This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An author's correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suksawat, J.
Right arrow Articles by Breitschwerdt, E. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suksawat, J.
Right arrow Articles by Breitschwerdt, E. B.

 Previous Article  |  Next Article 

Journal of Clinical Microbiology, January 2001, p. 90-93, Vol. 39, No. 1
0095-1137/01/$04.00+0   DOI: 10.1128/JCM.39.1.90-93.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.

Coinfection with Three Ehrlichia Species in Dogs from Thailand and Venezuela with Emphasis on Consideration of 16S Ribosomal DNA Secondary Structure

Jiraporn Suksawat,1 Christian Pitulle,1 Cruz Arraga-Alvarado,2 Karina Madrigal,2 Susan I. Hancock,1 and Edward B. Breitschwerdt1,*

Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina 27606,1 and Unidad de Investigacions Clinicas, Facultad de Ciencias, Veterinarias, Universidad del Zulia, Maracaibo, Venezuela2

Received 2 August 2000/Returned for modification 8 September 2000/Accepted 25 October 2000


    ABSTRACT
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

As part of a larger study to investigate tick-borne infections in dogs from Thailand and Venezuela, documentation of coinfection with three Ehrlichia species in two dogs, one from each country, became the focus of the present study. Although neither dog had clinical signs attributable to ehrlichiosis, both dogs were anemic and neutropenic and the Thai dog was thrombocytopenic. Genus- and species-specific PCR targeting the 16S rRNA genes indicated that both dogs were coinfected with Ehrlichia canis, E. platys, and E. equi. To our knowledge, these results provide the first molecular documentation for the presence of E. equi in dogs from these countries. Using universal bacterial PCR primers, one nearly full-length 16S rRNA gene could be amplified from each dog. The sequences were identical to each other and almost identical to that of E. platys (AF156784), providing the first E. platys 16S ribosomal DNA (rDNA) sequences reported from these two geographically divergent countries. To determine whether these sequence differences allow differentiation between these two strains and other published 16S rDNA E. platys sequences, we performed a phylogenetic analysis of the rRNA, incorporating the consideration of secondary structure.


    INTRODUCTION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Dogs can be infected with several Ehrlichia species, including Ehrlichia canis (7), E. chaffeensis (6), E. equi (17), E. risticii (15), E. platys (12), and E. ewingii (9). Knowledge related to the geographic distribution, zoonotic potential, and pathologic consequences of Ehrlichia infections in dogs has expanded in recent years. However, within the genus Ehrlichia, only E. canis has been strongly implicated as a canine pathogen of worldwide distribution. In Thailand, morulae have been visualized in canine monocytes and platelets, whereas in Venezuela, morulae have been observed in monocytes, granulocytes, and platelets (1). With the advent of increased serologic and molecular testing, coinfection with multiple tick-borne organisms has been recognized with increasing frequency in both dogs and humans in the United States (2, 4, 9, 16, 18). Data related to coinfection with multiple tick-borne pathogens are less available from many other countries.

Cultivation of Ehrlichia sp. requires complex and time-consuming steps, large blood specimen volumes, and meticulous attention to detail. Additionally, the phenotypic characterization of intracellular bacteria can lead to the proposal of a novel organism that genotypically may or may not be different from other known organisms. Phylogenetic analysis of 16S rRNA has proven to be the most powerful tool for the identification and classification of microorganisms (20, 23) and does not rely on the cultivation of organisms. Therefore, it has become the approach of choice when phenotypic data are inconclusive. In this report, we have utilized this approach to identify and to characterize the different Ehrlichia species responsible for coinfection in the dogs from Thailand and from Venezuela.

(This study was presented in part as an abstract at the 15th sesquiannual meeting of the American Society of Rickettsiology, Captiva Island, Fla., 1 to 3 May 2000.)


    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Dogs. The dog from Thailand (a 6-year-old female poodle) was admitted to the Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand, for evaluation of peridontal disease. Blood from the dog from Venezuela (an adult male mixed-breed dog) was sent to Unidad de Investigacions Clinicas, Facultad de Ciencias, Veterinarias, Universidad del Zulia, Maracaibo, Venezuela, for hematologic evaluation. The dog was reportedly healthy, but another dog from the same household had died recently of a febrile illness compatible with ehrlichiosis, raising the possibility for a tick-transmitted infection. Neither dog had traveled outside of the country of origin.

Blood sample collection. Half of the blood obtained from the dog from Thailand was treated with EDTA as an anticoagulant, and the remainder was allowed to clot for the removal of serum. For the dog from Venezuela, only EDTA-anticoagulated blood was available to us. Samples were stored frozen at -70°C and transported on dry ice.

IFA and Western immunoblotting. An indirect fluorescent antibody (IFA) test was performed on the serum from the Thai dog to assess the prevalence of antibodies to E. canis, E. chaffeensis, E. equi, and E. risticii (14). To confirm the IFA results, serum from the Thai dog was screened by electrophoretic analysis of E. canis (canine-origin strain Florida, provided by C. J. Holland) and E. phagocytophila (human-origin strain 96HE158, provided by J. S. Dumler) protein antigens using the Western immunoblotting procedure, as described elsewhere (21).

DNA extraction and PCR amplification. Frozen (-70°C) EDTA-blood was thawed to room temperature, and 200 µl was removed and washed twice with phosphate-buffered saline. DNA was extracted using the QIAamp DNA-blood minikit (Qiagen, Chatsworth, Calif.) by following the manufacturer's protocol. To minimize the potential risks for contaminations, DNA extractions, PCRs, and agarose gel electrophoresis were performed in separate rooms. Positive (tissue culture-grown Ehrlichia species) and negative controls were included in all PCR assays.

PCRs for the amplification of partial 16S ribosomal DNA (rDNA) for the genus Ehrlichia (122 bp) and for Ehrlichia species (151 to 401 bp, depending on the species) were performed by using nested PCR in a Progene thermocycler (Techne, Princeton, N.J.) as previously described (4, 16). PCR amplification of the almost-complete 16S rDNA (1,460 bp) was accomplished with primers PO-C and PC-5A as previously described (22), except that the annealing temperature was 53°C. All PCR products were separated by agarose gel electrophoresis in 1× Tris-borate-EDTA buffer. The concentration of agarose was 1 (386 to 1,460 bp) or 2% (122 to 151 bp). PCR products were purified by using the Qiaquick PCR purification kit (Qiagen) as described by the supplier. The DNA fragments were visualized by UV transillumination after ethidium bromide staining and compared to DNA size standards (Promega, Madison, Wis.).

Cloning and sequencing. PCR amplicons that represented almost-full-length 16S rDNA (1,460 bp) were ligated into the pCR 2.1-TOPO vector followed by transformation of Escherichia coli TOP 10 cells using the TOPO TA cloning kit (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions. The resulting clones were screened by blue/white colony screening. Plasmid DNA of positive clones was isolated by using the QIAprep spin miniprep kit (Qiagen). Size confirmation of the cloned inserts was performed by restriction digest with EcoRI and subsequent agarose gel electrophoresis. Each insert of interest was reamplified from the plasmid using plasmid-specific primers M13 forward (-20) and M13 reverse. The resulting amplicons were digested with restriction enzyme endonucleases AluI and HpaI (Promega). DNA fragments were separated on a 4% agarose gel in 1× Tris-borate-EDTA. Clones that represented unique restriction fragment patterns were chosen for double-strand sequencing. All sequencing reactions were performed at the Center Sequencing Facility (University of North Carolina, Chapel Hill, N.C.). The following primers were used: P1 (5'ACTCCTACGGGAGGCAGCAGT), P3Mod (5'ATTAGATACCCTGGTAGTCC), and P4 (5'GAGGAAGGTGGGGACGTCAA) and M13 reverse (Invitrogen), PC1 (5'ACTGCTGCCTCCCGTAGGAGT), PC3 (5'GGACTACCAGGGTATCTAAT), and PC4 (5'TTGACGTCATCCCCACCTTCCTC). Short PCR products derived from the species-specific PCRs were used directly for sequencing with primers HE3-R (5'CTTCTATAGGTACCGTCATTATCTTCCCTAT) and EC-F (5'CAATTATTTATAGCCTCTGGCTATAGGAA) for E. canis, HE3-R and EQ-F (5'GTCGAACGGATTATTCTTTATAGCTTGC) for E. equi, and GE2f (5'GTTAGTGGCAGACGGGTGAGT) and Ehrl3-IP2 (5'TCATCTAATAGCGATAAATC) for E. platys.

Sequence analysis. All 16S rDNA sequences were initially compared to the sequence data available in the common databases by using BLAST, version 2.0 (3) for the determination of their approximate phylogenetic affiliations. Sequences that reflected the closest matches (those for E. canis [U26740], E. platys [AF156784], E. equi [M73223], E. phagocytophila (M73220), human granulocytic ehrlichiosis (HGE) agent [AF093788]) were downloaded from GenBank and were aligned with the sequences from this study based on 16S rRNA secondary structure. Sequence differences were evaluated based on the comparison of homologous regions within the 16S rRNA.

Nucleotide sequence accession numbers. Partial 16S rDNA sequences derived from Thai and Venezuelan dogs were deposited in GenBank under accession no. AF287155 and AF287154 for E. equi and under accession no. AF286699 and AF287153 for E. platys.


    RESULTS
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

Case summaries. The dog from Thailand had no signs of abnormal bleeding, was afebrile, and had a systolic heart murmur. During blood smear examination, intracellular morulae (cell type not defined) containing Ehrlichia species were observed and Babesia canis parasites were identified in erythrocytes. The dog was anemic (18.5% packed cell volume [PCV]; reference values, 37 to 55%), leukopenic (6,100/µl; reference values, 6,900 to 13,600/µl), neutropenic (3,172/µl; reference values, 3,300 to 9,000/µl), and thrombocytopenic (30,000/µl; reference values, 150 to 500/µl). In the dog from Venezuela, morulae containing Ehrlichia species were found in granulocytes and in platelets. Additionally, gamonts of the eucaryotic genus Hepatozoon were reported in neutrophils. The dog was anemic (18.5% PCV; reference values, 37 to 55%), leukopenic (3,600/µl; reference values, 6,900 to 13,600/µl), neutropenic (2,988/µl; reference values, 3,300 to 9,000/µl), and lymphopenic (216/µl; reference values, 1,200 to 4,200/µl). Values are given in cells per microliter of blood.

Serology. By IFA testing, the Thai dog had a reciprocal titer of 10,240 to E. canis antigens, 10,240 to E. chaffeensis antigens, 1,280 to E. equi antigens, and 640 to E. risticii antigens. The Western immunoblot patterns with respect to E. canis and E. equi antigens were indicative of the exposure to E. canis.

Sequencing and analysis of species-specific PCR products. Partial 16S rRNA sequences obtained from Ehrlichia species-specific PCR products provided the initial molecular evidence that both dogs were infected with at least three Ehrlichia species. The sequences of the E. canis and E. platys PCR products from both dogs (302 and 129 bp, respectively) were identical to those of the corresponding regions in the 16S rDNAs of E. canis (U26740) and E. platys (AF156784), respectively. The 343-bp partial 16S rDNA fragments derived from both dogs that resembled that of E. equi were identical to each other but showed differences in three positions from those of E. equi (M73223), E. phagocytophila (M73220), and HGE agent (AF093788).

Analysis of E. platys 16S rDNA. By using universal bacterial primers PO-C and PC-5A (22), we amplified the almost-complete (1,460 bp) 16S rDNA from one of the organisms involved in the coinfection of the two dogs studied. The 16S rDNA sequence derived from the Thai dog differed in five positions from the corresponding sequence for E. platys (strain Gzh981; China) deposited in GenBank (AF156784). Three of these differences are at nucleotide positions 1078, 1142, and 1309 of the corresponding rRNA (E. coli J01695 numbering system). Two single nucleotide insertions occur between nucleotide positions 511 and 512 and between positions 990 and 991 (E. coli J01695 numbering system). The 16S rDNA sequence obtained from the Venezuelan dog differed from E. platys 16S rDNA (AF156784) in four positions. Two differences are at nucleotide positions 1078 and 1299, and two single nucleotide insertions are between nucleotide positions 511 and 512 and between positions 990 and 991 of the corresponding rRNA (E. coli J01695 numbering system). The 16S rDNAs from both dogs differed from each other in only three positions (1142, 1299, and 1309) of the corresponding rRNAs. The sequence differences will be considered in Discussion.


    DISCUSSION
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

In this study, we focused on two dogs from geographically diverse countries that were coinfected with E. canis, E. platys, and E. equi. Western immunoblot analysis confirmed exposure to E. canis but could not be used to confirm exposure to E. equi because of the cross-reaction of E. canis serum to E. equi antigens (21). Similarly, sera from dogs infected with E. canis or E. chaffeensis are also highly cross-reactive (5, 16). Since serum was not available from the Venezuelan dog, serologic testing could not be performed.

To overcome the limitations of serology, 16S rDNA-based PCR was used to obtain molecular evidence for coinfection with E. canis, E. platys, and E. equi. Phylogenetic analysis using 16S rRNA is ideally based on the comparison of homologous regions of the 16S rRNA molecules. This has to be accomplished by using an alignment based on secondary structure rather than simply aligning sequences based on sequence similarity (20, 23). The main problem one encounters when comparing 16S rRNA sequence data with those derived from common databases is how to evaluate sequence differences and how to derive conclusions about the relatedness of organisms. However, differences can be the result of, e.g., sequencing errors, PCR errors, or microheterogeneity between different rRNA operons within the same organism (10).

By comparing our almost-full-length 16S rDNA sequence data derived from the dogs in Thailand and Venezuela to the E. platys sequences deposited in GenBank (3) under accession no. AF156784, we found almost sequence identity. All sequence differences in our data set have been confirmed in independent experiments by the double-strand sequencing of the corresponding DNA. Five and four positions of the 16S rDNA out of a total of 1,429 bp were different between E. platys (AF156784) and the E. platys sequence derived from the Thai and Venezuelan dogs, respectively.

To evaluate the accuracy and the importance of these sequence differences for phylogenetic studies and the development of specific PCR primers or diagnostic DNA/RNA probes, we performed a phylogenetic analysis based on secondary structure (http://www.rna.icmb.utexas.edu). We believe that the insertion of a C between positions 511 and 512 (E. coli J01695 numbering system), as reported for E. platys (AF156784), is due to a sequencing or PCR artifact. This insertion was not observed in our sequences, and the corresponding positions are conserved within the Bacteria. There is no evidence from the secondary structure of the 16S rRNA to support the presence of this insertion. The reported insertion of a T (AF156784) at positions 990 and 991 (E. coli J01695 numbering system) is in a loop area and is therefore possible. However, none of our sequencing data show this insertion. E. platys (AF156784) shows a deletion at position 1078 (E. coli J01695 numbering system). The sequence of the corresponding loop is therefore GGA. Both our isolates show a G at this position, which is part of a tetraloop with sequence GGGA. A tetraloop at this position is widely present in bacterial 16S rRNAs. Furthermore, this tetraloop is of the GNRA type (R = purine), one of the most common motifs in terminal loops within RNA molecules (13). We therefore believe that the deletion in E. platys (AF156784) could also be a result of a sequencing or PCR artifact. At position 1142 (E. coli J01695 numbering system), we observed A for the sample from Thailand, whereas E. platys (AF156784) and the sample from Venezuela have a G. Since this position is part of a conserved helix and since our sequence did not support a covariation event, we believe that an A at position 1142 is highly unlikely to occur in vivo and might be due to a PCR or sequencing error. Position 1299 (E. coli J01695 numbering system) is located in a loop that is occupied by an A for E. platys (AF156784) and the sequence derived from the Thai dog, whereas the sequence from the Venezuelan dog has a G. We therefore consider this result as possible.

Secondary structures of RNA molecules are based on Watson-Crick and non-Watson-Crick base pairs, e.g., G · U (19). At position 1309, the sequence derived from the Venezuelan dog and the sequence of E. platys (AF156784) have a T, whereas the sequence derived from the Thai dog has a C. This position is in a stem structure that has been confirmed by covariation. Since G · U base pairs in RNA stem structures are possible, we consider this result valid.

The results clearly indicate that one of the infecting organisms in both cases is E. platys. The minor sequence differences within the 16S rRNA molecules do not allow phylogenetic differentiation between E. platys from China, Thailand, and Venezuela (10). Nevertheless, the few differences in the RNA sequence can be used to develop PCR primers or DNA/RNA probes, subject to a determination of the legitimacy of these differences in the 16S rRNA sequences as outlined above.

The E. equi-specific PCR primers amplified DNA fragments (401 bp) from both dogs. Due to direct sequencing of the PCR products, only 343 bp was available for the comparison to other sequences deposited in the common databases. Our two sequences were found to be identical to each other. With the exception of three positions, the two sequences were identical to the 16S rRNA data deposited in GenBank for E. equi (M73223), HGE agent (AF093788), and E. phagocytophila (M73220).

Based on the secondary structure analysis, these three positions are located within a helix that corresponds to positions 61 to 106 (E. coli J01695 numbering system). This helix is a common structural feature within the Bacteria. However, only portions of the helix (positions 61 to 67 and 101 to 106 and positions 81 to 88) are conserved. The nucleotide positions between those regions, as well as the length of the helix, can vary and are 17, 20, and 21 bp in E. coli, E. equi from Thailand and Venezuela, and the E. equi sequence from GenBank (M73223), respectively. These minor differences are inadequate to distinguish our samples from E. equi (M73223), HGE agent (AF093788), and E. phagocytophila (M73220).

All the sequence differences identified in this study are inadequate to phylogenetically support the presence of a novel Ehrlichia species. Based on 16S rRNA there is so far no meaningful differentiation between the same Ehrlichia species from these geographically divergent locations.

To our knowledge, this study represents the first molecular evidence that E. canis, E. platys, and E. equi infect dogs in Thailand and Venezuela. This study further supports the hypothesis that coinfection with multiple Ehrlichia species occurs in dogs. The extent to which coinfection potentiates disease manifestations or complicates the diagnostic and therapeutic management of sick dogs awaits the results of future studies.


    ACKNOWLEDGMENTS

This research was supported by a grant from Bayer Animal Health, Monheim, Germany.

We are grateful to Parnchitt Nilkhumhang, Professor at the Faculty of Veterinary Medicine, Kasetsart University, Bangkok, Thailand, for providing Thai dog EDTA-blood and sera.


    FOOTNOTES

* Corresponding author. Mailing address: Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, 4700 Hillsborough St., Raleigh, NC 27606. Phone: (919) 513-6234. Fax: (919) 513-6336. E-mail: ed_breitschwerdt{at}ncsu.edu.


    REFERENCES
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References

1. Arraga-Alvarado, C. 1992. Ehrlichiosis canina en Maracaibo, Estado Zulia-Venezuela. Reporte de 55 casos. Rev. Cient. Univ. Zulia 2:41-52.
2. Barton, L. L., J. E. Dawson, G. W. Letson, A. Luisiri, and A. J. Scalzo. 1990. Simultaneous ehrlichiosis and lyme disease. Pediatr. Infect. Dis. 9:127-129.
3. Benson, D. A., I. Karsch-Mizrachi, D. J. Lipman, J. Ostell, B. F. Oulette, B. A. Rapp, and D. L. Wheeler. 2000. GenBank. Nucleic Acids Res. 28:15-18[Abstract/Free Full Text].
4. Breitschwerdt, E. B., B. C. Hegarty, and S. I. Hancock. 1998. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, and Bartonella vinsonii. J. Clin. Microbiol. 36:2645-2651[Abstract/Free Full Text].
5. Dawson, J. E., Y. Rikihisa, A. Ewing, and D. B. Fishbein. 1991. Serologic diagnosis of human ehrlichiosis using two Ehrlichia canis isolates. J. Infect. Dis. 163:564-567[Medline].
6. Dawson, J. E., K. L. Biggie, C. K. Warner, K. Cookson, S. Jenkins, J. F. Levine, and J. G. Olson. 1996. Polymerase chain reaction evidence of Ehrlichia chaffeensis, an etiologic agent of human ehrlichiosis, in dogs from southeast Virginia. Am. J. Vet. Res. 57:1175-1179[Medline].
7. Donatein, A., and F. Lestoguard. 1935. Existance in Algerie dune Rickettsia du chein. Bull. Soc. Pathol. Exot. 28:418-419.
8. Ewing, S. A., and R. G. Buckner. 1965. Manifestations of babesiosis, ehrlichiosis, and combined infections in dogs. Am. J. Vet. Res. 26:815-828[Medline].
9. Ewing, S. A., W. R. Robertson, R. G. Buckner, and C. S. Hayat. 1971. A new strain of Ehrlichia canis. J. Am. Vet. Med. Assoc. 159:1771-1774[Medline].
10. Fox, G. E., J. D. Wisotzkey, and P. Jurtshuk, Jr. 1992. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity. Int. J. Syst. Bacteriol. 42:166-170[Abstract/Free Full Text].
11. Goodman, J. L., C. Nelson, B. Vitale, J. E. Madigan, J. S. Dumler, T. J. Kurtti, and U. G. Munderloh. 1996. Direct cultivation of the causative agent of human granulocytic ehrlichiosis. N. Engl. J. Med. 334:209-215[Abstract/Free Full Text].
12. Harvey, J. W., C. F. Simpson, and J. M. Gaskin. 1978. Cyclic thrombocytopenia induced by a rickettsia-like agent in dogs. J. Infect. Dis. 137:182-188[Medline].
13. Hedenstierna, K. O., J. L. Siefert, G. E. Fox, and E. J. Murgola. 2000. Co-conservation of rRNA tetraloop sequences and helix length suggests involvement of the tetraloops in higher-order interactions. Biochimie 82:221-227[Medline].
14. Hegarty, B. C., M. G. Levy, R. F. Gager, and E. B. Breitschwerdt. 1997. Immunoblot analysis of the immunoglobulin G response to Ehrlichia canis in dogs: an international survey. J. Vet. Diagn. Investig. 9:32-38[Abstract/Free Full Text].
15. Kakoma, I., R. D. Hansen, B. E. Anderson, T. A. Hanley, K. G. Sims, L. Liu, C. Bellamy, M. T. Long, and B. Baek. 1994. Cultural, molecular, and immunological characterization of the etiologic agent for atypical canine ehrlichiosis. J. Clin. Microbiol. 32:170-175[Abstract/Free Full Text].
16. Kordick, S. K., E. B. Breitschwerdt, B. C. Hegarty, K. L. Southwick, C. M. Colitz, S. I. Hancock, J. M. Bradley, R. Rumbough, J. T. Mcpherson, and J. N. MacCormack. 1999. Coinfection with multiple tick-borne pathogens in a Walker Hound Kennel in North Carolina. J. Clin. Microbiol. 37:2631-2638[Abstract/Free Full Text].
17. Madewell, B. R., and D. H. Gribble. 1982. Infection in two dogs with an agent resembling Ehrlichia equi. J. Am. Vet. Med. Assoc. 180:512-514[Medline].
18. Magnarelli, L. A., J. S. Dumler, J. F. Anderson, R. C. Johnson, and E. Fikrig. 1995. Coexistence of antibodies to tick-borne pathogens of babesiosis, ehrlichiosis, and Lyme borreliosis in human sera. J. Clin. Microbiol. 33:3054-3057[Abstract].
19. Nagaswamy, U., N. Voss, Z. Zhang, and G. E. Fox. 2000. Database of non-canonical base pairs found in known RNA structures. Nucleic Acids Res. 28:375-376[Abstract/Free Full Text].
20. Pace, N. R. 1997. A molecular view of microbial diversity and the biosphere. Science 276:734-740[Abstract/Free Full Text].
21. Suksawat, J., B. C. Hegarty, and E. B. Breitschwerdt. 2000. Seroprevalence of Ehrlichia canis, Ehrlichia equi and Ehrlichia risticii in sick dogs from North Carolina and Virginia. J. Vet. Intern. Med. 14:50-55[CrossRef][Medline].
22. Welch, D. F., D. M. Hensel, D. A. Pickett, V. H. San Joaquin, A. Robinson, and L. N. Slater. 1993. Bacteremia due to Rochalimaea henselae in a child: practical identification of isolates in the clinical laboratory. J. Clin. Microbiol. 31:2381-2386[Abstract/Free Full Text].
23. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221-271[Free Full Text].


Journal of Clinical Microbiology, January 2001, p. 90-93, Vol. 39, No. 1
0095-1137/01/$04.00+0   DOI: 10.1128/JCM.39.1.90-93.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Cardozo, G. P., Oliveira, L. P., Mansur, M. A. B., Santos, E. V., Roberto, P. G., Marins, M. (2009). Molecular characterisation of two strains of Anaplasma platys in Brazil. Vet Rec. 164: 338-340 [Full Text]  
  • Sasanelli, M., Paradies, P., Lubas, G., Otranto, D., de Caprariis, D. (2009). Atypical clinical presentation of coinfection with Ehrlichia, Babesia and Hepatozoon species in a dog. Vet Rec. 164: 22-23 [Full Text]  
  • Alberti, A., Zobba, R., Chessa, B., Addis, M. F., Sparagano, O., Pinna Parpaglia, M. L., Cubeddu, T., Pintori, G., Pittau, M. (2005). Equine and Canine Anaplasma phagocytophilum Strains Isolated on the Island of Sardinia (Italy) Are Phylogenetically Related to Pathogenic Strains from the United States. Appl. Environ. Microbiol. 71: 6418-6422 [Abstract] [Full Text]  
  • Parola, P., Cornet, J.-P., Sanogo, Y. O., Miller, R. S., Thien, H. V., Gonzalez, J.-P., Raoult, D., Telford III, S. R., Wongsrichanalai, C. (2003). Detection of Ehrlichia spp., Anaplasma spp., Rickettsia spp., and Other Eubacteria in Ticks from the Thai-Myanmar Border and Vietnam. J. Clin. Microbiol. 41: 1600-1608 [Abstract] [Full Text]  
  • Inokuma, H., Fujii, K., Okuda, M., Onishi, T., Beaufils, J.-P., Raoult, D., Brouqui, P. (2002). Determination of the Nucleotide Sequences of Heat Shock Operon groESL and the Citrate Synthase Gene (gltA) of Anaplasma (Ehrlichia) platys for Phylogenetic and Diagnostic Studies. CVI 9: 1132-1136 [Abstract] [Full Text]  
  • Unver, A., Perez, M., Orellana, N., Huang, H., Rikihisa, Y. (2001). Molecular and Antigenic Comparison of Ehrlichia canis Isolates from Dogs, Ticks, and a Human in Venezuela. J. Clin. Microbiol. 39: 2788-2793 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow An author's correction has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suksawat, J.
Right arrow Articles by Breitschwerdt, E. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suksawat, J.
Right arrow Articles by Breitschwerdt, E. B.