Previous Article | Next Article 
Journal of Clinical Microbiology, January 2001, p. 196-200, Vol. 39, No. 1
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.1.196-200.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Simultaneous Detection of Influenza Viruses A and B
Using Real-Time Quantitative PCR
L. J. R.
van
Elden,*
M.
Nijhuis,
P.
Schipper,
R.
Schuurman, and
A. M.
van
Loon
Department of Virology, University Medical
Center Utrecht, Utrecht, The Netherlands
Received 13 July 2000/Returned for modification 21 August
2000/Accepted 11 November 2000
 |
ABSTRACT |
Since influenza viruses can cause severe illness, timely diagnosis
is important for an adequate intervention. The available rapid
detection methods either lack sensitivity or require complex laboratory
manipulation. This study describes a rapid, sensitive detection method
that can be easily applied to routine diagnosis. This method
simultaneously detects influenza viruses A and B in specimens of
patients with respiratory infections using a TaqMan-based real-time PCR
assay. Primers and probes were selected from highly conserved regions
of the matrix protein gene of influenza virus A and the hemagglutinin
gene segment of influenza virus B. The applicability of this
multiplex PCR was evaluated with 27 influenza virus A and 9 influenza
virus B reference strains and isolates. In addition, the specificity of
the assay was assessed using eight reference strains of other
respiratory viruses (parainfluenza viruses 1 to 3, respiratory
syncytial virus Long strain, rhinoviruses 1A and 14, and coronaviruses
OC43 and 229E) and 30 combined nose and throat swabs from asymptomatic
subjects. Electron microscopy-counted stocks of influenza viruses A and
B were used to develop a quantitative PCR format. Thirteen copies
of viral RNA were detected for influenza virus A, and 11 copies were
detected for influenza virus B, equaling 0.02 and 0.006 50% tissue
culture infective doses, respectively. The diagnostic efficacy of the
multiplex TaqMan-based PCR was determined by testing 98 clinical
samples. This real-time PCR technique was found to be more sensitive
than the combination of conventional viral culturing and shell vial culturing.
 |
INTRODUCTION |
Influenza virus infection is a
highly contagious respiratory disease that can spread easily and that
is responsible for considerable morbidity and mortality each year.
Elderly and compromised individuals are especially at risk of
developing severe illness and complications. Therefore, rapid diagnosis
is important not only for timely therapeutic intervention but also for
the identification of a beginning influenza outbreak. Recently
published results of clinical trials using new anti-influenza virus
compounds, the neuraminidase inhibitors, demonstrated that these drugs
are effective against influenza viruses A and B and are most effective
when administered early, when symptoms first emerge (6, 8,
12). With the development of such new treatment options, rapid
detection methods become even more desirable.
Virus isolation via cell culturing, shell vial culturing, antigen
detection, and serologic analysis are the methods currently used for
the laboratory diagnosis of influenza viruses. Each of these methods,
however, has its limitations. For example, although virus isolation via
cell culturing can be a robust and sensitive method for the detection
of limited numbers of viable virions, it is labor-intensive and depends
on optimal sample transport for sensitive virus isolation. Moreover,
since the concentrations of viable virus can decline rapidly after the
first few days of the infection, the virus can become undetectable by
culturing in the later course of the infection (7).
Finally, the results from cell culturing generally are obtained too
late for adequate intervention.
Alternative diagnostic techniques, such as viral antigen detection
(immunofluorescence and enzyme immunoassay techniques) and shell vial
culturing, on the other hand, provide results much more quickly but
generally are less sensitive than conventional cell culturing (4,
11, 15, 18, 20).
To overcome this lack of sensitivity and to obtain rapid diagnostic
results, PCR techniques have been developed for the specific detection
and subtyping of influenza viruses. They have proven to be very
sensitive and specific but, unfortunately, are often difficult to
implement in a routine diagnostic setting and still require
time-consuming sample handling and post-PCR analysis (1, 3,
5). Needless to say, better techniques are still needed.
Here, we describe a multiplex TaqMan-based real-time PCR assay for the
rapid and simultaneous detection of influenza viruses (influenza virus
A, influenza virus B, or both) in clinical specimens. We also compare
this real-time PCR assay to conventional culturing methods and to an
in-house nested PCR assay. The method can generate results within 4 to
5 h and does not require any post-PCR processing (9, 10,
14). Moreover, the assay can be used for direct virus
quantification and can be easily implemented in routine viral
diagnostic testing.
 |
MATERIALS AND METHODS |
Virus stocks.
Influenza virus A/Port Chalmers/1/73 (H3N2),
influenza virus B/Lee/40, and parainfluenza viruses 1 to 3 were
obtained from the American Type Culture Collection (Manassas, Va.).
Influenza virus A and B reference strains and isolates and reference
strains of rhinovirus 1A, rhinovirus 14, respiratory syncytial virus
(Long strain), coronavirus OC43, and coronavirus 229E were kindly
provided by the Laboratory for Virology, National Institute of Public
Health and the Environment (Bilthoven, The Netherlands).
Virus particle counts.
Purified human influenza virus A/PR/8
(H1N1) (virus particles were counted by electron microscopy [EM]) was
obtained from Advanced Biotechnologies Incorporated (ABI), Columbia,
Md. Influenza virus A/Texas/36/91 (H1N1), influenza virus A/Port
Chalmers/1/73 (H3N2), and influenza virus B/Lee/40 were propagated at
33°C on tertiary rhesus monkey kidney cells pretreated with Eagle
minimal essential medium (BioWhittaker) supplemented with streptomycin, penicillin, amphotericin B, and 0.01% trypsin. After the development of a cytopathic effect, cells and supernatant were harvested and frozen
at
70°C. The virus particle count of each stock was then determined
by quantitative EM.
Clinical specimens.
Combined nose and throat swab specimens
or nasal washes were obtained from individuals with upper or lower
respiratory tract symptoms. Some of these specimens were obtained at
regional general practices participating in a study to evaluate the
efficacy of influenza vaccination. The other clinical samples were
obtained from patients with respiratory illnesses at the University
Medical Center Utrecht in 1998 and 1999. Routine diagnostic logistics were used for sample transportation from the general practices to the
laboratory as well as for sample transportation from the outpatient
clinic to the laboratory. The samples that were sent by mail were left
at room temperature for a maximum of 24 h. The samples from the
outpatient clinic were sent to the laboratory within 2 h. All of
the samples were transported in 5 ml of virus transport medium. Nasal
wash specimens and swab specimens were vortexed for 10 s and
centrifuged at 2,000 × g for 15 min. One milliliter of
the supernatant was used directly for virus culturing. The remaining
material was stored at
70°C until RNA extraction.
Virus isolation and growth.
Confluent tertiary rhesus monkey
kidney cells were inoculated with 100 µl of each clinical sample.
After absorption for 1 h at room temperature, the inoculum was
removed and 5 ml of fresh Eagle minimal essential medium supplemented
with 0.02 M HEPES, 0.075% bicarbonate, 100 U each of penicillin and
streptomycin per ml, 25 U of nystatin (Gibco) per ml, 0.2 M glutamine
(SVM [Foundation for the Advancement of Public Health and Environment {Stichting Volksgezondheid en Milieu in Dutch}]) and 0.01%
trypsin (SVM) was added. The cultures were then incubated at 33°C on
roller drums and examined twice weekly for 10 days for a cytopathic
effect. Regular testing for hemadsorption was performed using a 0.25% guinea pig erythrocyte suspension. Positive cultures were identified by
immunofluorescence with commercial monoclonal antibodies (Dako Imagen)
for influenza viruses A and B and parainfluenza viruses 1 to 3. Further
subtyping of the strains was performed at the National Reference Center
for Influenza, Rotterdam, The Netherlands.
After 2 days of culturing, usually before a cytopathic effect was
noticed, rapid antigen testing was performed by immunofluorescence with
commercial monoclonal antibodies for influenza viruses A and B (shell
vial culturing). The supernatants of the clinical specimens were also
cultured on other tissue cell lines (R-HeLa cells and HEp-2c cells) for
the detection of other respiratory viruses.
Viral genomic RNA isolation and cDNA synthesis.
RNA
extraction was performed according to the method described by Boom et
al. (2). Briefly, 10 to 100 µl of respiratory specimen,
tissue culture supernatant, or EM-counted virus stock was mixed with
900 µl of lysis buffer and 50 µl of silica and incubated for 10 min
at room temperature in order to bind the nucleic acid to the silica
particles. Unbound material was removed by several washing steps. The
RNA was then eluted either in 100 µl of 40-ng/µl poly(A) RNA before
one-tube reverse transcription (RT)-PCR (13) or in 100 µl of RNase-free water before cDNA synthesis.
cDNA was synthesized by using MultiScribe reverse transcriptase and
random hexamers (both from PE Applied Biosystems). Each
50-µl
reaction mixture contained 10 µl of eluted RNA, 5 µl of
10× RT
buffer, 5.5 mM MgCl
2, 500 µM each deoxynucleoside
triphosphate,
2.5 µM random hexamer, and 0.4 U of RNase inhibitor per
µl (all
from PE Applied Biosystems). After incubation for 10 min at
25°C,
RT was carried out for 30 min at 48°C, followed by RT
inactivation
for 5 min at 95°C. The cDNA was stored at

70°C
before further
use.
Qualitative PCR.
A multiplex nested PCR was performed for
influenza viruses A and B. A one-tube RT-PCR was followed by a second
(nested) amplification. First-round amplification primers and nested
primers were selected from conserved regions of the gene for the matrix
protein of influenza virus A (first-round primer set: FLU-1, 5'
CAGAGACTTGAAGATGTCTTTGC 3', and FLU-2, 5'
GGCAAGTGCACCAGCAGAATAACT 3'; second-round primer set: FLU-3,
5' GACCRATCCTGTCACCTCTGACT 3', and FLU-4, 5'
ATTTCTTTGGCCCCATGGAATGT 3') and the hemagglutinin gene segment of
influenza virus B (FLUB-5, 5' GAATCTGCACTGGGATAACATC 3', and
FLUB-8, 5' TTTGTTCTGTCRATGCATTATAGG 3'; inner primer set:
FLUB-2, 5' TCTCATTTTGCAAATCTCAAAGG 3', and FLUB-3, 5'
TCRTGGAGTATTGAARCTTTTGC 3'). The RT-PCR and nested PCR conditions
that we applied were those described by Nijhuis et al.
(13); we used a PE 9600 Thermocycler (Perkin-Elmer). PCR
products were visualized on an ethidium bromide-stained agarose gel
using UV illumination. A 100-bp marker (5-µl) was used as a control
for fragment lengths.
Real-time quantitative PCR.
Primers and probes for influenza
viruses A and B were selected using Primer Express software (PE Applied
Biosystems) and were based on genomic regions highly conserved in
various subtypes and genotypes of influenza virus A (matrix protein
gene) and influenza virus B (hemagglutinin gene segment). The exact
primers and probes were chosen after a sequence comparison of 39 influenza virus A strains and 44 influenza virus B strains. Probes were
obtained without runs of identical nucleotides to avoid nonspecific
interactions, with no G's at the 5' end, and with a melting
temperature of 69°C (10°C above the melting temperature of the
primers to ensure full hybridization of the probes during primer
extension). Moreover, primers and probes were tested for possible
interactions to make sure that they could be used together in a
multiplex assay. The forward and reverse primers (INFA-1, INFA-2,
INFA-3, INFB-1, and INFB-2) and probes (INFAp1/3 and INFBp1/2) used are
shown in Table 1. For influenza virus A,
two forward primers with different nucleotides at base 4 at the 5' end
were selected to ensure that all strains of influenza virus A could be
detected. Both fluorogenic probes for influenza viruses A and B
consisted of oligonucleotides with the 5' reporter dye
6-carboxyfluorescein (FAM) and the 3' quencher dye
6-carboxytetramethylrhodamine (TAMRA). A 25-µl PCR was performed
using 5 µl of cDNA, 12.5 µl of TaqMan universal PCR master mix
containing ROX as a passive reference (PE Applied Biosystems), 900 nM
each influenza virus A primer, 300 nM each influenza virus B primer,
and 100 nM each probe. Amplification and detection were performed with
an ABI Prism 7700 sequence detection system under the following
conditions: 2 min at 50°C to require optimal AmpErase
uracil-N-glycosylase activity, 10 min at 95°C to activate
AmpliTaq Gold DNA polymerase, and 45 cycles of 15 s at 95°C and
1 min at 60°C.
During amplification, the ABI Prism sequence detector monitored
real-time PCR amplification by quantitatively analyzing fluorescence
emissions. The reporter dye (FAM) signal was measured against
the
internal reference dye (ROX) signal to normalize for non-PCR-related
fluorescence fluctuations occurring from well to well. The threshold
cycle represented the refraction cycle number at which a positive
amplification reaction was measured and was set at 10 times the
standard deviation of the mean baseline emission calculated for
PCR
cycles 3 to
15.
 |
RESULTS |
Sensitivity.
The sensitivity of the multiplex assay was
determined in two ways: (i) by a virus infectivity assay and (ii) by
counting the viral particles using EM. Influenza virus A/PR/8/34
(sucrose gradient purified) and influenza virus B/Lee/40 were first
counted by EM and subsequently titrated by serial dilution. The 50%
tissue culture infective doses (TCID50) for the two
strains, calculated by the Kärber formula, were 1.8 × 109 and 2.0 × 109/ml, respectively,
corresponding to 9 × 1011 and 3.3 × 1012 viral particles, respectively.
The 10-fold serially diluted concentrations of the two strains were
then amplified using the multiplex TaqMan assay. Eleven
viral particles
of influenza virus B/Lee/40 and 13 viral particles
of influenza virus
A/PR/8/34 could be detected by both the multiplex
TaqMan assay and the
separate TaqMan assays for influenza viruses
A and B (Fig.
1). This level of sensitivity correlated
with 0.02
TCID
50 of influenza virus A/PR/8/34 and 0.006 TCID
50 of influenza
virus B/Lee/40.

View larger version (68K):
[in this window]
[in a new window]
|
FIG. 1.
Standardization of influenza virus B in the multiplex
TaqMan assay. Serial dilutions were made using the EM-counted influenza
virus B/Lee/40 stock. A minimum of ±10 copies of RNA could be detected
after 40 cycles. The intensity of fluorescence is given on the
y axis ( Rn = reporter signal [FAM]/passive reference
signal [ROX]).
|
|
Specificity.
The specificity of the multiplex TaqMan PCR
was assessed by testing reference strains of subtypes of
influenza virus A H1N1 (A/Singapore/6/86, A/Taiwan/1/86,
A/Texas/36/91, A/Bayern/7/95, A/PR/8/34, and NIB-39rec
Bayern), H2N2 (A/Singapore/1/57, A/Japan/307/57, and
A/England/1/66), and H3N2 (A/Hongkong/1/68, A/Philadelphia/2/82, A/Shangdong/9/93, A/RESVIR, A/Sydney/5/97, and A/Port
Chalmers/1/73); influenza virus B (B/Yamagata/16/88, B/Lee/40,
B/Panama/45/90, and B/Singapore/222/79); and a variety of other
respiratory viruses (rhinovirus 1A, rhinovirus 14, respiratory
syncytial virus [Long strain], coronaviruses OC43 and 229E, and
parainfluenza viruses 1 to 3). Five H1N1, seven H3N2, and five
influenza virus B isolates from patients were also tested. All of the
influenza virus strains but none of the other respiratory viruses were
detected. In addition, nose and throat swab specimens obtained from 30 asymptomatic subjects during the winter season were analyzed by the
multiplex TaqMan PCR to assess the possibility of false-positive
results; none of the samples gave a positive signal.
Comparison of TaqMan PCR, shell vial culturing, and conventional
culturing to nested RT-PCR for clinical specimens.
A total of 98 clinical specimens were collected during the 1998-1999 and 1999-2000 winter seasons. Eighty of the samples were sent by mail at room
temperature, whereas 18 of the samples were transported to the
laboratory immediately at 4°C. The samples were analyzed for
influenza viruses A and B using multiplex nested PCR, multiplex TaqMan
PCR, cell culturing, and shell vial culturing (Table
2). All of the nested RT-PCR-positive
samples were subsequently used in a sensitivity analysis. When the
results of the multiplex TaqMan PCR and the combined results of
conventional cell culturing and shell vial culturing were compared with
those of the nested PCR, overall sensitivities of 88 and 51%,
respectively, were found. For the 18 samples that were transported at
4°C, sensitivities were 83% for multiplex TaqMan PCR and 44% for
conventional culturing and/or shell vial culturing. For the 80 samples
that were sent by mail at room temperature, sensitivities were 96% for
multiplex TaqMan PCR and 57% for conventional culturing and/or shell
vial culturing.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Comparison of conventional culturing or shell vial
culturing, multiplex TaqMan PCR, and nested multiplex PCR for the
detection of influenza viruses A and B in 98 clinical specimens
|
|
Longitudinal follow-up.
Six patients infected with influenza
virus (two with influenza virus B and four with influenza virus A
[H3N2]) were monitored during their infections. A total of 30 nasal
washes were obtained on days 1 to 3, 7, and 14 after the presentation
of influenza-like symptoms. The number of viral RNA copies in the
clinical samples was determined by extrapolation to a standard curve
generated upon amplification of serial dilutions of the EM-counted
virus stocks (A/PR/8/34 and B/Lee/40) (Fig.
2). Using the multiplex TaqMan PCR, we
were able to detect and quantify influenza virus in nasal washes up to
7 days after the initial presentation of influenza-like symptoms in
four patients, as shown in Fig. 3. Using
conventional culturing, we could detect virus on day 7 only in one
patient. The multiplex TaqMan PCR was also much more sensitive for the
detection of influenza viruses A and B than conventional culturing
and/or shell vial culturing: 20 of 30 specimens (66%) were positive
with the multiplex TaqMan PCR, while 11 of 30 specimens (35%) were
positive with tissue cell culturing and/or shell vial culturing.

View larger version (70K):
[in this window]
[in a new window]
|
FIG. 2.
Standard curve generated by the analysis of known
amounts of viral RNA of influenza virus B/Lee/40 with the multiplex
TaqMan PCR. Unknown quantities of virus in clinical specimens are
plotted against the standard curve.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Longitudinal follow-up of six patients with either
influenza virus A (patients 3 to 6) or virus B infection (patients 1 and 2). Quantitative analysis was performed using the multiplex TaqMan
PCR. The clinical samples were plotted against the standard curve. The
filled symbols represent the clinical specimens that were also found
positive by conventional culturing and/or shell vial culturing. vp,
virus particles.
|
|
 |
DISCUSSION |
Our findings demonstrate that the multiplex TaqMan PCR is a
sensitive and specific method for the simultaneous rapid detection of
influenza viruses A and B. In fact, we were able to detect as little as
0.02 TCID50 for influenza virus A and 0.006 TCID50 for influenza virus B, corresponding to
approximately 10 viral RNA copies.
For epidemiological reasons, it is important to type and subtype
influenza virus strains. In recent studies, typing and subtyping of
influenza virus strains have been performed using (multiplex) RT-PCR
(5, 16, 19). This type of analysis, however, is time-consuming, either because (sub)type-specific PCRs need to be
performed or because the post-PCR analysis is complicated.
The multiplex TaqMan PCR described here allows extremely rapid and
accurate diagnosis of both types of influenza viruses within 4 to
5 h. Our type-specific probes, for example, can be labeled with
different fluorogenic dyes to distinguish between influenza viruses A
and B, because the ABI Prism 7700 sequence detection system has the
capability of detecting multiple dyes with distinct emission
wavelengths (17). Then, sequential TaqMan PCRs using subtype-specific primers can be performed to subtype influenza virus A
in detail (16).
Besides being rapid, this method also has the advantage of a
standardized protocol that can be applied easily to other respiratory viruses; the TaqMan PCR can be performed under uniform amplification conditions, thereby allowing the use of target-specific primer and
probe sets. In addition, the procedure is less complicated than other
RT-PCR methods, and the chances of contamination are minimized because
there is no post-PCR processing of the samples.
The multiplex TaqMan PCR was more sensitive than standard conventional
culturing or shell vial culturing; i.e., the multiplex TaqMan PCR
detected influenza viruses at lower concentrations. The low recovery
rate with culture techniques is usually explained by viral inactivation
caused by the transportation of samples. However, in this study, the
transport conditions did not affect the sensitivity of conventional
culturing, although the number of tested clinical specimens was small.
In order to correct for false-positive results, we obtained samples not
only from symptomatic patients but also from asymptomatic individuals
during the same influenza season. Since none of the latter samples
contained influenza virus RNA, the positive results obtained with the
multiplex TaqMan PCR, which were confirmed by nested PCR, can be
considered true positives.
Follow-up of the six symptomatic patients showed that influenza virus
could be detected up to 7 days after infection using the multiplex
TaqMan PCR, a period when most of the patients were still clinically
ill. In contrast, influenza virus could be isolated by conventional
culturing only during the first 1 or 2 days for the majority of these patients.
We were able to quantify the results of our PCR technique using serial
dilutions of EM-counted stocks of influenza viruses A and B. A standard
curve could be generated with the multiplex TaqMan PCR, creating a
quantitative format for the assay. Even though influenza virus
infection usually persists for only 1 week, quantification might be a
useful tool for evaluating the effects of antiviral therapy.
In conclusion, we have developed a rapid, highly sensitive and specific
quantitative real-time PCR for the simultaneous detection of influenza
viruses A and B. Results can be obtained within a few hours, thus
allowing time for adequate clinical management and the evaluation of
antiviral therapy.
 |
ACKNOWLEDGMENTS |
We thank Charles Boucher, Department of Virology, University
Medical Center Utrecht, for critically reading the manuscript. We also
thank Eric Claas, Department of Virology, University Medical Center
Leiden, for the gift of A/Japan/307/57 virus and A/England/1/66 virus.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Eijkman-Winkler
Institute for Microbiology, Infectious Diseases and Inflammation,
Department of Virology, University Medical Center Utrecht, P.O. Box
85500, 3508 GA Utrecht, The Netherlands. Phone: 31 30 2506526. Fax: 31 30 2505426. E-mail: l.vanelden{at}digd.azu.nl.
 |
REFERENCES |
| 1.
|
Atmar, R. L.,
B. D. Baxter,
E. A. Dominguez, and L. H. Taber.
1996.
Comparison of reverse transcription-PCR with tissue culture and other rapid diagnostic assays for detection of type A influenza virus.
J. Clin. Microbiol.
34:2604-2606[Abstract].
|
| 2.
|
Boom, R.,
C. J. Sol,
M. M. Salimans,
C. L. Jansen,
P. M. Wertheim-van Dillen, and J. van der Noorda.
1990.
Rapid and simple method for purification of nucleic acids.
J. Clin. Microbiol.
28:495-503[Abstract/Free Full Text].
|
| 3.
|
Claas, E. C.,
A. J. van Milaan,
M. J. Sprenger,
M. Ruiten-Stuiver,
G. I. Arron,
P. H. Rothbarth, and N. Masurel.
1993.
Prospective application of reverse transcriptase polymerase chain reaction for diagnosing influenza infections in respiratory samples from a children's hospital.
J. Clin. Microbiol.
31:2218-2221[Abstract/Free Full Text].
|
| 4.
|
Doller, G.,
W. Schuy,
K. Y. Tjhen,
B. Stekeler, and H. J. Gerth.
1992.
Direct detection of influenza virus antigen in nasopharyngeal specimens by direct enzyme immunoassay in comparison with quantitating virus shedding.
J. Clin. Microbiol.
30:866-869[Abstract/Free Full Text].
|
| 5.
|
Ellis, J. S.,
D. M. Fleming, and M. C. Zambon.
1997.
Multiplex reverse transcription-PCR for surveillance of influenza A and B viruses in England and Wales in 1995 and 1996.
J. Clin. Microbiol.
35:2076-2082[Abstract].
|
| 6.
|
Hayden, F. G.,
R. L. Atmar,
M. Schilling,
C. Johnson,
D. Poretz,
D. Paar,
L. Huson,
P. Ward, and R. G. Mills.
1999.
Use of the selective oral neuraminidase inhibitor oseltamivir to prevent influenza.
N. Engl. J. Med.
341:1336-1343[Abstract/Free Full Text].
|
| 7.
|
Hayden, F. G.,
A. D. M. E. Osterhaus,
J. J. Treanor,
D. M. Fleming,
F. Y. Aoki,
K. G. Nicholson,
A. M. Bohnen,
H. M. Hirst,
O. Keene, and K. Wightman.
1997.
Efficacy and safety of the neuraminidase inhibitor zanamivir in the treatment of influenzavirus infections.
N. Engl. J. Med.
337:874-880[Abstract/Free Full Text].
|
| 8.
|
Hayden, F. G.,
J. J. Treanor,
R. S. Fritz,
M. Lobo,
R. F. Betts,
M. Miller,
N. Kinnersley,
R. G. Mills,
P. Ward, and S. E. Straus.
1999.
Use of the oral neuraminidase inhibitor oseltamivir in experimental human influenza: randomized controlled trials for prevention and treatment.
JAMA
282:1240-1246[Abstract/Free Full Text].
|
| 9.
|
Heid, C. A.,
J. Stevens,
K. J. Livak, and P. M. Williams.
1996.
Real time quantitative PCR.
Genome Res.
6:986-994[Abstract/Free Full Text].
|
| 10.
|
Kato, T.,
M. Mizokami,
M. Mukaide,
E. Orito,
T. Ohno,
T. Nakano,
Y. Tanaka,
H. Kato,
F. Sugauchi,
R. Ueda,
N. Hirashima,
K. Shimamatsu,
M. Kage, and M. Kojiro.
2000.
Development of a TT virus DNA quantification system using real-time detection PCR.
J. Clin. Microbiol.
38:94-98[Abstract/Free Full Text].
|
| 11.
|
Kok, J.,
L. Mickan, and C. J. Burrell.
1994.
Routine diagnosis of seven respiratory viruses and Mycoplasma pneumoniae by enzyme immunoassay.
J. Virol. Methods
50:87-100[CrossRef][Medline].
|
| 12.
|
Management of Influenza in the Southern Hemisphere Trialists Study Group.
1998.
Randomised trial of efficacy and safety of inhaled zanamavir in treatment of influenza A and B virus infections.
Lancet
352:1877-1881[CrossRef][Medline].
|
| 13.
|
Nijhuis, M.,
C. A. Boucher, and R. Schuurman.
1995.
Sensitive procedure for the amplification of HIV-1 RNA using a combined reverse-transcription and amplification reaction.
BioTechniques
19:178-180[Medline], 182.
|
| 14.
|
Pongers-Willemse, M. J.,
O. J. Verhagen,
G. J. Tibbe,
A. J. Wijkhuijs,
V. de Haas,
E. Roovers,
C. E. van der Schoot, and J. J. van Dongen.
1998.
Real-time quantitative PCR for the detection of minimal residual disease in acute lymphoblastic leukemia using junctional region specific TaqMan probes.
Leukemia
12:2006-2014[CrossRef][Medline].
|
| 15.
|
Schmid, M. L.,
G. Kudesia,
S. Wake, and R. C. Read.
1998.
Prospective comparative study of culture specimens and methods in diagnosing influenza in adults.
Br. Med. J.
316:275[Free Full Text].
|
| 16.
|
Schweiger, B.,
I. Zadow,
R. Heckler,
H. Timm, and G. Pauli.
2000.
Application of a fluorogenic PCR assay for typing and subtyping of influenza viruses in respiratory samples.
J. Clin. Microbiol.
38:1552-1558[Abstract/Free Full Text].
|
| 17.
|
Vet, J. A.,
A. R. Majithia,
S. A. Marras,
S. Tyagi,
S. Dube,
B. J. Poiesz, and F. R. Kramer.
1999.
Multiplex detection of four pathogenic retroviruses using molecular beacons.
Proc. Natl. Acad. Sci. USA
96:6394-6399[Abstract/Free Full Text].
|
| 18.
|
Wiselka, M.
1994.
Influenza: diagnosis, management, and prophylaxis.
Br. Med. J.
308:1341-1345[Abstract/Free Full Text].
|
| 19.
|
Wright, K. E.,
G. A. Wilson,
D. Novosad,
C. Dimock,
D. Tan, and J. M. Weber.
1995.
Typing and subtyping of influenza viruses in clinical samples by PCR.
J. Clin. Microbiol.
33:1180-1184[Abstract].
|
| 20.
|
Ziegler, T.,
H. Hall,
A. Sanchez-Fauquier,
W. Gamble, and N. Cos.
1995.
Type and subtype specific detection of influenza viruses in clinical specimens by rapid culture assay.
J. Clin. Microbiol.
33:318-322[Abstract].
|
Journal of Clinical Microbiology, January 2001, p. 196-200, Vol. 39, No. 1
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.1.196-200.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Badiaga, S., Richet, H., Azas, P., Zandotti, C., Rey, F., Charrel, R., Benabdelkader, E.-h., Drancourt, M., Raoult, D., Brouqui, P.
(2009). Contribution of a shelter-based survey for screening respiratory diseases in the homeless. Eur J Public Health
19: 157-160
[Abstract]
[Full Text]
-
Rodriguez, R. A., Pepper, I. L., Gerba, C. P.
(2009). Application of PCR-Based Methods To Assess the Infectivity of Enteric Viruses in Environmental Samples. Appl. Environ. Microbiol.
75: 297-307
[Full Text]
-
Heer, A. K., Harris, N. L., Kopf, M., Marsland, B. J.
(2008). CD4+ and CD8+ T Cells Exhibit Differential Requirements for CCR7-Mediated Antigen Transport during Influenza Infection. J. Immunol.
181: 6984-6994
[Abstract]
[Full Text]
-
Mahony, J. B.
(2008). Detection of Respiratory Viruses by Molecular Methods. Clin. Microbiol. Rev.
21: 716-747
[Abstract]
[Full Text]
-
Song, J.-H., Nguyen, H. H., Cuburu, N., Horimoto, T., Ko, S.-Y., Park, S.-H., Czerkinsky, C., Kweon, M.-N.
(2008). From the Cover: Sublingual vaccination with influenza virus protects mice against lethal viral infection. Proc. Natl. Acad. Sci. USA
105: 1644-1649
[Abstract]
[Full Text]
-
LeGoff, J., Kara, R., Moulin, F., Si-Mohamed, A., Krivine, A., Belec, L., Lebon, P.
(2008). Evaluation of the One-Step Multiplex Real-Time Reverse Transcription-PCR ProFlu-1 Assay for Detection of Influenza A and Influenza B Viruses and Respiratory Syncytial Viruses in Children. J. Clin. Microbiol.
46: 789-791
[Abstract]
[Full Text]
-
Keller, T. T., van der Meer, J. J., Teeling, P., van der Sluijs, K., Idu, M. M., Rimmelzwaan, G. F., Levi, M., van der Wal, A. C., de Boer, O. J.
(2008). Selective Expansion of Influenza A Virus-Specific T Cells in Symptomatic Human Carotid Artery Atherosclerotic Plaques. Stroke
39: 174-179
[Abstract]
[Full Text]
-
Letant, S. E., Ortiz, J. I., Bentley Tammero, L. F., Birch, J. M., Derlet, R. W., Cohen, S., Manning, D., McBride, M. T.
(2007). Multiplexed Reverse Transcriptase PCR Assay for Identification of Viral Respiratory Pathogens at the Point of Care. J. Clin. Microbiol.
45: 3498-3505
[Abstract]
[Full Text]
-
Matskevich, A. A., Moelling, K.
(2007). Dicer is involved in protection against influenza A virus infection. J. Gen. Virol.
88: 2627-2635
[Abstract]
[Full Text]
-
van de Pol, A. C., van Loon, A. M., Wolfs, T. F. W., Jansen, N. J. G., Nijhuis, M., Breteler, E. K., Schuurman, R., Rossen, J. W. A.
(2007). Increased Detection of Respiratory Syncytial Virus, Influenza Viruses, Parainfluenza Viruses, and Adenoviruses with Real-Time PCR in Samples from Patients with Respiratory Symptoms. J. Clin. Microbiol.
45: 2260-2262
[Abstract]
[Full Text]
-
Dessing, M. C., van der Sluijs, K. F., Florquin, S., Akira, S., van der Poll, T.
(2007). Toll-Like Receptor 2 Does Not Contribute to Host Response during Postinfluenza Pneumococcal Pneumonia. Am. J. Respir. Cell Mol. Bio.
36: 609-614
[Abstract]
[Full Text]
-
Chao, D.-Y., Davis, B. S., Chang, G.-J. J.
(2007). Development of Multiplex Real-Time Reverse Transcriptase PCR Assays for Detecting Eight Medically Important Flaviviruses in Mosquitoes. J. Clin. Microbiol.
45: 584-589
[Abstract]
[Full Text]
-
Co, D. O., Hogan, L. H., Karman, J., Heninger, E., Vang, S., Wells, K., Kawaoka, Y., Sandor, M.
(2006). Interactions between T Cells Responding to Concurrent Mycobacterial and Influenza Infections. J. Immunol.
177: 8456-8465
[Abstract]
[Full Text]
-
Keller, T. T., van der Sluijs, K. F., de Kruif, M. D., Gerdes, V. E. A., Meijers, J. C. M., Florquin, S., van der Poll, T., van Gorp, E. C. M., Brandjes, D. P. M., Buller, H. R., Levi, M.
(2006). Effects on Coagulation and Fibrinolysis Induced by Influenza in Mice With a Reduced Capacity to Generate Activated Protein C and a Deficiency in Plasminogen Activator Inhibitor Type 1. Circ. Res.
99: 1261-1269
[Abstract]
[Full Text]
-
Zitterkopf, N. L., Leekha, S., Espy, M. J., Wood, C. M., Sampathkumar, P., Smith, T. F.
(2006). Relevance of influenza a virus detection by PCR, shell vial assay, and tube cell culture to rapid reporting procedures.. J. Clin. Microbiol.
44: 3366-3367
[Abstract]
[Full Text]
-
Brown, D. M., Dilzer, A. M., Meents, D. L., Swain, S. L.
(2006). CD4 T cell-mediated protection from lethal influenza: perforin and antibody-mediated mechanisms give a one-two punch.. J. Immunol.
177: 2888-2898
[Abstract]
[Full Text]
-
Espy, M. J., Uhl, J. R., Sloan, L. M., Buckwalter, S. P., Jones, M. F., Vetter, E. A., Yao, J. D. C., Wengenack, N. L., Rosenblatt, J. E., Cockerill, F. R. III, Smith, T. F.
(2006). Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. Clin. Microbiol. Rev.
19: 165-256
[Abstract]
[Full Text]
-
van der Sluijs, K. F., van Elden, L. J. R., Nijhuis, M., Schuurman, R., Florquin, S., Shimizu, T., Ishii, S., Jansen, H. M., Lutter, R., van der Poll, T.
(2006). Involvement of the platelet-activating factor receptor in host defense against Streptococcus pneumoniae during postinfluenza pneumonia. Am. J. Physiol. Lung Cell. Mol. Physiol.
290: L194-L199
[Abstract]
[Full Text]
-
Grissell, T. V., Powell, H., Shafren, D. R., Boyle, M. J., Hensley, M. J., Jones, P. D., Whitehead, B. F., Gibson, P. G.
(2005). Interleukin-10 Gene Expression in Acute Virus-induced Asthma. Am. J. Respir. Crit. Care Med.
172: 433-439
[Abstract]
[Full Text]
-
Suzuki, N., Yoshida, A., Nakano, Y.
(2005). Quantitative Analysis of Multi-Species Oral Biofilms by TaqMan Real-Time PCR. Clin Med Res
3: 176-185
[Abstract]
[Full Text]
-
Krafft, A. E., Russell, K. L., Hawksworth, A. W., McCall, S., Irvine, M., Daum, L. T., Connoly, J. L., Reid, A. H., Gaydos, J. C., Taubenberger, J. K.
(2005). Evaluation of PCR Testing of Ethanol-Fixed Nasal Swab Specimens as an Augmented Surveillance Strategy for Influenza Virus and Adenovirus Identification. J. Clin. Microbiol.
43: 1768-1775
[Abstract]
[Full Text]
-
Hindiyeh, M., Levy, V., Azar, R., Varsano, N., Regev, L., Shalev, Y., Grossman, Z., Mendelson, E.
(2005). Evaluation of a Multiplex Real-Time Reverse Transcriptase PCR Assay for Detection and Differentiation of Influenza Viruses A and B during the 2001-2002 Influenza Season in Israel. J. Clin. Microbiol.
43: 589-595
[Abstract]
[Full Text]
-
Yoshikawa, T., Matsuo, K., Matsuo, K., Suzuki, Y., Nomoto, A., Tamura, S.-i., Kurata, T., Sata, T.
(2004). Total viral genome copies and virus-Ig complexes after infection with influenza virus in the nasal secretions of immunized mice. J. Gen. Virol.
85: 2339-2346
[Abstract]
[Full Text]
-
van der Sluijs, K. F., van Elden, L. J. R., Nijhuis, M., Schuurman, R., Pater, J. M., Florquin, S., Goldman, M., Jansen, H. M., Lutter, R., van der Poll, T.
(2004). IL-10 Is an Important Mediator of the Enhanced Susceptibility to Pneumococcal Pneumonia after Influenza Infection. J. Immunol.
172: 7603-7609
[Abstract]
[Full Text]
-
Arens, R., Schepers, K., Nolte, M. A., van Oosterwijk, M. F., van Lier, R. A.W., Schumacher, T. N.M., van Oers, M. H.J.
(2004). Tumor Rejection Induced by CD70-mediated Quantitative and Qualitative Effects on Effector CD8+ T Cell Formation. JEM
199: 1595-1605
[Abstract]
[Full Text]
-
Templeton, K. E., Scheltinga, S. A., Beersma, M. F. C., Kroes, A. C. M., Claas, E. C. J.
(2004). Rapid and Sensitive Method Using Multiplex Real-Time PCR for Diagnosis of Infections by Influenza A and Influenza B Viruses, Respiratory Syncytial Virus, and Parainfluenza Viruses 1, 2, 3, and 4. J. Clin. Microbiol.
42: 1564-1569
[Abstract]
[Full Text]
-
Dingle, K. E., Crook, D., Jeffery, K.
(2004). Stable and Noncompetitive RNA Internal Control for Routine Clinical Diagnostic Reverse Transcription-PCR. J. Clin. Microbiol.
42: 1003-1011
[Abstract]
[Full Text]
-
Frisbie, B., Tang, Y.-W., Griffin, M., Poehling, K., Wright, P. F., Holland, K., Edwards, K. M.
(2004). Surveillance of Childhood Influenza Virus Infection: What Is the Best Diagnostic Method To Use for Archival Samples?. J. Clin. Microbiol.
42: 1181-1184
[Abstract]
[Full Text]
-
Boivin, G., Cote, S., Dery, P., De Serres, G., Bergeron, M. G.
(2004). Multiplex Real-Time PCR Assay for Detection of Influenza and Human Respiratory Syncytial Viruses. J. Clin. Microbiol.
42: 45-51
[Abstract]
[Full Text]
-
Hughes, G. J., Smith, J. S., Hanlon, C. A., Rupprecht, C. E.
(2004). Evaluation of a TaqMan PCR Assay To Detect Rabies Virus RNA: Influence of Sequence Variation and Application to Quantification of Viral Loads. J. Clin. Microbiol.
42: 299-306
[Abstract]
[Full Text]
-
Falsey, A. R., Formica, M. A., Treanor, J. J., Walsh, E. E.
(2003). Comparison of Quantitative Reverse Transcription-PCR to Viral Culture for Assessment of Respiratory Syncytial Virus Shedding. J. Clin. Microbiol.
41: 4160-4165
[Abstract]
[Full Text]
-
van Elden, L. J. R., van Loon, A. M., van der Beek, A., Hendriksen, K. A. W., Hoepelman, A. I. M., van Kraaij, M. G. J., Schipper, P., Nijhuis, M.
(2003). Applicability of a Real-Time Quantitative PCR Assay for Diagnosis of Respiratory Syncytial Virus Infection in Immunocompromised Adults. J. Clin. Microbiol.
41: 4378-4381
[Abstract]
[Full Text]
-
Ruest, A., Michaud, S., Deslandes, S., Frost, E. H.
(2003). Comparison of the Directigen Flu A+B Test, the QuickVue Influenza Test, and Clinical Case Definition to Viral Culture and Reverse Transcription-PCR for Rapid Diagnosis of Influenza Virus Infection. J. Clin. Microbiol.
41: 3487-3493
[Abstract]
[Full Text]
-
Habib-Bein, N. F., Beckwith, W. H. III, Mayo, D., Landry, M. L.
(2003). Comparison of SmartCycler Real-Time Reverse Transcription-PCR Assay in a Public Health Laboratory with Direct Immunofluorescence and Cell Culture Assays in a Medical Center for Detection of Influenza A Virus. J. Clin. Microbiol.
41: 3597-3601
[Abstract]
[Full Text]
-
Hak, E., Hoes, A. W., Grobbee, D. E., Lammers, J. W. J., van Essen, G. A., van Loon, A. M., Verheij, T. J. M.
(2003). Conventional Influenza Vaccination Is Not Associated with Complications in Working-Age Patients with Asthma or Chronic Obstructive Pulmonary Disease. Am J Epidemiol
157: 692-700
[Abstract]
[Full Text]
-
White, P. L., Shetty, A., Barnes, R. A.
(2003). Detection of seven Candida species using the Light-Cycler system. J Med Microbiol
52: 229-238
[Abstract]
[Full Text]
-
Griffin, D. W., Donaldson, K. A., Paul, J. H., Rose, J. B.
(2003). Pathogenic Human Viruses in Coastal Waters. Clin. Microbiol. Rev.
16: 129-143
[Abstract]
[Full Text]
-
Dworkin, L. L., Gibler, T. M., Van Gelder, R. N.
(2002). Real-Time Quantitative Polymerase Chain Reaction Diagnosis of Infectious Posterior Uveitis. Arch Ophthalmol
120: 1534-1539
[Abstract]
[Full Text]
-
Spackman, E., Senne, D. A., Myers, T. J., Bulaga, L. L., Garber, L. P., Perdue, M. L., Lohman, K., Daum, L. T., Suarez, D. L.
(2002). Development of a Real-Time Reverse Transcriptase PCR Assay for Type A Influenza Virus and the Avian H5 and H7 Hemagglutinin Subtypes. J. Clin. Microbiol.
40: 3256-3260
[Abstract]
[Full Text]
-
Asai, Y., Jinno, T., Igarashi, H., Ohyama, Y., Ogawa, T.
(2002). Detection and Quantification of Oral Treponemes in Subgingival Plaque by Real-Time PCR. J. Clin. Microbiol.
40: 3334-3340
[Abstract]
[Full Text]
-
Broyles, J. M., O'Connell, K. P., Korniewicz, D. M.
(2002). PCR-Based Method for Detecting Viral Penetration of Medical Exam Gloves. J. Clin. Microbiol.
40: 2725-2728
[Abstract]
[Full Text]
-
Poehling, K. A., Griffin, M. R., Dittus, R. S., Tang, Y.-W., Holland, K., Li, H., Edwards, K. M.
(2002). Bedside Diagnosis of Influenzavirus Infections in Hospitalized Children. Pediatrics
110: 83-88
[Abstract]
[Full Text]
-
Kuoppa, Y., Boman, J., Scott, L., Kumlin, U., Eriksson, I., Allard, A.
(2002). Quantitative Detection of Respiratory Chlamydia pneumoniae Infection by Real-Time PCR. J. Clin. Microbiol.
40: 2273-2274
[Abstract]
[Full Text]
-
Chan, K. H., Maldeis, N., Pope, W., Yup, A., Ozinskas, A., Gill, J., Seto, W. H., Shortridge, K. F., Peiris, J. S. M.
(2002). Evaluation of the Directigen FluA+B Test for Rapid Diagnosis of Influenza Virus Type A and B Infections. J. Clin. Microbiol.
40: 1675-1680
[Abstract]
[Full Text]
-
Mackay, I. M., Arden, K. E., Nitsche, A.
(2002). Real-time PCR in virology. Nucleic Acids Res
30: 1292-1305
[Abstract]
[Full Text]
-
Zhang, J., Day, I. N. M., Byrne, C. D.
(2002). A novel medium throughput quantitative competitive PCR technology to simultaneously measure mRNA levels from multiple genes. Nucleic Acids Res
30: e20-e20
[Abstract]
[Full Text]
-
Lipson, S. M., Liolios, L., Wesselingh, S.
(2002). Rapid Laboratory Diagnostics during the Winter Respiratory Virus Season. J. Clin. Microbiol.
40: 733-734
[Full Text]
-
Callahan, J. D., Wu, S.-J. L., Dion-Schultz, A., Mangold, B. E., Peruski, L. F., Watts, D. M., Porter, K. R., Murphy, G. R., Suharyono, W., King, C.-C., Hayes, C. G., Temenak, J. J.
(2001). Development and Evaluation of Serotype- and Group-Specific Fluorogenic Reverse Transcriptase PCR (TaqMan) Assays for Dengue Virus. J. Clin. Microbiol.
39: 4119-4124
[Abstract]
[Full Text]