ICR mice (average weight ± standard deviation, 28 ± 4 g), purchased from Charles River Japan (Oita, Japan), were used. These mice were fed dried food designed for experiments, and as a prophylaxis against intercurrent bacterial infections, they were provided with water containing 50 µg of vancomycin (Shionogi & Co., Osaka, Japan) per ml and 10 µg of gentamicin (Schering-Plough K. K., Osaka, Japan) per ml. Each cage housed five mice. All animal experiments were performed according to the guidelines of the Ethical Committee for Animal Experiments at Oita Medical University.

Experimental protocols. (i) Initial immunosuppression and T. asahii infection. In each mouse, 200 mg of cyclophosphamide (CPM; Shionogi & Co.) per kg of body weight per day (on days 3 and 2) and 30 mg of prednisolone (PSL; Shionogi & Co.) per kg per day (on day 1) were injected intraperitoneally to induce initial immunosuppression (Fig. 1). Subsequently, these mice were divided into two groups. In one group, 0.3 ml of T. asahii suspension (10⁷ CFU/ml) was injected into the caudal vein on day 0. Preliminary results showed that the survival rate due to this dose of T. asahii was 80% in immunocompromised mice (data not shown). For comparison (control, no T. asahii infection), 0.3 ml of physiological saline was injected into the caudal vein on day 0 in another group of mice. Next, based on the timing of reimmunosuppression, mice injected with T. asahii were divided into four subgroups (R0, R1, R2, and R3), while control mice not infected with T. asahii were also divided into four subgroups (r0, r1, r2, and r3).

View larger version (21K): [in this window] [in a new window]   FIG. 1.   Experimental protocols. To lower immunological competence in the initial part of the study, 200 mg of CPM per kg per day (days 3 and 2) and 30 mg of PSL per kg per day (day 1) were injected intraperitoneally into 8-week-old male ICR mice. Next, these mice were divided into two groups; in one group of mice, 0.3 ml of T. asahii suspension (107/ml) was injected into the caudal vein on day 0, while the other group received the same volume of the vehicle in the same manner on the same day. Then mice infected with T. asahii were divided into four subgroups (R0, R1, R2, and R3), and those not infected with T. asahii were also divided into four subgroups (r0, r1, r2, and r3). Reimmunosuppression was performed at different times with 1-week intervals. Mice were monitored closely for 5 weeks after fungal infection.

(ii) Reimmunosuppression. Reimmunosuppression was performed using the same immunosuppressants at 1 week (on days 7, 8, and 9) after fungal infection for mice of groups r1 and R1, at 2 weeks (on days 14, 15, and 16) for mice of groups r2 and R2, and at 3 weeks (on days 21, 22, and 23) for mice of groups r3 and R3. These reimmunosuppressants were not administered to mice of groups r0 and R0 for comparison (control, no reimmunosuppression).

Measured parameters. (i) Effects of initial and reimmunosuppression on neutrophil count. The total number of leukocytes was determined using a hemocytometer in uninfected mice (r0, r1, r2, and r3; 10 mice/group) once a day for 10 days after administration of immunosuppressants. Differential counts were quantitated in Giemsa-stained leukocyte smears.

(ii) Survival rate of mice following T. asahii infection. Mice infected with T. asahii (R0, R1, R2, and R3: 10 mice/group) and those uninfected (r0, r1, r2, and r3: 10 mice/group) were observed for 5 weeks after injection of fungal suspensions or physiological saline. The lungs, liver, spleen, and kidneys of mice that died during the observation period were excised to pathologically determine the exact cause of death. These specimens were stained using hematoxylin-eosin (HE) or Gomori-methenamine silver (GMS).

(iii) Clearance of fungi from blood and organs of mice infected with T. asahii. Using 30 R0 mice, we investigated the clearance of T. asahii microbiologically, serologically, and pathologically. On days 0 (immediately after T. asahii infection), 7, 14, 17, 21, 28, and 35, the blood, lungs, spleen, and kidneys were collected under sterile conditions (3 mice/day) under ether anesthesia. A 100-µl volume of blood was cultured on SDA at 37°C for 48 h to count the number of fungal cells. The remaining blood samples were centrifuged at 2,500 × g for 10 min at room temperature, and the obtained serum samples were used for nested PCR and glucuronoxylomannan (GXM) antigen assays. The right lung, right hepatic lobe, part of the spleen, and right kidney were homogenized with sterile distilled water. The samples from each specimen were serially diluted 10-fold using sterile distilled water and cultured in a manner similar to that described for blood to count fungal cells. Specimens stained with HE or GMS were prepared using samples from the left lung, left hepatic lobe, part of the spleen, and the left kidney. They were then pathologically assessed in a blinded fashion to determine fungal clearance. The results of the pathological findings, blood cultures, and serological assays were compared in each mouse. The presence of T. asahii in the kidney and in other organs was recorded separately.

(iv) Fungal clearance from blood and organs following reimmunosuppression. Clearance of T. asahii was investigated microbiologically, serologically, and pathologically in R1, R2, and R3 mice (30 each). The blood, lungs, liver, spleen, and kidneys were harvested under ether anesthesia on days 7, 10, 12, and 14, from R1 mice (3 mice/day); on days 14, 17, 19, and 21 from R2 mice; and on days 21, 24, 26, and 28 from R3 mice. These samples were handled in the same way as with the R0 mice.

Serological assays. (i) Nested PCR assay. Nested PCR was performed according to the method described by Nagai et al. (15). Serum samples were treated with proteinase K to extract DNA and then were used as templates (24). Two sets of oligonucleotide primers derived from the sequence of 26S rRNA genes of T. asahii can specifically detect T. asahii and T. mucoides. In a single PCR step, TB26-1 (5' AAAGATGAAAAGCACTTTGG3') and TB26-2 (5' AAGCCATTATGTCAACATCC3') were used as primers, and 30 cycles of DNA amplification were performed (1 min of denaturation at 94°C, 2 min of annealing at 55°C, and 2 min of DNA extension at 72°C). In the nested PCR step, TB26-9 (5' AGCACTTTGGAAAGAGAG3') and TB26-10 (5'CCTAAGCTCGAACGTGCC3') were used as primers, and DNA was amplified in the same fashion except for the primer annealing temperature. This step was carried out at 63°C for 2 min. To avoid possible contamination of PCR mixtures, all reactions were performed under stringent conditions, as recommended by Kwok and Higuchi (11). Nested PCR products were electrophoresed on 2% agarose gel containing ethidium bromide, and the results were photographed.

(ii) GXM assay. The latex agglutination test, Serodirect "Eiken" Cryptococcus (Eiken Chemical Co.), was used for detection of GXM-like polysaccharide antigen from T. asahii (12). Assays were performed according to the instructions provided by the manufacturer.

Statistical analysis. Survival rates were analyzed by the Kaplan-Meier method, and P values of less than 0.05 were considered statistically significant. Neutrophil and fungal cell counts were expressed as means ± standard deviations. When no fungal cells were detected, the lower detection limit was used for analysis (blood culture, 10 CFU/ml, organ culture, 100 CFU/g).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

Changes in neutrophil counts by initial immunosuppression and reimmunosuppression. The initial immunosuppression resulted in a significant neutropenia (neutrophil count <500/µl) during the first 5 days (days 0 to 4), but the count recovered to the basal level by day 7. Neutrophil counts of <500/µl were noted in R1, R2, and R3 mice for 5 days, between 3 and 7 days after reimmunosuppression. There were no differences in the duration or degree of leukopenia among the different groups (data not shown).

Survival rate following T. asahii infection. The 5-week-survival rate after T. asahii infection was 0% for group R1, 50% for group R2, 80% for group R3, and 80% for group R0. There was a significant difference in the survival rate between groups R1 and R0 or R3 (P < 0.05) (Fig. 2). On the other hand, the survival rate of mice treated with physiological saline was 100% for all groups (r1, r2, r3, and r0). These results confirmed that mice did not die of adverse reactions caused by administration of immunosuppressants.

View larger version (12K): [in this window] [in a new window]   FIG. 2.   Survival rates of R0, R1, R2, and R3 mice infected with T. asahii. The survival rate of mice infected with T. asahii (10 mice/group) was analyzed by the Kaplan-Meier method. Within 1 week of fungal infection (up to day 7), two mice died in each group (R0, R1, R2, and R3). All remaining eight mice in group R1 died within 1 week after reimmunosuppression (up to day 14). In addition, three mice in group R2 died within 1 week after reimmunosuppression (up to day 21). However, none of the remaining mice in group R3 died following reimmunosuppression. There was a significant difference in the survival rates between groups R1 and R0 or R3 (P < 0.05).

View larger version (152K): [in this window] [in a new window]   FIG. 3.   Pathological findings in a representative R1 mouse, which died at day 14 postinfection (7 days after reimmunosuppression). (A) Lung (×200, HE); (B) lung (×200, GMS); (C) kidney (×200, HE); (D) kidney (×200, GMS). Note the presence of fungal proliferation, inflammatory cellular infiltration and/or hemorrhage in each section.

Fungal clearance from blood and organs of mice infected with T. asahii. Table 1 shows the results of fungal clearance in R0 mice. Six of the 30 mice died after infection. Organ cultures were not performed on days 0 and 17. Fungal-cell counts dropped below the detection limit in the blood by day 14, the spleen by day 21, and the liver and lung by day 28. However, T. asahii was still detected on SDA in the kidney on day 35. 

Fungal clearance from blood and organs following reimmunosuppression. Figure 4 shows the fungal clearance in R1, R2, and R3 mice. T. asahii was not cleared at all from the blood and organs of R1 mice. Furthermore, T. asahii was not cleared fully from R2 mice. Despite the reimmunosuppression, fungal-cell counts in the blood and organs in R3 mice were below the detection limit in all tissues except the kidney by 7 days after reimmunosuppression. Table 3 compares the pathological findings with the results of the nested PCR assay, the GXM antigen assay, and blood cultures in R1, R2, and R3 mice. In R1 mice, the results of blood culture, the nested PCR assay, and the GXM antigen assay were all positive, and T. asahii was observed in the lung, liver, spleen, and kidney. In R2 mice, although T. asahii was not detected on day 14 (before reimmunosuppression) in blood cultures and pathological specimens of the lung, liver, and spleen, it was detected on day 17 in all mice and in only one of three mice on days 19 and 21. On the other hand, the nested PCR was positive in two mice on day 14 and in all mice on day 17, and then became positive in two mice on day 19 and one mouse on day 21. However, the GXM antigen assay was positive in all serum samples, and T. asahii was detected in all kidney specimens. In R3 mice, between days 21 (before reimmunosuppression) and 28 (7 days after reimmunosuppression), the results of blood culture, the nested PCR assay, and pathological examinations (lung, liver, and spleen) were all negative. Nonetheless, T. asahii was detected by the GXM antigen assay and in the kidney throughout the observation period.

View larger version (19K): [in this window] [in a new window]   FIG. 4.   Organ clearance of T. asahii from R1, R2, and R3 mice. Three mice in each group (n = 30 each) were sacrificed each day, and the lungs, liver, spleen, kidneys, and blood were dissected out. The detection limit of fungal cell counts in peripheral blood was 10 CFU/ml, and that in various organs was 100 CFU/ml.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

Disseminated trichosporonosis is often seen in patients with depressed bone marrow function associated with hematological malignancies or cancers under chemotherapy (3, 8, 10, 15, 18, 21). Hence, a compromised immune system seems to allow fungal contamination and colonization to become a lethal opportunistic infection. In clinical practice, Trichosporon cannot always be detected in blood samples, thus making it difficult to diagnose disseminated trichosporonosis. In addition, since disseminated trichosporonosis is difficult to differentiate histologically from disseminated candidiasis, it is often difficult to make a definite diagnosis (16, 18). The delay in diagnosis may contribute to the poor prognosis of this disease.

In previous animal models, reduced number and function of neutrophils were thought to be closely involved in the onset of disseminated trichosporonosis (1, 2, 4, 7, 9, 14, 22, 25). These animal models for disseminated trichosporonosis are prepared by first severely compromising the immune system (accompanied by leukopenia) followed by inoculation of a large number of fungi. Hence, in such animal models, the mortality rate is largely determined by the dosage of immunosuppressants and the amount of inoculated pathogen. However, in clinical practice, the number of fungi that enter the body is markedly smaller than that used in animal experiments. Furthermore, immunosuppressants and anticancer agents are not, in general, administered simultaneously but rather intermittently. Therefore, we assumed that the fungi enter the body by microbial translocation when the body's immune competence is lowered by the initial treatment and that fungi that evade the body's defense mechanism cause disseminated trichosporonosis when the immune competence is lowered again by additional therapy. To examine such mechanisms using an animal model, it is necessary to establish a latent trichosporonemia with persistent infection (i.e., fungi are found in hosts in nonlethal amounts) and then induce immunosuppression.

Previous studies have demonstrated a time lag in the clearance of fungi from blood and organs during recovery of immunological competence in mice infected with Trichosporon (4). Even when small numbers of fungi remain in the body, they do not affect survival. Hence, we thought that our hypothesis could be proven if a lethally disseminating infection can be induced by additional administration of immunosuppressants. To reduce the number of neutrophils in peripheral blood, CPM was administered, and to lower the immunological competence of the major organs, PSL was injected intraperitoneally before infecting the mice with T. asahii. It was assumed that bone marrow function would recover within 7 days after the initial immunosuppression and by taking into account the clinical usage of anticancer chemotherapy, the additional immunosuppressants were administered on days 7, 8, and 9; 14, 15, and 16; 21, 22, and 23; and 28, 29, and 30. However, as shown in Fig. 2, there was no difference in the survival rate between group R0 (control, no reimmunosuppression) and group R3 (reimmunosuppression on days 21, 22, and 23); thus reimmunosuppression was not performed on days 28, 29, and 30.

The survival rates in group R1 (reimmunosuppression on days 7, 8, and 9) and group R2 (reimmunosuppression on days 14, 15, and 16) were lower than in group R0, and disseminated trichosporonosis was pathologically confirmed in all deceased mice. These findings showed that disseminated trichosporonosis developed when immunosuppressants were administered during the process of eliminating T. asahii. In the present model, the critical period for the progression of disseminated trichosporonosis by reimmunosuppression was shorter than 21 days after infection. Clinically, chemotherapy is generally administered to patients with hematological malignancies at 1- or 2-week intervals. Thus, it is possible that trichosporonemia, which develops during chemotherapy-induced suppression of bone marrow function, might develop into disseminated trichosporonosis by subsequent administration of anticancer agents.

In the R1 mice, reimmunosuppression was induced when fungi were still detectable in the blood and major organs, and disseminated trichosporonosis was confirmed in all mice. Furthermore, in R2 mice, reimmunosuppression was induced when fungi were detected in major organs but not in peripheral blood. At 14 days after T. asahii infection, the results of blood culture were negative in all mice, but reimmunosuppression caused death due to disseminated trichosporonosis in some but not all mice. In R3 mice, reimmunosuppression was induced when fungi were still detectable in major organs, except the spleen and blood. None of the mice died or developed lethal disseminated trichosporonosis. These results suggest that, in order for disseminated trichosporonosis to be induced in mice by reimmunosuppression, the presence of T. asahii in major organs, except the spleen and blood, was not always important. In addition, we have investigated whether T. asahii brain involvement was not always important for dissemination in this experiment (data not shown). With regard to fungal clearance from the blood, just prior to reimmunosuppression, blood cultures from some R2 mice were negative but were positive on nested PCR and the GXM assay, while other mice tested negative on blood culture and nested PCR but positive in the GXM assay. Therefore, if positive nested PCR represented latent trichosporonemia in R2 mice, then it is highly possible that latent trichosporonemia developed into disseminated trichosporonosis by reimmunosuppression. This notion is supported by the finding that none of the R3 mice tested positive by nested PCR and that reimmunosuppression did not cause disseminated trichosporonosis in R3 mice. In other words, the apparently reduced survival rate in groups R1 and R2 compared to groups R0 and R3 was dependent on the presence of latent trichosporonemia before reimmunosuppression, thus suggesting the importance of latent trichosporonemia in the progression of disseminated trichosporonosis caused by reimmunosuppression.

What were the underlying mechanisms that precipitated disseminated trichosporonosis in R2 mice? It is possible that the persistent presence of fungi in different organs played a role in this process. However, there were no significant differences in the survival rates between group R3 (fungi were detected in major organs except the spleen) and group R0, suggesting that the persistent colonization of fungi in various organs did not play a major role in the progression of disseminated trichosporonosis. In other words, it is difficult to assume that fungi remaining in organs can cause disseminated trichosporonosis. Therefore, we believe that disseminated trichosporonosis could develop in the presence of only a very small number of fungi in the blood, which were detectable by the nested PCR but not by blood culture.

Our results may have important clinical implications. For instance, it is important to detect latent trichosporonemia during the early stages to prevent the progression of disseminated trichosporonosis. We compared the usefulness of the specific DNA detection assay (nested PCR with serum), serum GXM antigen assay, and blood culture in the diagnosis of latent trichosporonemia. Our results showed that blood culture could detect fungi up to day 7, but nested PCR could detect fungi up to day 17. Therefore, the period in which fungi were detectable by the nested PCR matched the critical period for the progression of disseminated trichosporonosis by reimmunosuppression. On the other hand, the GXM antigen assay could detect fungi in each infected mouse over a long period. Therefore, this assay is useful in determining the presence of Trichosporon, but it is not suitable for monitoring the progression of disseminated trichosporonosis.

Previous studies have examined the role of PCR in monitoring systemic candidiasis or pulmonary aspergillosis (6, 19, 23). However, to our knowledge, there are no studies that have previously examined the value of PCR monitoring in experimental disseminated trichosporonosis. In this study, we investigated not only the underlying mechanisms but also PCR monitoring of experimental disseminated trichosporonosis.

In conclusion, we described in the present study a new mouse model to study the underlying mechanism of disseminated trichosporonosis. Our results showed that when the immunological competence of hosts with latent trichosporonemia is compromised by immunosuppressants or anticancer agents, disseminated trichosporonosis can progress by additional immunosuppression. In addition, we also demonstrated that nested PCR using serum samples is a useful test for early detection of latent trichosporonemia. Further studies of disseminated trichosporonosis should be conducted in clinical practice, particularly to assess the diagnostic value of nested PCR in detecting latent trichosporonemia in order to prevent or arrest the progression of disseminated trichosporonosis. Monitoring of latent trichosporonemia by nested PCR in the present animal model suggests the safe timing of reimmunosuppression by chemotherapy.