Previous Article | Next Article 
Journal of Clinical Microbiology, September 2000, p. 3467-3469, Vol. 38, No. 9
Division of
Bacteriology1 and Division of
Virology,2 Department of Public Health, Osaka
Prefectural Institute of Public Health, Nakamichi, Higashinari-ku,
Osaka 537-0025, and Department of Clinical Pathology, Osaka
Medical College, Takatsuki 569-8686,3 Japan
Received 2 December 1999/Returned for modification 28 April
2000/Accepted 12 June 2000
Seventy-three B/Victoria group strains isolated in the 1996-1997
influenza season were divided into three groups according to the degree
of reactivity to monoclonal antibody 8E6. Analysis of nucleotide
sequences of the HA1 region clarified that single amino acid
substitutions were responsible for the difference in reactivity to 8E6.
Influenza is one of the most
important infectious diseases in industrial as well as developing
countries. Over the past 20 years, influenza B virus has caused
epidemics in humans, as have the H1 and H3 subtypes of influenza A
virus. Influenza B virus is isolated only from humans and is
characterized by a low rate of antigenic change and cocirculation of
antigenic variants; recently, reassortment and insertion-deletion have
been reported as strategies for its evolution (3, 7, 9, 11, 14,
16). Influenza B virus strains are divided into two large
phylogenetic trees: one is the group that B/Victoria/2/87 represents,
and the other is the group that B/Yamagata/16/88 represents (3, 7,
9). B/Victoria group strains were dominant in the 1980s, while
B/Yamagata group strains were dominant in the early 1990s. However,
B/Victoria group strains reemerged in South China in 1994, and since
then, strains of both groups have been isolated in the same season
(10, 11). They are antigenically distinct, and the
differences in human immune response have been discussed (5,
6). Actually, B/Victoria group strains were not detected in the
conventional hemagglutination inhibition (HI) test with ferret serum
for B/Yamagata group strains. Therefore, we established a rapid
detection system by using specific monoclonal antibodies (MAbs) in
peroxidase-antiperoxidase (PAP) staining (10, 12, 15) and
analyzed 100 strains of the 1996-1997 influenza season. When the
anti-nucleoprotein (NP) or anti-matrix protein (M) MAbs were used,
strains of both groups were detected equally well, and when
anti-hemagglutinin (HA) MAbs 10B8 and 9E10 were used, strains were
clearly distinguishable. Another anti-HA MAb, 8E6, detected only
two-thirds of the B/Victoria group strains. Therefore, it was suggested
that the strains, isolated from clinical specimens in one season, were
actually a mixture of distinct antigenicities (10).
In this study, we used 8E6 in PAP staining, HI tests, and
neutralization (NT) tests (12), and we analyzed the
heterogeneous antigenicities of B/Victoria group strains isolated in
the 1996-1997 influenza season. The results of nucleotide sequencing
revealed that point mutations correspond to the variation in
antigenicity. A total of 100 influenza B virus strains isolated in
Osaka Prefecture were analyzed. Influenza B virus isolates
B/Nagasaki/1/87, representative of the B/Victoria group strains of the
1980s, B/Guandong/5/94, representative of the B/Victoria group strains
that reemerged in the 1990s, and B/Mie/1/93, representative of the
B/Yamagata group strains, were utilized. RNA was obtained from
virus-infected Madin-Darby canine kidney (MDCK) cells, and reverse
transcription (RT)-PCR and direct sequencing were performed with
primers 3'CTACTCATGGTAGTAACATCC (positions 52 to 72) and
5'TGGGAAGCCACCAATCTGAGAAAC (positions 774 to 751) for the
former half of the HA1 gene and with primers 3'ACCTCAGGATCTTGCCCTAACG (positions 493 to 514) and
5'TGTGTATCCGTGCCAACCTGCAAT (positions 1194 to 1171) for the
latter half.
Table 1 shows the results of PAP staining
and NT tests of 100 influenza B virus strains isolated in the
1996-1997 season along with those of the 3 representative strains.
B/Nagasaki/1/87 reacted to 8E6 and 10B8 in PAP staining and NT tests,
while B/Guandong/5/94 reacted to 10B8 but not to 8E6. In PAP staining,
all 73 B/Victoria group strains, which had been identified in a
conventional HI test, were detected with 10B8, while 51 of 73 strains
were detected by 8E6. When the 73 B/Victoria group strains were
screened in the NT test with 8E6 and 10B8 at 5 × 10
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
Heterogeneity of Influenza B Virus Strains in One
Epidemic Season Differentiated by Monoclonal Antibodies and
Nucleotide Sequences
ABSTRACT
Top
Abstract
Text
References
TEXT
Top
Abstract
Text
References
3 dilutions of murine ascites, all were neutralized by
10B8 while 33 of 51 strains were neutralized by 8E6. Consequently, the
73 B/Victoria group strains were divided into 3 groups. Group 1 comprises B/Guandong-type strains, which are neither stained nor
neutralized with 8E6. Group 3 is made up of B/Nagasaki-type strains,
which are stained and neutralized with 8E6. Group 2 is the intermediate group of strains, which are stained but not neutralized with 8E6. Table
2 shows the results of PAP staining, the
HI test, the NT test, nucleotide sequencing of the HA1 region, and
sequencing of deduced amino acid residues for nine representative
strains from the three groups. Differences in the nucleotide sequence were observed only between positions 589 and 596, which correspond to
amino acid residue 197 or 199. Amino acid substitutions at these
residues have been observed in strains isolated from clinical specimens
and laboratory-induced antigenic variants, suggesting that these
residues play important roles in the determination of antigenicity
(1, 7). Lindstrom et al. reported that these residues are
Asn and Ile or Asn and Thr in the strains isolated in 1993 and 1994 after the reemergence of the B/Victoria group, Asn and Asn in the
strain isolated in 1996-1997, and Asn and Ala in the strain isolated
in 1997-1998 (7). Therefore, it is suspected that group 1 strains existed at the beginning of the 1996-1997 season, while group
2 and group 3 strains appeared later. The collection date of each
isolate confirms this notion (Table 2). It has been reported for
antigenic variants selected by MAbs and polyclonal antibodies that
single amino acid substitutions are sufficient to alter the
antigenicity of the HA molecule of influenza virus (1, 2, 4, 8,
13). Our report suggests that neutralizing antibodies induce the
virus to create antigenic variants for survival during the epidemic
season. When MAbs which neutralize B/Guandong/5/94 but not
B/Nagasaki/1/87 are obtained, this will be clearly demonstrated.
TABLE 1.
Results of PAP staining and NT tests of influenza B virus
strains isolated in the 1996-1997 season
TABLE 2.
Summary of the PAP staining, HI test, NT test, and
nucleic acid and amino acid sequencing results for B/Victoria group
strains isolated in the 1996-1997 season
B/Yamagata group strains did not react to 8E6 or to 10B8 (Table 1); therefore, we established six MAbs which specifically recognize the HA protein of B/Mie/1/93. All the B/Yamagata group strains were stained with the six MAbs in PAP staining. Two MAbs showed NT activities against 27 strains to the same degree as against B/Mie/1/93 (data not shown). The nucleotide sequencing of the HA1 region of four representative strains showed that 2 of 353 amino acid residues of HA protein were different; however, this did not affect the antigenicities against MAbs. Consequently, in contrast to B/Victoria group strains, B/Yamagata group strains isolated in the 1996-1997 epidemic season were homogeneous, at least as analyzed with the MAbs.
Our results support the idea that single amino acid substitutions are sufficient to alter the antigenicity of the HA molecule of influenza virus and clearly demonstrate that the influenza B virus B/Victoria group strains isolated in one epidemic season were heterogeneous.
Nucleotide sequence accession numbers. DDBJ accession numbers were assigned to influenza B virus strains isolated in the 1996-1997 season as follows: AB029618 for B/Osaka/1058/97, AB029619 for B/Osaka/1059/97, AB033826 for B/Osaka/1169/97, and AB029622 for B/Osaka/711/97.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the Ministry of Education, Science and Culture of Japan (10670376).
We thank Tetsuo Kase (Osaka Prefectural Institute of Public Health) for the 1996-1997 influenza B virus strains, and Yumiko Yamamoto for excellent technical assistance.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Division of Bacteriology, Department of Public Health, Osaka Prefectural Institute of Public Health, 3-69, 1-Chome, Nakamichi, Higashinari-ku, Osaka, 537-0025, Japan. Phone: 81-6-6972-1321. Fax: 81-6-6972-0772. E-mail: nakagawa{at}iph.pref.osaka.jp.
| |
REFERENCES |
|---|
|
Top
Abstract
Text
References
|
|---|
| 1. |
Berton, M. T.,
C. W. Naeve, and R. G. Webster.
1984.
Antigenic structure of the influenza B virus hemagglutinin: nucleotide sequence analysis of antigenic variants selected with monoclonal antibodies.
J. Virol.
52:919-927 |
| 2. | Cleveland, S. M., H. P. Taylor, and N. J. Dimmock. 1997. Selection of neutralizing antibody escape mutants with type A influenza virus HA-specific polyclonal antisera: possible significance for antigenic drift. Epidemiol. Infect. 118:149-154[CrossRef][Medline]. |
| 3. |
Kanegae, Y.,
S. Sugita,
A. Endo,
M. Ishida,
S. Senya,
K. Osako,
K. Nerome, and A. Oya.
1990.
Evolutionary pattern of the hemagglutinin gene of influenza B viruses isolated in Japan: cocirculating lineages in the same epidemic season.
J. Virol.
64:2860-2865 |
| 4. |
Lambkin, R.,
L. McLain,
S. E. Jones,
S. L. Aldridge, and N. J. Dimmock.
1994.
Neutralization escape mutants of type A influenza virus are readily selected by antisera from mice immunized with whole virus: a possible mechanism for antigenic drift.
J. Gen. Virol.
75:3493-3502 |
| 5. |
Levandowski, R. A.,
P. A. Gross,
M. Weksler,
E. Staton,
M. S. Williams, and J. Bonelli.
1991.
Cross-reactive antibodies induced by a monovalent influenza B virus vaccine.
J. Clin. Microbiol.
29:1530-1532 |
| 6. |
Levandowski, R. A.,
H. L. Regnery,
E. Staton,
B. G. Burgess,
M. S. Williams, and J. R. Groothuis.
1991.
Antibody responses to influenza B viruses in immunologically unprimed children.
Pediatrics
88:1031-1036 |
| 7. |
Lindstrom, S. E.,
Y. Hiromoto,
H. Nishimura,
T. Saito,
R. Nerome, and K. Nerome.
1999.
Comparative analysis of evolutionary mechanisms of the hemagglutinin and three internal protein genes of influenza B virus: multiple cocirculating lineages and frequent reassortment of the NP, M, and NS genes.
J. Virol.
73:4413-4426 |
| 8. |
Luoh, S.-M.,
M. W. McGregor, and V. S. Hinshaw.
1992.
Hemagglutinin mutations related to antigenic variation in H1 swine influenza viruses.
J. Virol.
66:1066-1073 |
| 9. |
McCullers, J. A.,
G. C. Wang,
S. He, and R. Webster.
1999.
Reassortment and insertion-deletion are strategies for the evolution of influenza B viruses in nature.
J. Virol.
73:7343-7348 |
| 10. | Nakagawa, N., A. Maeda, T. Kase, R. Kubota, and Y. Okuno. 1999. Rapid detection and identification of two lineages of influenza B strains with monoclonal antibodies. J. Virol. Methods 79:113-120[CrossRef][Medline]. |
| 11. | Nerome, R., Y. Hiromoto, S. Sugita, N. Tanabe, M. Ishida, M. Matsumoto, S. E. Lindstrom, T. Takahashi, and K. Nerome. 1998. Evolutionary characteristics of influenza B virus since its first isolation in 1940: dynamic circulation of deletion and insertion mechanism. Arch. Virol. 143:1569-1583[CrossRef][Medline]. |
| 12. |
Okuno, Y.,
K. Tanaka,
K. Baba,
A. Maeda,
N. Kunita, and S. Ueda.
1990.
Rapid focus reduction neutralization test of influenza A and B viruses in microtiter system.
J. Clin. Microbiol.
28:1308-1313 |
| 13. |
Okuno, Y.,
Y. Isegawa,
F. Sasao, and S. Ueda.
1993.
A common neutralizing epitope conserved between the hemagglutinins of influenza A virus H1 and H2 strains.
J. Virol.
67:2552-2558 |
| 14. | Rota, P., T. R. Wallis, M. W. Harmon, J. S. Rota, A. P. Kendal, and K. Nerome. 1990. Cocirculation of two distinct evolutionary lineages of influenza type B virus since 1983. Virology 175:59-68[CrossRef][Medline]. |
| 15. |
Ueda, M.,
A. Maeda,
N. Nakagawa,
T. Kase,
R. Kubota,
H. Takakura,
A. Ohshima, and Y. Okuno.
1998.
Application of subtype-specific monoclonal antibodies for rapid detection and identification of influenza A and B viruses.
J. Clin. Microbiol.
36:340-344 |
| 16. | Yamashita, M., M. Krystal, W. M. Fitch, and P. Palese. 1988. Influenza B virus evolution: co-circulating lineages and comparison of evolutionary pattern with those of influenza A and C viruses. Virology 163:112-122[CrossRef][Medline]. |
Journal of Clinical Microbiology, September 2000, p. 3467-3469, Vol. 38, No. 9
0095-1137/00/$04.00+0
Copyright © 2000, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Nakagawa, N., Higashi, N., Nakagawa, T.
(2009). Cocirculation of Antigenic Variants and the Vaccine-Type Virus during the 2004-2005 Influenza B Virus Epidemics in Japan. J. Clin. Microbiol.
47: 352-357
[Abstract] [Full Text] -
Wang, Q., Cheng, F., Lu, M., Tian, X., Ma, J.
(2008). Crystal Structure of Unliganded Influenza B Virus Hemagglutinin. J. Virol.
82: 3011-3020
[Abstract] [Full Text] -
Wang, Q., Tian, X., Chen, X., Ma, J.
(2007). Structural basis for receptor specificity of influenza B virus hemagglutinin. Proc. Natl. Acad. Sci. USA
104: 16874-16879
[Abstract] [Full Text] -
Nakagawa, N., Suzuoki, J., Kubota, R., Kobatake, S., Okuno, Y.
(2006). Discovery of the Neutralizing Epitope Common to Influenza B Virus Victoria Group Isolates in Japan. J. Clin. Microbiol.
44: 1564-1566
[Abstract] [Full Text] -
Nakagawa, N., Kubota, R., Okuno, Y.
(2005). Variation of the Conserved Neutralizing Epitope in Influenza B Virus Victoria Group Isolates in Japan. J. Clin. Microbiol.
43: 4212-4214
[Abstract] [Full Text] -
Nakagawa, N., Kubota, R., Maeda, A., Okuno, Y.
(2004). Influenza B Virus Victoria Group with a New Glycosylation Site Was Epidemic in Japan in the 2002-2003 Season. J. Clin. Microbiol.
42: 3295-3297
[Abstract] [Full Text] -
Chi, X. S., Bolar, T. V., Zhao, P., Rappaport, R., Cheng, S.-M.
(2003). Cocirculation and Evolution of Two Lineages of Influenza B Viruses in Europe and Israel in the 2001-2002 Season. J. Clin. Microbiol.
41: 5770-5773
[Abstract] [Full Text] -
Nakagawa, N., Kubota, R., Nakagawa, T., Okuno, Y.
(2003). Neutralizing epitopes specific for influenza B virus Yamagata group strains are in the 'loop'. J. Gen. Virol.
84: 769-773
[Abstract] [Full Text] -
Nakagawa, N., Nukuzuma, S., Haratome, S., Go, S., Nakagawa, T., Hayashi, K.
(2002). Emergence of an Influenza B Virus with Antigenic Change. J. Clin. Microbiol.
40: 3068-3070
[Abstract] [Full Text] -
Nakagawa, N., Kubota, R., Nakagawa, T., Okuno, Y.
(2001). Antigenic variants with amino acid deletions clarify a neutralizing epitope specific for influenza B virus Victoria group strains. J. Gen. Virol.
82: 2169-2172
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»