Previous Article | Next Article 
Journal of Clinical Microbiology, October 2001, p. 3649-3655, Vol. 39, No. 10
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.10.3649-3655.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Detection of Ciprofloxacin-Resistant
Yersinia pestis by Fluorogenic PCR Using the
LightCycler
Luther E.
Lindler,*
Wei
Fan, and
Nazma
Jahan
Department of Bacterial Diseases, Division of
Communicable Diseases and Immunology, Walter Reed Army Institute of
Research, Silver Spring, Maryland 20910
Received 7 May 2001/Returned for modification 9 July 2001/Accepted 26 July 2001
 |
ABSTRACT |
We have developed a fluorescence resonance energy transfer
(FRET)-based assay to detect ciprofloxacin resistant (Cpr)
mutants of the biothreat agent Yersinia pestis. We
selected spontaneous mutants of the attenuated Y. pestis
KIM 5 strain that were resistant to a ciprofloxacin (CIP)
concentration of at least 1 µg/ml. DNA sequencing of
gyrA encoded by 65 of these mutants revealed that all
isolates contained one of four different point mutations within the
quinolone resistance-determining region of gyrA. We
developed a FRET-based assay that detected all of these mutations by
using a single pair of fluorescent probes with sequences complementary
to the wild-type Y. pestis gyrA sequence. Melting peak
analysis revealed that the probe-PCR product hybrid was less stable
when amplification occurred from any of the four mutant templates. This
instability resulted in the PCR product obtained from the
Cpr Y. pestis strains displaying a 4 to
11°C shift in probe melting temperature. Following optimization of
the reaction conditions, we were able to detect approximately 10 pg of
purified wild-type template DNA or the presence of approximately 4 CFU
of wild-type Y. pestis KIM 5 or Cpr mutants
in crude lysates. Taken together, our results demonstrate the utility
of FRET-based assays for detection of Cpr mutants of
Y. pestis. This method is both sensitive and rapid.
 |
INTRODUCTION |
Resistance to antibiotics has become
a major concern for the medical community over the past several years
(13, 14, 16). Many organisms have become resistant to the
common "drug of choice" used to treat the disease. A few examples
are methicillin-resistant Staphylococcus aureus,
vancomycin-resistant enterococci (18), and
multiple-drug-resistant Mycobacterium tuberculosis
(19), as well as organisms causing many enteric
diseases. One of the current antibiotics that is effective in treating
bacterial infectious diseases is ciprofloxacin (CIP), a fluorinated
quinolone that blocks DNA replication through inhibition of gyrase
activity (2, 24). Resistance to CIP does occur and is
usually mediated by point mutations in DNA gyrases or, less commonly,
through membrane alterations that reduce drug entry into the bacteria
(28).
A critical piece of information necessary for the treatment of any
bacterial disease is the antibiotic sensitivity profile of the
infectious agent. Classically the sensitivity profile has been
determined by growth of the organism in the presence of the antibiotic
either in agar diffusion assays or by incubation of the organism in
various concentrations of the drug for determination of the MIC. Both
of these methods depend on growth of the bacterium after its initial
isolation and are therefore time-consuming. DNA probe-based detection
of antibiotic resistance offers the potential for increased speed.
Among DNA-based techniques, PCR offers the best opportunity for speed,
sensitivity, and specificity.
Recently it has become possible to couple PCR with real-time detection
of the amplification product by use of fluorescent probes, thus
eliminating the necessity to analyze the reaction product by gel
electrophoresis. Fluorescence resonance energy transfer (FRET) is one
of the available chemistries that can be used to detect the PCR
product in these reactions. Roche Diagnostics has adopted this
chemistry for its "Hybridization Probes" technology (5). Two DNA probes are used to bind to the amplification
product when FRET chemistry is used to specifically detect the
amplification product. The two light-activated molecules are positioned
in close proximity at the 3' and 5' termini of the probes such that
fluorescence increases as more PCR product accumulates and the two
labeled probes bind next to each other.
The increase in antibiotic resistance coupled with the threat of
modification of agents of biological warfare have prompted us to
develop a hybridization probe assay for the detection of CIP resistance
(Cpr) in Yersinia pestis. We chose
Y. pestis as a model for our initial development of a
Cpr assay for three reasons. First, it is the
etiologic agent of a disease that has high potential for use as a
biological terrorism or biological warfare agent (27).
Second, it is likely that any biological used as a weapon would be made
antibiotic resistant. Third, Y. pestis is relatively slow
growing, and therefore the increased speed of DNA-based antibiotic
resistance detection would improve our ability to properly treat
infected individuals. Although our development of the assay used
Y. pestis as a model, the method should be broadly
applicable to the detection of antibiotic resistance encoded by point
mutations in other organisms.
 |
MATERIALS AND METHODS |
Cultivation of bacteria, isolation of Cpr mutants,
and antibiotic sensitivity testing.
The bacterium used in this
study was an avirulent, pigmentation-negative
(pgm-negative) mutant of Y. pestis KIM 5 and was obtained from Susan Straley, Department of Microbiology and
Immunology, University of Kentucky, Lexington, Ky. Bacteria were grown
on brain heart infusion agar (BHI; Difco Laboratories, Detroit, Mich.) plates for 48 h at 30°C or overnight in BHI broth at 30°C with aeration. After cultivation, the bacteria were collected, washed twice
with phosphate-buffered saline (150 mM NaCl, 1.7 mM
KH2PO4, 5 mM
Na2PO4 [pH 7.4]) and
suspended to yield a concentration of 1011
CFU/ml. For selection of Cpr mutants, a 100-µl
sample of washed bacteria was plated on BHI agar plates containing 1 to
10 µg of CIP (Bayer, Leverkusen, Germany)/ml. Cpr mutants appeared after 48 to 72 h of
incubation at 30°C. Colonies were purified by streaking on fresh BHI
agar plates containing the appropriate concentration of CIP. The MIC
for CIP was determined by using E Test (AB Biodisk, Piscataway,
N.J.) antibiotic strips containing a continuous gradient of CIP. The E
Test was performed by spreading 100 µl of bacterial culture onto BHI
agar plates without antibiotic. After 48 h of incubation at
30°C, the MIC was read according to the manufacturer's instructions.
DNA isolation, gene amplification, and sequencing.
Total-cell DNA was extracted from 5-ml cultures of Y. pestis
or Cpr mutants with the Puregene DNA Isolation
Kit (Gentra Systems, Minneapolis, Minn.). Initially primers to amplify
the quinolone resistance-determining region (QRDR) (30) of
gyrA were selected from the published Escherichia
coli sequence (GenBank accession number AE000312) (3)
using Primerselect software (Lasergene, Madison, Wis.). PCR
amplification primers gyrA51 and gyrA31 were ATGAGCGACCTTGCGAGAG
and TGTTCCATCAGCCCTTCAATG, respectively. We used PCR
and direct DNA sequencing to identify Y. pestis gyrA mutations. PCR was carried out with AmpliTaq Gold (Perkin-Elmer, Foster
City, Calif.) according to the manufacturer's directions. Initial activation of AmpliTaq Gold and denaturation of template DNA
were carried out at 95°C for 10 min, followed by 30 cycles of 95°C
for 30 s, 55°C for 30 s, and 72°C for 1 min, with a final extension step of 72°C for 7 min. Amplification products were examined for size and purity by fractionation of a 10-µl sample on
1.5% agarose gels or 10% polyacrylamide gels (Novex Corporation, San
Diego, Calif.). PCR products were purified for automated DNA sequencing
with a QIAquick PCR Purification Kit (Qiagen, Valencia, Calif.).
Nucleotide sequence determination was performed by the dideoxy
chain-termination method using the Applied Biosystems International
(ABI, Foster City, Calif.) PRISM dichloRhodamine Dye Terminator
Sequencing Kit with AmpliTaq DNA polymerase. DNA sequencing reactions
were analyzed on an ABI 377XL automated DNA sequencher. Sequence data
were edited and assembled into contiguous sequences using the
Sequencher program (Gene Codes, Ann Arbor, Mich.). The Y. pestis KIM 5 wild-type gyrA nucleotide sequence was
determined using the gyrA51 and gyrA31 primers used in the initial PCR.
The DNA sequences of the mutant gyrA genes were determined using oligonucleotide primers gyrA51seq and gyrA31seq, which had the
sequences AAATAACACCGGTCAACATC and
ATATAAGCCAGACAGCCATCA, respectively. Template DNA for
sequencing of the Y. pestis gyrA mutants was prepared by
using 2.5-µl boiled overnight bacterial culture as the template in a
50-µl PCR mixture with gyrA51 and gyrA31 as the primers. The
purified PCR product obtained from the mutants was
sequenced as described above for wild-type Y. pestis
gyrA.
The QRDR regions of Y. pestis gyrB and parC were
amplified using oligonucleotide primer pairs GyrB51
(TCGAATTCTTATGACTCCTCCAG)-GyrB31 (CAATACCGTCTTTTTCAGTGGAG) and ParC53
(GACCGTGCGTTGCCGTTTATTGG)-ParC39 (TTGGCTAAGTGGCGGAGTTTC). These primers were selected by
using the E. coli GyrB (GenBank accession number
P06982) and ParC (P20083) protein sequences (3) to
search the Y. pestis CO92 genome database at
http://www.sanger.ac.uk/Projects/Y_pestis/blast_server.shtml (1). Contiguous sequences that could encode proteins 78%
identical to GyrB and 80% identical to ParC over the entire length of
the E. coli proteins were found in the Y. pestis
CO92 genome database. The contiguous DNA sequences from the genome
database were used to obtain the potential coding regions for Y. pestis KIM 5 GyrB and ParC.
FRET probe detection of Cpr mutants.
Y.
pestis Cpr mutants were detected using
hybridization probe (FRET) reactions with the LightCycler (Roche
Diagnostics, Mannheim, Germany). The primers for hybridization probe
reactions were LC3 (GATTATGCGATGTCCGTTATTGTC) and LC4
(GAAGTTACCCTGCCCATCCAC). Primers LC3 and LC4 were designed
using Primerselect (Lasergene). Sequence-specific hybridization probes
were probe 1 (GCATGGTGACAGCGCGGTC-fluorescein) and probe 2 (Lightcycler Red
640-ACGACACTATCGTGCGTATGGCCCA-PO4). The probes were chosen using Primerselect (Lasergene) software according to the guidelines suggested by Roche Diagnostics. Operon Technologies, Inc. (Alameda, Calif.), or Synthegen LLC (Houston, Tex.)
synthesized the fluorescent-labeled FRET probes. Mutant sequence
detection was performed with primers LC3 and LC4 plus probe 1 and probe
2 and the Roche Diagnostics DNA Master Hybridization Probes kit. The
optimized reaction mixture contained template DNA in 2 µl of water, 5 mM MgCl2, 1 µM primers LC3 and LC4, 0.4 µM
(each) probe1 and probe2, and 1× LightCycler DNA Master Hybridization Probes buffer, according to the manufacturer's directions (Roche Diagnostics). Crude lysates of Cpr mutants were
analyzed by a simple growth and boiling procedure. A 2-µl portion of
the clarified supernatant obtained from crude boiled lysates was used
as a template in the hybridization probe Cpr
detection assay as described above. All PCRs were performed on a
LightCycler (Roche Diagnostics) using channel F2 (640 nm). The Y. pestis gyrA target sequences were amplified by a single incubation at 95°C for 1 min, followed by 40 cycles of 95°C for 0 s,
58°C for 15 s, and 72°C for 15 s. The melting curve for
the annealing of the PCR product with the FRET probes was determined by
monitoring the fluorescence of channel F2 from 40 to 95°C with a
temperature transition rate of 0.1°C per s. Lightcycler amplification
results were verified by electrophoresis of 10 µl of the PCR product
on 1.5% agarose gels. Data were analyzed with LightCycler software, version 3.1, according to the manufacturer's instructions.
Nucleotide sequence accession numbers.
The DNA sequences of
wild-type Y. pestis KIM 5 and of the four examples of
Y. pestis KIM 5 Cpr gyrA
point mutants have been deposited in GenBank and assigned accession
numbers AF217736 through AF217740. The Y. pestis gyrB and
parC sequences have been given GenBank accession numbers AF221694 and AF221695, respectively. To promote ease of analysis and
comparison with previous studies, we have adopted the convention of
using the E. coli GyrA (GenBank accession number P09097)
numbering throughout this paper when referring to specific amino acid residues.
 |
RESULTS |
Isolation of Cpr Y. pestis mutants.
We performed 11 independent experiments to isolate
Cpr mutants. The average mutation frequency
observed for all of these experiments was 2.6 × 10
10. These mutant isolations resulted in 682 Cpr Y. pestis KIM 5 strains. We chose
65 mutants at random for further single-colony isolation and
characterization. We performed initial experiments to determine the
influence of plating cell density on the CIP MIC observed by using E
Test antibiotic sensitivity strips. Inoculation of BHI agar plates with
approximately 107 or 108
cells produced MICs that were similar to each other. However, inoculation of BHI agar plates for the E Test with cell concentrations above or below 107 or 108
CFU produced significantly higher or lower observed MICs, respectively. Accordingly, we chose to plate Y. pestis KIM 5 at
107 CFU per plate in order to determine the
observed MIC for CIP in all later experiments. Our observed CIP MIC for
the wild-type Y. pestis strain KIM 5 was 0.026 µg/ml. For
all the Cpr mutants, MICs at least 40 times
greater than that for the wild type, i.e., between 1.1 and 4.6 µg/ml,
were observed (Fig. 1B).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Nucleotide sequence and protein changes in Y.
pestis Cpr mutants. (A) DNA sequences of wild-type
(WT) Y. pestis gyrA and the four point mutants,
identified as M1 through M4, corresponding to their designations in the
text. Underlined nucleotides in the WT sequence denote the FRET assay
probe 1. Nucleotide substitutions in mutants M1 through M4 are
boldfaced and underlined. Amino acid substitutions and the position
relative to E. coli GyrA (3)
are given on the right. (B) Amino acid changes, isolation frequency,
and CIP MIC for the various Cpr mutants. Amino acid
numbering (67 to 106) is relative to the E. coli GyrA
sequence (3) and is indicated to the left and right of the
sequence. Boldfaced, underlined letters indicate amino acid changes in
the QRDR of E. coli GyrA that have been shown to result
in Cpr. MICs for the Y. pestis mutants
determined by duplicate E Tests in five independent experiments are
shown as averages with standard deviations in parentheses. Amino acid
changes for mutants M1 through M4 are shown as boldfaced letters below
the corresponding positions in the E. coli QRDR.
|
|
Sequencing of wild-type Y. pestis and
Cpr mutants.
We obtained a single, approximately
630-bp fragment of DNA from the Y. pestis KIM 5 genome using
oligonucleotide primers gyrA51 and gyrA31 in PCRs. After determination
of the sequence of this fragment on both strands of DNA, a BLASTN
(1) search of GenBank (http://www.ncbi.nlm.nih.gov/blast/blast.cgi) revealed that our sequence had a high degree of homology (probability value,
1e
137) with Serratia
marcescens gyrA (GenBank accession number AF052260) (26). The final 492-bp Y. pestis KIM 5 gyrA sequence was 88% identical to S. marcescens
gyrA at the nucleotide level, suggesting that it was the plague
homologue of the gyrase A gene. Further evidence was obtained by
performing protein searches of the nonredundant GenBank database. The
protein database search revealed that the putative protein product
translated from our DNA sequence was 96% identical over a
164-amino-acid overlap with S. marcescens GyrA (AAC68576)
(26) as well as many other E. coli GyrA
homologues. Our analysis of the predicted Y. pestis KIM 5 GyrA sequence obtained from the PCR product using Megalign (Lasergene)
revealed that the nucleotide sequence changes encoded six conservative
amino acid substitutions compared to S. marcescens GyrA. Our
results revealed that the Y. pestis KIM 5 GyrA sequence
within the QRDR was identical to that of E. coli.
Accordingly, we designated our sequence Y. pestis gyrA.
We amplified the DNA encoding the QRDR from all of the
Cp
r Y. pestis mutants we isolated
using the gyrA51-gyrA31 primer pair.
The DNA sequences for each of
these mutants were determined on
both strands using oligonucleotide
primers gyrA51seq and gyrA51seq.
Each of the mutants revealed a
single-nucleotide change in the
QRDR of
gyrA, and these
substitutions belonged to one of four
groups (Fig.
1A). The
largest group of mutants isolated had a
transition of guanine to
adenine such that Gly-81 (relative to
E. coli numbering,
GenBank accession number
P09097) was changed
to Asp in that position
(mutant M1 in Fig.
1). The smallest group
of mutants had a guanine
altered to a thymine such that Gly-81
was changed to Cys (mutant M2 in
Fig.
1). The final two groups
of mutants were found in equal numbers as
shown in Fig.
1. We
identified mutations in
Y. pestis gyrA
that were guanine-to-thymine
transversions. These mutants coded for an
Ile residue at position
83 instead of the Ser residue in the wild-type
protein sequence
(mutant M3 in Fig.
1). The last group of mutants had a
transversion
of cytosine to adenine such that amino acid Ser-83
was changed
to Arg (mutant M4 in Fig.
1). The position of the amino
acid substitution
encoded by the mutant did not correlate with the
level of Cp
r, since we observed MICs of
approximately 1 and 4 µg/ml for strains
with mutations at either
codon 81 or codon 83 within
gyrA (Fig.
1B).
Since other gene products such as GyrB (
8,
12,
31) and
ParC (
6,
11,
20) have been shown to be involved in
resistance
to CIP, we amplified the QRDRs of these genes from a
randomly
selected group of our Cp
r mutants and
compared the DNA sequences for both
Y. pestis KIM
5
gyrB and
parC. The DNA sequences of the wild type
Y. pestis KIM 5 g
yrB and
parC loci
were determined as described in Materials
and Methods. In order to
confirm that the genes we amplified did
encode the expected proteins,
our nucleotide sequences were translated
into predicted proteins and
used to search the GenBank protein
database. The protein product
predicted by translation of the
wild-type
Y. pestis gyrB
sequence was highly homologus (probability
value,
1
e
102) with
E. coli GyrB
(AAC76722) (
3). The entire protein sequence
predicted by
translation of
Y. pestis KIM 5
parC was 86%
identical
with the
E. coli ParC sequence (
P20082)
(
3), amino acids
12 through 394. Accordingly, the putative
function of the proteins
encoded by our PCR product obtained after
Y. pestis gyrB and
parC amplification was
confirmed by protein homologies in the database.
The DNA sequence of
gyrB carried by 12 of our 65
Y. pestis
Cp
r mutants was determined from randomly selected
strains regardless
of observed MIC and was found to be identical with
the wild-type
sequence. Similarly, the
parC sequence
encoding the QRDR was determined
for 36 of the 65 Cp
r mutants and was found to be identical to the
wild-type DNA
sequence.
Amplification and detection of gyrA in the
LightCycler.
We designed PCR primers and hybridization probes for
detection of Y. pestis KIM 5 gyrA as shown in
Fig. 2. Oligonucleotide primers LC3 and
LC4 were designed to amplify a 261-bp region of gyrA that
included all of the point mutations within the QRDR we had detected in
our Cpr mutant isolation (Fig. 1). As shown in
Fig. 2, the FRET detection probe 1 was chosen to have the same sequence
as wild-type Y. pestis gyrA and to encompass all four of the
point mutations within the gene that resulted in
Cpr. FRET probe 2 was selected such that the 5'
end of the oligonucleotide containing the LightCycler-Red-640 label was
positioned 1 bp away from the probe 1 3' end (Fig. 2). The predicted
melting temperatures (Tm) for probe 1 and
probe 2 were 59.6 and 64.9°C, respectively. We reasoned that we would
be able to detect the mutant genes through melting curve analysis by
using a single probe, since probe 1 was based on the wild-type allele
and included the region where all of the Cpr
point mutations occurred in gyrA.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Schematic representation of the hybridization probe
assay for Cpr in Y. pestis. PCR primers are
represented by arrows above or below the Y. pestis gyrA
sequence and are labeled LC3 and LC4. Probe 1 and probe 2 are shown
between LC3 and LC4. The starbursts at the 3' and 5' termini of probe 1 and probe 2, respectively, indicate light reactive labels. Probe 1 is
homologous with the wild-type Y. pestis gyrA sequence.
The positions of the four point mutations described in Fig. 1A are
indicated (boldfaced, underlined letters) in the wild-type DNA sequence
below probe 1. The Tm of probe 1 was
chosen to be less than that of probe 2 such that detection of melting
of the probes from the PCR product would be dependent on the stability
of probe 1 with the product.
|
|
We tested the ability of the hybridization probe assay to detect
Y. pestis gyrA sequences using purified genomic DNA as a
template. Melting peak analysis revealed that the change in
fluorescence
with the change in time versus temperature was also
proportional
to the amount of template DNA used in the reaction (Fig.
3). The
ability to detect a change in
fluorescence signal above background
(no template controls) was
proportional to the template concentration
(Fig.
3). The hybridization
probe assay was routinely able to
detect
Y. pestis gyrA
sequences at concentrations of 10 pg of
genomic DNA per reaction. Using
a
Y. pestis KIM 5 genome size
of 4.4 Mbp (
17),
we calculate that our lower limit of detection
of
gyrA is
approximately 2,100 genomic equivalents using purified
DNA as a
template in the reaction. We found that a single product
of
approximately 261 bp (Fig.
3, inset) was amplified in a template
concentration-dependent manner similar to that seen on the FRET
probe
assay.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 3.
Sensitivity of the hybridization probe CIP assay. The
graph shows the melting peak analysis of the probe-PCR product hybrid
as the change in fluorescence with the change in time
(dF/dT) versus hybrid temperature at the
various DNA concentrations. The 0.001-ng template reaction mixture was
indistinguishable from the no-template control (water). NTC,
no-template control.
|
|
FRET probe detection of Cpr gyrA DNA
sequences.
Using the FRET probe assay, we were able to
differentiate Y. pestis KIM 5 gyrA mutants
(Cpr) from wild-type (Cps)
organisms. As shown in Fig. 4, the
melting peak temperature was dependent on the homology between probe 1 and the amplified PCR product. All of the mutant PCR products formed a
less-stable hybrid with probe 1 than did the wild-type gyrA
sequence. The largest difference in melting peak was seen with the
cytosine-to-adenosine mutation (M4 in Fig. 1A), which was closest to
the 3' fluorescein label on probe 1. Interestingly, the most-stable
probe1-mutant PCR product hybrid was formed with the guanine-to-thymine
transversion mutant (Fig. 1A and 4). This mutation was located 1 bp 5'
to the mutation in the strain that formed the least-stable hybrid with probe 1 (M3 in Fig. 1A). However, the two mutations that were the most
distal to the 3' end of probe 1 (M1 and M2 in Fig. 1A) had an
intermediate Tm. The mutant
gyrA-probe1 Tm was easily
differentiated from those generated with wild-type templates. The
minimum Tm decrease compared to that for
the wild-type sequence was with mutant M3, for which the
Tm was consistently 4°C (Fig. 4). The maximum Tm shift compared to Y. pestis KIM 5 was greater than 11°C for the
M4 mutant. Furthermore, we found the Tm of
the melting peaks to be consistent between experiments. We performed
five independent Tm determinations for all
four mutants and the wild-type organism. The maximum standard deviation
of the melting peak temperature obtained for each of these mutants from
these experiments was 0.93°C. In all experiments the
Tm (defined as the
Tm of the wild type
the
Tm of the mutant) was also consistent and
varied less than 0.5°C.

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 4.
FRET assay for Cpr detection using purified
template DNA of mutant and wild-type Y. pestis.
Wild-type and mutant templates were used in the PCR amplification
followed by melting peak analysis. The graph is of the change in
fluorescence as a function of time
(dF/dT) versus the temperature of the
reaction products. The templates used in the various reactions are
given in the key. Mutant designations in parentheses are as shown in
Fig. 1A. All mutant templates produced a lower
Tm than did the 100% match between
probe 1 and the wild-type template. The template concentration was 10 µg/ml for all reactions.
|
|
Colony assay for Cpr Y. pestis
In
order to test the utility of our FRET assay for identification of
Cpr Y. pestis, we performed the assay on
crude lysates of bacteria. Initially, we used boiled lysates from a
single colony suspended in 100 µl of water as the template in these
reactions without any further growth of the cells. We found that we
could identify the Cpr mutants in dilutions up to and
including 1,000-fold (data not shown). The minimum number of CFU we
could detect in our initial FRET PCRs was approximately 500. Since our
goal was to develop our assay to cover as wide a range of template
concentrations as possible, we tested the effect of growing the
bacteria for a short time in liquid culture on the sensitivity of the
assay. We found that growth for only 3 h in BHI broth allowed us
to detect the presence of Y. pestis gyrA at dilutions up
to 10,000-fold as shown in Fig. 5. This
result represented an approximately 100-fold increase over reactions
performed on suspended bacteria that were not allowed to replicate
before analysis by the FRET assay. The FRET PCR generated from the
10
4 dilution of bacteria (Fig. 5) contained the
equivalent of approximately 4 CFU of Y. pestis. Use of
crude lysates as template DNA resulted in melting peak shifts for the
Cpr mutants that were similar to those seen with purified
templates. The data shown in Fig. 5 are for the wild-type
gyrA allele and mutant M4. Mutants M1, M2, and M3 all
displayed melting peak temperature shifts similar to those shown in
Fig. 4 (data not shown). Dilutions of cell suspensions greater than
10
4 resulted in melting peaks that could not be
distinguished from those for negative controls. In order to compare
melting peak analysis results with the amount of PCR product produced,
we analyzed a 10-µl sample of the Y. pestis KIM 5 reaction products on agarose gels. We did not detect any
gyrA PCR product in the reaction products produced with
the 10
5 and 10
6 dilutions (data not shown).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 5.
Detection of Cpr mutations in crude
whole-cell lysates. Single colonies were grown in broth for 3 h at
30°C before being harvested. Shown is a melting peak analysis of
various concentrations of wild-type Y. pestis or
Cpr mutant M4. Bacteria used in the reactions are given
above each melting peak. Curves obtained with each dilution are
labeled. The sample labeled "undil." represents the reaction
obtained with undiluted bacterial suspensions. The 2-µl sample used
in the FRET PCR labeled "undil." contained 4 × 104 CFU. Suspensions of bacteria were diluted before lysis
by boiling to simulate different concentrations of organisms that might
be obtained after the 3-h growth period. The curve labeled "water"
represents the no-template control sample.
|
|
 |
DISCUSSION |
Although Cpr in Y. pestis is
currently of no concern to public health officials, the organism is of
major concern as a potential agent for biological warfare or
bioterrorism (27). Given that CIP is a new-generation
antibiotic under consideration for inclusion in a national antibiotic
stockpile (9), a rapid method for the detection of
Cpr agents of bioterrorism is highly desirable.
We have developed a simple and rapid PCR assay to detect
Cpr using FRET probes and the Roche Diagnostics
LightCycler. The assay was able to detect four different point
mutations within Y. pestis KIM 5 gyrA using a
single probe pair with as few as approximately 2,100 copies of purified
target sequence. Cpr Y. pestis could
also be detected in crude lysates prepared from fresh colonies isolated
on petri plates at levels below 10 CFU per reaction. The difference in
detection level between pure and crude templates is most likely due to
the tendency of Y. pestis to grow as chains under culture
conditions similar to those used here (L. E. Lindler, unpublished
data). Using our assay, we were able to determine if the bacteria
growing on solid medium were Cpr within 4 h
using melting peak analysis. Furthermore, the FRET assay was able to
reliably identify Cpr Y. pestis at CFU
concentrations of 4 to 40,000 per reaction. This finding is
particularly important if the method is to be useful in a clinical
laboratory, since the assay will identify Cpr
bacteria over a wide range of template concentrations, thus reducing the possibility of false-negative reactions.
Given that FRET depends on the interaction of two fluorochromes in
proximity with each other, it might be expected that the location of
the base mismatch within probe 1 would strongly influence the melting
peak. However, our results indicate that the position of the mismatch
within probe 1 does not greatly influence this stability. This fact was
suggested by our observation that mutant M4 and M3 produced the largest
and smallest Tm values in our FRET assay
and were located only 1 bp apart. The stability of these mutant
templates was especially noteworthy, since M3 and M4 are located
nearest the 3' terminus of probe 1 and therefore might be expected to
decrease the excitation of probe 2. If the position of the mismatch
within the probe 1 sequence were a major factor in probe-template
stability, then mutants M1 and M2 (Fig. 1A) might be expected to reduce
the observed Tm to a lesser degree than
mutant M3. However, the melting peaks of M1, M2, and M3 were very
similar, further suggesting that the position of the mismatch did not
influence probe 1 binding to the PCR product to any great degree. Taken
together, our results suggest that the greatest influence on the
observed melting peak using the FRET assay is due to the sequence of
the base pair mismatch rather than the position of the mismatch within
the donor probe.
Currently, the standard method of determining Cpr
is by agar diffusion tests. This method requires the isolation of the
pathogen followed by an extra day of incubation with disks or strips.
DNA-based methods for Cpr detection, such as
mismatch amplification mutation assay (MAMA) combined with DNA
sequencing (32) and single-stranded confirmation polymorphism (23), have been developed. All of these
methods require electrophoresis of reaction products to determine if a mutant allele of a cellular gyrase is encoded by the isolate. Also,
both of the techniques above require equipment that does not easily
lend itself to use in a clinical laboratory environment. Most recently,
Wilson et al. (29) developed a 5' nuclease assay to detect
Cpr in Campylobacter jejuni by PCR
allelic discrimination (AD). These researchers were able to distinguish
mutations at codon 86 by use of a pair of fluorescent probes and
comparison of binding of those probes with either mutant or wild-type
PCR products. Although this assay was shown to be sensitive to the
femtogram level of template DNA, it has not been tested for the ability to distinguish Cpr mutants from sensitive strains
using crude whole-cell lysates as we have demonstrated here.
Furthermore, we believe the FRET-based assay is more applicable because
the use of a single pair of FRET probes allows the detection of four
different linked point mutations in gyrA. In contrast,
detection of the point mutations described here would require at least
five different probes to be developed for an AD assay, assuming that
one wild-type probe could be paired with a probe that binds to each
individual point mutation in gyrA.
The mutations in Y. pestis gyrA all occurred at position 81 or 83 relative to the E. coli protein sequence. Although we
did not determine the sequences of gyrB and parC
for every Cpr mutant we identified, our random
sampling of these gene sequences suggests that they were most probably
wild type in the mutants we characterized. Specifically, the observed
MICs for all of the individual members of our four mutant classes were
similar, and secondary alterations in gyrB and/or
parC have been shown to result in increased levels of
Cpr (7, 11, 20). Taken together, our
random DNA sequencing of known secondary mutation sites and our MIC
data strongly suggest that the Y. pestis
Cpr strains we characterized did not encode
mutations in the gyrB and/or parC QRDR.
Six different amino acid substitutions in E. coli GyrA have
been identified in Cpr strains following in vitro
selection (4, 10, 22, 30). Among our 65 Y. pestis Cpr mutants we found only two amino
acid positions in GyrA that had been changed. The substitutions in
Y. pestis GyrA were Gly-81 to Asp or Cys and Ser-83 to Ile
or Arg. All of the amino acid substitutions we identified in Y. pestis GyrA have been found in other organisms (4, 15, 20,
23, 25, 30). Based on the results of our characterization of 65 Y. pestis Cpr mutants, the most common
site of mutation in GyrA is Gly-81. Other studies have indicated that
Ser-83 is the most common hotspot for changes in gyrA that
result in Cpr (7, 11, 20, 21, 23,
30). The fact that Gly-81 appears to be a hotspot for mutation
in Y. pestis may reflect a difference in the organism's DNA
repair capabilities or a difference in the tertiary structure of GyrA.
Alternatively, this finding may be due to the limited number of
Cpr isolates we characterized.
In summary, we have developed a pair of FRET probes that can easily
detect four closely linked point mutations in Y. pestis gyrA
by use of melting peak analysis. This FRET-based
Cpr detection method is sensitive, reproducible,
and applicable over a wide range of template concentrations. In order
for this assay to be useful in a clinical laboratory setting, it should
be possible to perform the analysis as quickly after initial isolation
of the organism as possible. We have demonstrated that this is possible by use of crude whole-cell lysates as templates in our reactions. Further testing of specificity is planned for future experiments. However, currently we envision that the FRET assay described here could
be incorporated into a general DNA-based identification panel that
would include Y. pestis-specific primers. Accordingly, it
may be possible in the future to identify organisms and determine their
antibiotic sensitivity profiles simultaneously. The development of our
FRET-based Cpr assay is a first step toward this goal.
 |
ACKNOWLEDGMENTS |
We thank Peter Schwartz for technical assistance. We also
gratefully acknowledge the support of Erik Henchal.
This work is part of the U.S. Army Medical Research and Material
Command Research Area Director IV sponsored programs.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Bacterial Diseases, WRAIR, 503 Robert Grant Ave., Silver Spring, MD
20910. Phone: (301)-319-9388. Fax: (301) 319-9123. E-mail:
Luther.Lindler{at}na.amedd.army.mil.
 |
REFERENCES |
| 1.
|
Altschul, S. F.,
W. Gish,
W. Miller,
E. W. Myers, and D. J. Lipman.
1990.
Basic local alignment search tool.
J. Mol. Biol.
215:403-410[CrossRef][Medline].
|
| 2.
|
Balfour, J. A., and D. Faulds.
1993.
Oral ciprofloxacin: a pharmacoeconomic evaluation of its use in the treatment of serious infections.
Pharmacoeconomics
3:398-421[Medline].
|
| 3.
|
Blattner, F. R.,
G. Plunkett III,
C. A. Bloch,
N. T. Perna,
V. Burland,
M. Riley,
J. Collado-Vides,
J. D. Glasner,
C. K. Rode,
G. F. Mayhew,
J. Gregor,
N. W. Davis,
H. A. Kirkpatrick,
M. A. Goeden,
D. J. Rose,
B. Mau, and Y. Shao.
1997.
The complete genome sequence of Escherichia coli K-12.
Science
277:1453-1474[Abstract/Free Full Text].
|
| 4.
|
Cambau, E.,
F. Bordon,
E. Collatz, and L. Gutmann.
1993.
Novel gyrA point mutation in a strain of Escherichia coli resistant to fluoroquinolones but not to nalidixic acid.
Antimicrob. Agents Chemother.
37:1247-1252[Abstract/Free Full Text].
|
| 5.
|
Caplin, B. E.,
R. P. Rasmussen,
P. S. Bernard, and C. T. Wittwer.
1999.
LightCycler hybridization probes: the most direct way to monitor PCR amplification for quantitation and mutation detection.
Biochemica
1:5-9.
|
| 6.
|
Chu, Y. W.,
E. T. Houang, and A. F. Cheng.
1998.
Novel combination of mutations in the DNA gyrase and topoisomerase IV genes in laboratory-grown fluoroquinolone-resistant Shigella flexneri mutants.
Antimicrob. Agents Chemother.
42:3051-3052[Free Full Text].
|
| 7.
|
Deguchi, T.,
A. Fukuoka,
M. Yasuda,
M. Nakano,
S. Ozeki,
E. Kanematsu,
Y. Nishino,
S. Ishihara,
Y. Ban, and Y. Kawada.
1997.
Alterations in the GyrA subunit of DNA gyrase and the ParC subunit of topoisomerase IV in quinolone-resistant clinical isolates of Klebsiella pneumoniae.
Antimicrob. Agents Chemother.
41:699-701[Abstract].
|
| 8.
|
Gensberg, K.,
Y. F. Jin, and L. J. Piddock.
1995.
A novel gyrB mutation in a fluoroquinolone-resistant clinical isolate of Salmonella typhimurium.
FEMS Microbiol. Lett.
132:57-60[CrossRef][Medline]. (Erratum, 137:293, 1996.)
|
| 9.
|
Grabenstein, J.,
K. Downs, and D. Dotson.
2000.
Extraordinary infections: a focus on bioterrorism.
J. Am. Pharm. Assoc. (Washington, D.C.)
40:S36-S37.
|
| 10.
|
Hallett, P., and A. Maxwell.
1991.
Novel quinolone resistance mutations of the Escherichia coli DNA gyrase A protein: enzymatic analysis of the mutant proteins.
Antimicrob. Agents Chemother.
35:335-340[Abstract/Free Full Text].
|
| 11.
|
Heisig, P.
1996.
Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli.
Antimicrob. Agents Chemother.
40:879-885[Abstract].
|
| 12.
|
Heisig, P.
1993.
High-level fluoroquinolone resistance in a Salmonella typhimurium isolate due to alterations in both gyrA and gyrB genes.
J. Antimicrob. Chemother.
32:367-377[Abstract/Free Full Text].
|
| 13.
|
Jack, D. B.
1996.
Drug-resistant bacteria: responding to the infectious disease crisis.
Mol. Med Today
2:499-502[CrossRef][Medline].
|
| 14.
|
Jones, R. N., and M. A. Pfaller.
1998.
Bacterial resistance: a worldwide problem.
Diagn. Microbiol. Infect. Dis.
31:379-388[CrossRef][Medline].
|
| 15.
|
Korten, V.,
W. M. Huang, and B. E. Murray.
1994.
Analysis by PCR and direct DNA sequencing of gyrA mutations associated with fluoroquinolone resistance in Enterococcus faecalis.
Antimicrob. Agents Chemother.
38:2091-2094[Abstract/Free Full Text].
|
| 16.
|
Koshland, D. E., Jr.
1994.
The biological warfare of the future.
Science
264:327[Free Full Text].
|
| 17.
|
Lucier, T. S., and R. R. Brubaker.
1992.
Determination of genome size, macrorestriction pattern polymorphism, and nonpigmentation-specific deletion in Yersinia pestis by pulsed-field gel electrophoresis.
J. Bacteriol.
174:2078-2086[Abstract/Free Full Text].
|
| 18.
|
Michel, M., and L. Gutmann.
1997.
Methicillin-resistant Staphylococcus aureus and vancomycin-resistant enterococci: therapeutic realities and possibilities.
Lancet
349:1901-1906[CrossRef][Medline].
|
| 19.
|
Moss, A. R.,
D. Alland,
E. Telzak,
D. Hewlett, Jr.,
V. Sharp,
P. Chiliade,
V. LaBombardi,
D. Kabus,
B. Hanna,
L. Palumbo,
K. Brudney,
A. Weltman,
K. Stoeckle,
K. Chirgwin,
M. Simberkoff,
S. Moghazeh,
W. Eisner,
M. Lutfey, and B. Kreiswirth.
1997.
A city-wide outbreak of a multiple-drug-resistant strain of Mycobacterium tuberculosis in New York.
Int. J. Tuberc. Lung Dis.
1:115-121[Medline].
|
| 20.
|
Mouneimne, H.,
J. Robert,
V. Jarlier, and E. Cambau.
1999.
Type II topoisomerase mutations in ciprofloxacin-resistant strains of Pseudomonas aeruginosa.
Antimicrob. Agents Chemother.
43:62-66[Abstract/Free Full Text].
|
| 21.
|
Ruiz, J.,
F. Marco,
P. Goni,
F. Gallardo,
J. Mensa,
A. Trilla,
T. Jimenez de Anta, and J. Vila.
1995.
High frequency of mutations at codon 83 of the gyrA gene of quinolone-resistant clinical isolates of Escherichia coli.
J. Antimicrob. Chemother.
36:737-738[Free Full Text].
|
| 22.
|
Swanberg, S. L., and J. C. Wang.
1987.
Cloning and sequencing of the Escherichia coli gyrA gene coding for the A subunit of DNA gyrase.
J. Mol. Biol.
197:729-736[CrossRef][Medline].
|
| 23.
|
Takenouchi, T.,
E. Sakagawa, and M. Sugawara.
1999.
Detection of gyrA mutations among 335 Pseudomonas aeruginosa strains isolated in Japan and their susceptibilities to fluoroquinolones.
Antimicrob. Agents Chemother.
43:406-409[Abstract/Free Full Text].
|
| 24.
|
Thomson, C. J.
1999.
The global epidemiology of resistance to ciprofloxacin and the changing nature of antibiotic resistance: a 10 year perspective.
J. Antimicrob. Chemother.
43(Suppl. A):31-40[Abstract/Free Full Text].
|
| 25.
|
Truong, Q. C.,
J. C. Nguyen Van,
D. Shlaes,
L. Gutmann, and N. J. Moreau.
1997.
A novel, double mutation in DNA gyrase A of Escherichia coli conferring resistance to quinolone antibiotics.
Antimicrob. Agents Chemother.
41:85-90[Abstract].
|
| 26.
|
Weigel, L. M.,
C. D. Steward, and F. C. Tenover.
1998.
gyrA mutations associated with fluoroquinolone resistance in eight species of Enterobacteriaceae.
Antimicrob. Agents Chemother.
42:2661-2667[Abstract/Free Full Text].
|
| 27.
|
Weller, R. E.,
C. W. Lyu,
C. Wolters, and R. M. Atlas.
1999.
Universities and the biological and toxin weapons convention.
ASM News
65:403-409.
|
| 28.
|
Wiedemann, B., and P. Heisig.
1994.
Mechanisms of quinolone resistance.
Infection
22:S73-S79.
|
| 29.
|
Wilson, D. L.,
S. R. Abner,
T. C. Newman,
L. S. Mansfield, and J. E. Linz.
2000.
Identification of ciprofloxacin-resistant Campylobacter jejuni by use of a fluorogenic PCR assay.
J. Clin. Microbiol.
38:3971-3978[Abstract/Free Full Text].
|
| 30.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura, and S. Nakamura.
1990.
Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli.
Antimicrob. Agents Chemother.
34:1271-1272[Abstract/Free Full Text].
|
| 31.
|
Yoshida, H.,
M. Bogaki,
M. Nakamura,
L. M. Yamanaka, and S. Nakamura.
1991.
Quinolone resistance-determining region in the DNA gyrase gyrB gene of Escherichia coli.
Antimicrob. Agents Chemother.
35:1647-1650[Abstract/Free Full Text].
|
| 32.
|
Zirnstein, G.,
Y. Li,
B. Swaminathan, and F. Angulo.
1999.
Ciprofloxacin resistance in Campylobacter jejuni isolates: detection of gyrA resistance mutations by mismatch amplification mutation assay PCR and DNA sequence analysis.
J. Clin. Microbiol.
37:3276-3280[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, October 2001, p. 3649-3655, Vol. 39, No. 10
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.10.3649-3655.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Espy, M. J., Uhl, J. R., Sloan, L. M., Buckwalter, S. P., Jones, M. F., Vetter, E. A., Yao, J. D. C., Wengenack, N. L., Rosenblatt, J. E., Cockerill, F. R. III, Smith, T. F.
(2006). Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing. Clin. Microbiol. Rev.
19: 165-256
[Abstract]
[Full Text]
-
Lomholt, J A, Kilian, M
(2003). Ciprofloxacin susceptibility of Pseudomonas aeruginosa isolates from keratitis. Br. J. Ophthalmol.
87: 1238-1240
[Abstract]
[Full Text]
-
Lapierre, P., Huletsky, A., Fortin, V., Picard, F. J., Roy, P. H., Ouellette, M., Bergeron, M. G.
(2003). Real-Time PCR Assay for Detection of Fluoroquinolone Resistance Associated with grlA Mutations in Staphylococcus aureus. J. Clin. Microbiol.
41: 3246-3251
[Abstract]
[Full Text]
-
Hurtle, W., Lindler, L., Fan, W., Shoemaker, D., Henchal, E., Norwood, D.
(2003). Detection and Identification of Ciprofloxacin-Resistant Yersinia pestis by Denaturing High-Performance Liquid Chromatography. J. Clin. Microbiol.
41: 3273-3283
[Abstract]
[Full Text]
-
Torres, M. J., Criado, A., Palomares, J. C., Aznar, J., Saunders, N., Edwards, K.
(2002). Detection of rpoB Mutations in Mycobacterium tuberculosis with LightCycler Technology. J. Clin. Microbiol.
40: 735-735
[Full Text]