Previous Article | Next Article 
Journal of Clinical Microbiology, January 2001, p. 101-106, Vol. 39, No. 1
Department of Dermatology, Juntendo
University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113, Japan
Received 14 April 2000/Returned for modification 31 May
2000/Accepted 17 October 2000
An internal partial sequence of the gene encoding actin
(ACT), 725 to 762 bp in length, was amplified by PCR from
the genomic DNA extract of 12 species of dermatophytes and sequenced.
An intron that is 56 to 93 bp in length was located along the
ACT fragment of all of the dermatophytes at codon position
301 ( Dermatophytes, a group of pathogenic
fungi found in the genera Trichophyton,
Microsporum, and Epidermophyton, belong to the family Arthrodermataceae of the ascomycetous order
Onygenales. These fungi invade keratinized human and animal
tissues, causing dermatophytosis, a superficial infection of worldwide
distribution that accounts for the majority of superficial fungal infections.
Dermatophytosis is tentatively diagnosed by microscopic observation of
septate and hyaline hyphal elements in KOH-digested skin scales.
Culture isolates of dermatophytes are routinely identified by
examination of colonial and microscopic morphology as well as several
physiological properties. However, these procedures are usually
time-consuming, and difficulties in accurate identification are
sometimes encountered due to phenotypic variations among strains, thus
prompting the quest for molecular diagnostic methods based on the
relatively stable genotype (19). Some of the genes
targeted in the molecular identification of dermatophytes include the
internal transcribed spacers (ITS1 and ITS2) of the ribosomal DNA
(rDNA) (6, 7, 8, 14, 20), the chitin synthase 1 gene
(9), and the 18S rDNA (2, 10).
While diagnostic methods based on genotype provide a comparatively
accurate means of identifying a pathogenic organism, the amplification
of target DNA by PCR alone does not indicate the viability of the
source organism, information that is of obvious importance in
evaluating the efficacy of a particular therapy. On the other hand,
transcription activity indicates cellular function, and the
amplification of the mRNA of a particular gene by reverse transcription-PCR (RT-PCR) may be an effective molecular indicator of
cell viability. Actin, a cytoskeletal protein, participates in many
vital cellular functions (17, 18), and this makes the
detection of transcription activity of the encoding gene
(ACT) a potential indicator of cellular function in the
molecular assessment of fungal viability.
In this study, an intron-containing internal fragment of dermatophyte
ACT was isolated by PCR, and the sequences were analyzed. The presence of dermatophyte ACT mRNA in total RNA extract
from skin scales was investigated as an indicator of the presence of viable dermatophyte cells in skin scales.
Fungal isolates.
The isolates of dermatophytes included
Microsporum audouinii (IFM 5294), Microsporum
canis (IFM 47138 and 5 clinical isolates), Microsporum
cookei (IFM 40904), Microsporum fulvum (IFM 5318), Microsporum gypseum (IFM 41063 and 3 clinical isolates),
Microsporum nanum (CBS 728.88), Epidermophyton
floccosum (ATCC 50266 and 2 clinical isolates), Trichophyton
mentagrophytes (IFM 45795 and 30 clinical isolates),
Trichophyton tonsurans (ATCC 44690 and 4 clinical isolates),
Trichophyton rubrum (IFM 47168 and 33 clinical isolates),
Trichophyton verrucosum (IFM 5278), and Trichophyton violaceum (IFM 41075). The fungal isolates with IFM accession numbers were obtained from the culture collection of the Research Center for Pathogenic Fungi and Microbial Toxicoses, Chiba University, Chiba, Japan; CBS isolates were from the Centraalbureau voor
Schimmelcultures, Baarns, The Netherlands; and ATCC isolates were from
the American Type Culture Collection, Bethesda, Md. The dermatophytes
were grown on Sabouraud agar (1% [wt/vol] peptone, 1% [wt/vol]
glucose, 1.5% [wt/vol] agarose) at 28°C for 7 days.
Extraction of genomic DNA and total RNA from dermatophyte
cultures.
Nucleic acids were isolated from cultures of
dermatophytes according to the guanidinium isothiocyanate method
(1) using Isogen (Wako Junyaku Kogyo, Osaka, Japan).
Briefly described, 30 mg of mycelial fragments was placed in 1 ml of
Isogen contained in a 1.5-ml Eppendorf tube and was ground with a
plastic pestle. Total RNA was then separated from genomic DNA according
to the manufacturer's instructions.
PCR and RT-PCR isolation of the dermatophyte actin gene
(ACT) fragment.
Since there are no reports on the
nucleotide sequence of the gene encoding dermatophyte actin, the
primers 5'-CGAACCGTGAGAAGATGACC-3' (sense, bp 314 through
413) and 5'-GAACCACCGATCCAGACGGAGTA-3' (antisense, bp 1,124 through 1,143), used for the PCR of dermatophytic ACT, were
designed from the ACT of Ajellomyces capsulatus
(Histoplasma capsulatum) (GenBank accession no. U17498).
These primers were designed from regions of relatively high sequence
homology in an alignment of the ACTs of A. capsulatus, Candida albicans (GenBank accession no.
X16377), Emericella (Aspergillus)
nidulans (M 22869), and Humicola grisea var.
thermoidea (AB 003111). The nucleotide coordinates of
primers used in this study were numbered in the 5' to 3' direction with
reference to the coding sequence of the human
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.1.101-106.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Isolation of an Intron-Containing Partial Sequence
of the Gene Encoding Dermatophyte Actin (ACT) and Detection
of a Fragment of the Transcript by Reverse Transcription-Nested PCR as
a Means of Assessing the Viability of Dermatophytes in Skin
Scales
ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
3) (a codon number followed by "3" indicates that the
intron directly follows the codon) with reference to the amino acid
sequence of human 
-smooth muscle actin. A primer pair that annealed
to exon sequences flanking the ACT-associated intron
produced a dermatophyte-specific 171-bp amplicon by reverse
transcription-nested PCR (RT-PCR) of dermatophyte ACT mRNA.
PCR primer pairs with antisense sequence based on the ACT
intron sequence were species specific for dermatophytes, suggesting a
potential for use in the identification of dermatophytes. The viability
of dermatophytes in skin scales was subsequently assessed by the
presence of ACT mRNA in total RNA extracted from a 48-h
culture of scale samples in 250 µl of yeast carbon base broth.
RT-nested PCR of dermatophyte-infected samples amplified an
ACT fragment of the predicted size of 171 bp. The results
of viability testing based on ACT mRNA detection by
RT-nested PCR correlated with cultural isolation from skin scales. This
method is a potential tool for rapidly assessing fungal viability in the therapeutic efficacy testing of antimycotics.
INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
-smooth muscle actin
(GenBank accession no. NM001613).
-smooth muscle. A BLAST search of the microbial genome databases of GenBank was then
conducted with the designed primers.
Specificity of primers by RT-nested PCR.
The specificity of
ACT exon-based primers employed in the viability assessment
was tested by reverse transcription (RT)-3' rapid amplification of cDNA
ends-nested PCR (RT-3'RACE-nested PCR) (16) of total RNA
extracted from human keratinocytes and cultures of the following
organisms: C. albicans serotype A (JUH 3181), Candida
tropicalis (ATCC 750), Candida krusei (clinical isolate), Aspergillus fumigatus (ATCC 26430),
Aspergillus flavus (IFO 7540), Aspergillus niger
(IFO 31628), Aspergillus terreus (IFO 31675),
Crytococcus neoformans (TIMM 3173), Trichosporon beigelli (clinical isolate), Trichosporon mucoides
(clinical isolate), Sporothrix schenckii (clinical isolate),
Nocardia asteroides (clinical isolate), Staphylococcus
epidermidis (ATCC 14970), and Streptococcus sanguis
(ATCC 10556). Figure 1 shows a schematic
representation of RT-3'RACE-nested PCR.
|
Specificity of primers by PCR. The specificity of the oligonulceotide pair of DF (as described above) and an ACT intron-based antisense primer was tested by PCR of genomic DNA extract of human keratinocytes and cultures of the organisms described above. The antisense primers, whose complementary sequences are indicated in Fig. 3, were GATGCCGTAAAAGAGGAAAAGGAGACAG (E. floccosum), CATCAGTTAGTTAGTATTATTGCTAGCG (M. audouinii), GGCGAGGTGTTAGAAGGAAAAACGGTCC (M. canis), GTACGGTTATAGTATAAAGGAGGAGGAA (M. cookei), GGTCTTGTTATAGCATATAACCGTAGAA (M. fulvum), GGCTGTAGAAAGGAAAAAATGAGAAAGG (M. gypseum), GGTCTGTTATATATGGTTCACTAGCGTA (M. nanum), GTATATATACTTTAGAAGGAGAAGATAG (T. mentagrophytes and T. tonsurans), and CTATATAGTTTGTTACTGCAGAGGGAC (T. rubrum, T. verrucosum, and T. violaceum). The PCR conditions were as described above with an annealing temperature of 62°C.
ACT mRNA-dependent assessment of viability of dermatophytes in skin scales. Twenty-five samples of scales, 25 to 30 mg each, were collected from hyperkeratotic human soles. Less than 10 mg of the skin scale sample was suspended in 250 µl of yeast carbon base (YCB) broth (11.7 g/liter; Difco Laboratories, Detroit, Mich.) in a 1.5-ml screw-cap Eppendorf tube. The medium contained 12.5 µg of oxacillin per ml (Sigma Chemical Co., St. Louis, Mo.) and 50 µg of chloramphenicol per ml (Wako Pure Chemicals Industries Ltd., Osaka, Japan) and was sterilized by filtration through a 0.2-µm-pore-size polysulfone membrane (Kurabo, Osaka, Japan).
The culture was incubated for 48 h at 28°C and then centrifuged for 5 min at 5,000 × g and 4°C. The precipitate was washed once in 1 ml of buffer (10 mM Tris-HCl [pH 7.8]-1 mM CaCl2 · 2H2O-0.2% sodium dodecyl sulfate) and suspended in 500 µl of the same buffer incorporating 20 U of RNase inhibitor (Takara Shuzo) and 500 µg of proteinase K (Sigma). The mixture was incubated at 37°C for 30 min and then centrifuged for 3 min at 3,000 × g at 4°C. The precipitate was washed once in 1 ml of buffer containing 10 mM Tris-HCl (pH 7.8) and 2 mM EGTA and then suspended in 1 ml of Isogen (Wako Junyako Kogyo). The precipitate was homogenized by grinding with a pestle and by several passages through a 23-gauge needle. Total RNA and genomic DNA were then extracted as described above. A 10- to 15-mg portion of the skin scale sample, without prior cultivation in yeast carbon base, was also processed for the extraction of total RNA and genomic DNA. The total RNA extract was tested by RT-3'RACE-nested PCR, and the amplification of the expected size of dermatophyte ACT mRNA was used as an indicator of dermatophyte viability. The 18S-rDNA-based universal fungal PCR primer pair, CGAATCGCATGGCCTTG/TTCTCAGGCTCCCTCTCC (UF1/EU1), was used in the internal positive control for each sample (10). The RT-3'RACE-nested PCR condition was as described above. The annealing temperature for the internal positive control PCR was 52°C. The genomic DNA was screened by PCR using DF and a specific ACT intron-based antisense primer for the detection of T. rubrum or T. mentagrophytes. The remaining portion of the scale sample was inoculated on Sabouraud agar and incubated at 28°C.Nucleotide sequence accession numbers. The nucleotide sequence data of the ACT fragment have been deposited in the GenBank nucleotide sequence database with the following accession numbers: AF150736 (M. audouinii), AF150737 (M. canis), AF150738 (M. cookei), AF150739 (M. fulvum), AF152228 (M. gypseum), AF152235 (M. nanum), AF152234 (E. floccosum), AF152229 (T. mentagrophytes), AF152231 (T. tonsurans), AF152230 (T. rubrum), AF152232 (T. verrucosum), and AF152233 (T. violaceum).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
Amplification and sequence analyses of an internal partial fragment
of dermatophytic ACT.
The PCR primers, which were
based on the ACT of A. capsulatus, amplified a
725- to 762-bp internal partial sequence of the actin gene of 12 species of dermatophytes. The sequences had 85 to 90% nucleotide
sequence homology to eukaryotic actin genes as determined by a BLASTN
sequence homology search of the gene bank databases. A partial length
of ACT cDNA (669 bp) was amplified by RT-PCR using the same
primers as for the PCR, from the total RNA of the 12 species of
dermatophytes. The sequences of the ACT exon fragment and
the associated intron were species specific. An alignment of the
partial ACT exon showed a high degree of sequence conservation among the dermatophytes, with a few species-specific nucleotide substitutions. Figure 2 shows
an alignment of the ACT exon fragments of E. floccosum, M. canis, and T. rubrum and the homologous region of the human -smooth muscle actin.
|
Characterization of the ACT intron sequence.
A
comparative analysis of nucleotide sequences of the PCR and RT-PCR
products showed a single intron located along the ACT fragment. An analysis of the deduced amino acid sequence of the partial-length ACT exon placed the ACT intron at
codon position 301 (3) with reference to the coding sequence of the
human -2 smooth muscle actin gene (GenBank NM001613) (a codon number
followed by 3 indicates that the intron directly follows the codon).
Figure 3 shows an alignment of the
ACT intron sequences (56 to 93 bp) of different species of
dermatophytes. There were no variations in intron sequences among
strains of the same species of dermatophyte. The sequences of the
ACT introns of T. mentagrophytes and T. tonsurans were identical; so also were those of T. rubrum, T. verrucosum, and T. violaceum. The
introns showed the consensus sequences GTATG and TAG at their 5'- and
3'-splice-site junctions, respectively. The internal splice signal
consensus sequence CTAAC was located variously at 8 to 12 bp upstream
from the 3'-splice-site junctions of the ACT introns of
different dermatophytes. No open reading frame consistent with
endonuclease coding was identified in any of the introns, and no
simulation of known secondary structures was found.
|
Primer specificity.
An ACT cDNA product of the
expected size, 171 bp, was amplified by RT-3'RACE-nested PCR from the
total RNA extract of 89 isolates of 12 dermatophyte species (Fig.
4A). No cross-amplification occurred with
the human DNA or any of the reference organisms.
|
Molecular assessment of the viability of dermatophytes in skin
scales.
Table 1 shows the results of
the evaluation of dermatophytic viability in skin scales based on the
detection of dermatophyte ACT mRNA by RT-3'RACE-nested PCR.
A 171-bp ACT cDNA amplicon was produced by RT-3'RACE-nested
PCR of total RNA extracted from a portion of each of the 20 samples,
which were incubated for 48 h in YCB broth; five were negative for
dermatophytic mRNA. RT-3'RACE-nested PCR of total RNA, which was
extracted directly from sample portions without prior culturing in YCB,
produced the 171-bp amplicon from only 7 samples; 18 samples were
negative. The internal-control PCR produced a 138-bp fungus-specific
DNA amplicon from the genomic DNA extract of the 20 dermatophyte
samples that were ACT mRNA positive and the 5 negative
samples. PCR of genomic DNA extract using T. rubrum- and
T. mentagrophytes-specific primers produced 581- and 571-bp
fragments from 18 and 2 samples, respectively. Corresponding cultures
of the samples in Sabouraud agar yielded isolates of T. rubrum and T. mentagrophytes. Yeastlike isolates were
recovered from three samples while two showed no fungal growth.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
A DNA fragment, identified as an internal partial length of the gene encoding the actin protein, was amplified by PCR from the genomic DNA extracts of 12 species of dermatophytes and then sequenced. Since there was no prior report on the dermatophytic ACT sequence, the primary isolation primers were designed to anneal on the ACT sequence of A. capsulatus, a member of the monophyletic order Onygenales, from whose ancestor the family of dermatophytic fungi also evolved (13).
An important feature of the isolated fragment of dermatophyte
ACT is the associated intron. Studies on the insertion sites of the intron in the ACTs of various eukaryotes indicate
that the location site, codon 301 (3), is found in the actin genes of
fungal species but not in any other eukaryotic species
(21). The dermatophytic ACT introns lacked an
internal open reading frame encoding a functional endonuclease, thus
indicating the immobility of the intron (4, 12, 15).
An analysis of the dermatophyte ACT intron showed the presence of a short internal consensus sequence, the CTAAC box, which is an essential splicing signal sequence (11). The efficient in vitro excision of the intron by RNA splicing facilitated the differentiation of the RT-PCR product from amplicons that might have originated from the genomic ACT. The presence of the ACT-associated intron in all of the isolates of dermatophytes indicates the wide if not universal distribution of the intron among the dermatophytes. The differences in nucleotide sequences of the ACT-associated introns of different species of dermatophytes was exploited in the design of species-specific PCR primers. The Microsporum species were specifically distinguished by PCR, as was E. floccosum. T. rubrum was differentiated from T. mentagrophytes, although the former cross-reacted with T. verrucosum and T. violaceum and the latter with T. tonsurans. The complete sequence identities of the ACT-associated introns among these two Trichophyton groups probably reflect their close phylogenetic relationships (5, 7, 14). Thus, the ACT is less suited than the ITS regions of the DNA as a PCR target for the specific identification of dermatophytes; the latter have been used to differentiate several species of the three dermatophyte genera (6, 7, 8, 14, 20). The highly conserved ACT fragment was, however, suitable for the design of dermatophyte group-specific primer systems.
Actin-mediated cellular functions such as cytokinesis, exo- or endocytosis, chromosome segregation, organelle transportation, and cell shape change are all useful indicators of cell growth (17, 18). Thus, an actively transcribing actin gene indicates a need for the actin protein by a growing cell. On this basis, we indexed the specific detection of dermatophyte ACT mRNA in the total RNA extract of skin scales, by RT-3'RACE-nested PCR, to the presence of viable dermatophyte cells in tissue. RT-3'RACE-nested PCR is highly sensitive, and an earlier study showed that amplicons from 50 fg of total RNA of fungi were visualized following electrophoresis on an agarose gel (16).
In this study, the detection of dermatophyte ACT mRNA in
total RNA extracts of scale samples corresponded with cultural
isolation from samples. However, the positive rate of ACT
mRNA was higher in the cultured samples of skin scales than the
noncultured ones since the 48-h incubation in YCB served to increase
the amount of fungal ACT mRNA available for transcription,
amplification, and subsequent detection in an agarose gel. In our
experience, the positive rate of detection of dermatophyte
ACT mRNA in noncultured skin scales depended on the
intensity of infection and amount of sample available for total RNA
extraction (usually 
20 mg of scale). In such cases, positive results
were achieved within 8 h. Further improvement in the extraction
efficiency of total RNA is needed to enhance the detection of
dermatophyte ACT mRNA in total RNA directly extracted from
minimal amounts of noncultured scales, thus eliminating the need to
culture samples.
The advantages of ACT mRNA-based assessment of dermatophytic viability in dermatophyte-infected skin samples over the conventional culture methods include the achievement of results within a relatively shorter period, thus preventing unnecessary prolongation of therapy, and the elimination of problems of culture contamination and failure. The major disadvantages include dependency of results on efficiency of nucleic acid extraction and the possible degradation of mRNA leading to a false-negative result. The detection of dermatophyte ACT mRNA in skin scales as a means of evaluating fungal viability may have potential as a tool for the rapid assessment of the therapeutic efficacy of antimycotic agents.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Dermatology, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113, Japan. Phone: 81-3-5802-1089. Fax: 81-3-3813-9443. E-mail: tsuboi{at}med.juntendo.ac.jp.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
|
|---|
| 1. |
Barkan, A.
1989.
Tissue-dependent plastid mRNA splicing in maize: transcripts from four plastid genes are predominantly unspliced in leaf meristems and roots.
Plant Cell
1:437-445 |
| 2. | Bock, M, P. Nickel, M. Maiwald, R. Kappe, and H. Naher. 1997. Diagnosis of dermatomycoses with polymerase chain reaction. Hautartzt 48:175-180[CrossRef][Medline]. |
| 3. | Borson, N. D. 1992. A lock-docking oligo (dT) primer for 5' and 3' RACE PCR. PCR Methods Appl. 2:144-148[Medline]. |
| 4. |
Dujon, B.
1989.
Group 1 introns as mobile genetic elements: facts and mechanistic speculations  a review.
Gene
82:91-114[CrossRef][Medline].
|
| 5. | Gräser, Y., M. El Fari, R. Vilgalys, A. F. A. Kuijpers, G. S. de Hoog, W. Presber, and H.-J. Tietz. 1999. Phylogeny and taxonomy of the family Arthrodermataceae (dermatophytes) using sequence analysis of the ribosomal ITS region. Med. Mycol. 37:105-114[CrossRef][Medline]. |
| 6. | Gräser, Y., M. El Fari, W. Presber, W. Sterry, and H.-J. Tietz. 1998. Identification of common dermatophytes using polymerase chain reactions. Br. J. Dermatol. 138:576-582[CrossRef][Medline]. |
| 7. | Harmsen, D., A. Schwinn, E.-B. Brocker, and M. Frosch. 1998. Molecular differentiation of dermatophytic fungi. Mycoses 42:67-70[CrossRef]. |
| 8. |
Jackson, C. J.,
R. C. Barton, and E. G. V. Evans.
1999.
Species identification and strain differentiation of dermatophyte fungi by analysis of ribosomal-DNA intergenic spacer regions.
J. Clin. Microbiol.
37:931-936 |
| 9. | Kano, R., Y. Nakamura, T. Watari, S. Watanabe, H. Takahashi, H. Tsujimoto, and A. Hasegawa. 1997. Phylogenetic analysis of 8 dermatophyte species using chitin synthase 1 gene sequences. Mycoses 40:411-414[Medline]. |
| 10. |
Kappe, R.,
C. N. Okeke,
C. Fauser,
M. Maiwald, and H.-G. Sonntag.
1998.
Molecular probes for the detection of pathogenic fungi in the presence of human tissue.
J. Med. Microbiol.
47:811-820 |
| 11. | Langford, C. J., F.-J. Klinz, C. Donath, and D. Gallwitz. 1984. Point mutations identify the conserved intron-contained TACTAAC box as an essential splicing signal sequence in yeast. Cell 36:645-653[CrossRef][Medline]. |
| 12. | Lasker, B. A., G. W. Smith, G. S. Kobayashi, A. N. Whitney, and L. W. Mayer. 1998. Characterization of a single group 1 intron in the 18S rRNA gene of the pathogenic fungus Histoplasma capsulatum. Med. Mycol. 36:205-212[CrossRef][Medline]. |
| 13. | Leclerc, M. C., H. Philippe, and E. Guého. 1994. Phylogeny of dermatophytes and dimorphic fungi based on large subunit ribosomal RNA sequence comparisons. J. Med. Vet. Mycol. 32:331-341[Medline]. |
| 14. |
Makimura, K.,
Y. Tamura,
T. Mochizuki,
A. Hasegawa,
Y. Tajiri,
R. Hanazawa,
K. Uchida,
H. Saito, and H. Yamaguchi.
1999.
Phylogenetic classification and species identification of dermatophyte strains based on DNA sequences of nuclear ribosomal internal transcribed spacer 1 regions.
J. Clin. Microbiol.
37:920-924 |
| 15. | Okeke, C. N., R. Kappe, S. Zakikhani, O. Nolte, and H.-G. Sonntag. 1998. Ribosomal genes of Histoplasma capsulatum var. duboisii and var. farciminosum. Mycoses 41:355-362[Medline]. |
| 16. | Okeke, C. N., R. Tsuboi, M. Kawai, M. Yamazaki, S. Reangchainam, and H. Ogawa. 2000. Reverse transcription-3' rapid amplification of cDNA ends-nested PCR of ACT1 and SAP2 as a means of detecting viable Candida albicans in an in vitro cutaneous candidiasis model. J. Investig. Dermatol. 114:95-100[CrossRef][Medline]. |
| 17. | Pollard, T., C. Selden, and P. Maupin. 1984. Interaction of actin filaments with microtubules. J. Cell Biol. 99:335-375. |
| 18. | Reisler, E. 1993. Actin molecular structures and functions. Curr. Opin. Cell Biol. 5:41-47[CrossRef][Medline]. |
| 19. | Reiss, E., K. Tanaka, G. Bruker, V. Chazalet, D. Coleman, J. P. Debeaupuis, R. Hanazawa, J. P. Latge, J. Lortholary, K. Makimura, C. J. Morrison, S. Y. Murayama, S. Naoe, S. Paris, J. Sarfati, K. Shibuya, D. Sullivan, K. Uchida, and H. Yamaguchi. 1998. Molecular diagnosis and epidemiology of fungal infections. Med. Mycol. 36:249-257. |
| 20. |
Turenne, C. Y.,
S. E. Sanche,
D. J. Hoban,
J. A. Karlowsky, and A. M. Kabani.
1999.
Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system.
J. Clin. Microbiol.
37:1846-1851 |
| 21. | Weber, K., and W. Kabsch. 1994. Intron positions in actin genes seem unrelated to the secondary structure of the protein. EMBO J. 13:1280-1286[Medline]. |
Journal of Clinical Microbiology, January 2001, p. 101-106, Vol. 39, No. 1
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.1.101-106.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gupta, A. K., Zaman, M., Singh, J.
(2008). Diagnosis of Trichophyton rubrum from Onychomycotic Nail Samples Using Polymerase Chain Reaction and Calcofluor White Microscopy. J. Am. Podiatr. Med. Assoc.
98: 224-228
[Abstract] [Full Text] -
Binstock, J. M.
(2007). Molecular Biology Techniques for Identifying Dermatophytes and Their Possible Use in Diagnosing Onychomycosis in Human Toenail: A Review. J. Am. Podiatr. Med. Assoc.
97: 134-144
[Abstract] [Full Text] -
Gao, J., Takashima, A.
(2004). Cloning and Characterization of Trichophyton rubrum Genes Encoding Actin, Tri r2, and Tri r4. J. Clin. Microbiol.
42: 3298-3299
[Abstract] [Full Text] -
Bleve, G., Rizzotti, L., Dellaglio, F., Torriani, S.
(2003). Development of Reverse Transcription (RT)-PCR and Real-Time RT-PCR Assays for Rapid Detection and Quantification of Viable Yeasts and Molds Contaminating Yogurts and Pasteurized Food Products. Appl. Environ. Microbiol.
69: 4116-4122
[Abstract] [Full Text] -
Brouta, F., Descamps, F., Monod, M., Vermout, S., Losson, B., Mignon, B.
(2002). Secreted Metalloprotease Gene Family of Microsporum canis. Infect. Immun.
70: 5676-5683
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»