Previous Article | Next Article 
Journal of Clinical Microbiology, October 2001, p. 3705-3708, Vol. 39, No. 10
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.10.3705-3708.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Rapid Differentiation of "Mycobacterium
canettii" from Other Mycobacterium
tuberculosis Complex Organisms by PCR-Restriction Analysis
of the hsp65 Gene
Khye Seng
Goh,
Eric
Legrand,
Christophe
Sola, and
Nalin
Rastogi*
Unité de la Tuberculose et des
Mycobactéries, Institut Pasteur de Guadeloupe, BP 484, F-97165 Pointe-à-Pitre Cedex, Guadeloupe
Received 15 February 2001/Returned for modification 13 May
2001/Accepted 1 July 2001
 |
ABSTRACT |
A total of 102 isolates of the Mycobacterium
tuberculosis complex, including available "M.
canettii" isolates, were studied by PCR-restriction analysis
of a 441-bp fragment of the hsp65 gene. PRA upon
HhaI enzyme digestion (GCGC) allowed easy
differentiatiation of "M. canettii" from other
members of the M. tuberculosis complex (three bands of
260, 105, and 60 bp for "M. canetti," compared to
four bands of 185, 105, 75, and 60 bp for other members of the
M. tuberculosis complex). Sequencing of the 441-bp
hsp65 fragment of "M. canettii"
isolates showed the disappearance of an HhaI site at
position 235 due to a C-to-T transition that corresponded to position
631 of the homologous hsp65 gene of M.
tuberculosis H37Rv. Considering that "M.
canettii" may also exist as a stable rough morphotype, we
suggest that the true number of "M. canettii" isolates may be underestimated in clinical microbiology laboratories.
| |
TEXT |
The Mycobacterium
tuberculosis complex includes five recognized members; M. tuberculosis and M. africanum are human pathogens, M. bovis is known to infect a wide range of domestic and
wild animals as well as humans, M. bovis BCG is a vaccine
strain with attenuated virulence, and M. microti is a
pathogen of small rodents. Another member named "M.
canettii" was added to this list of M. tuberculosis
complex organisms in 1997 (the name is given in quotation marks since
it does not yet appear on the approved list of bacterial names)
(16). In 1969, Georges Canetti, of the Institut Pasteur, Paris, France, was the first to isolate "M. canettii" in
France. It was isolated as a smooth-colony variant of M. tuberculosis from a 20-year-old farmer suffering from pulmonary
tuberculosis. The original isolate, isolate HB3177, was reported to be
virulent for guinea pigs and was temporarily designated "M.
tuberculosis var. canettii (negrei)." In
1969 and 1970, two other "M. tuberculosis var.
canettii" strains (strains HB3178 and HB3253) were
isolated from a 54-year-old dairy-farm worker who had lived in
Madagascar and who was suffering from pulmonary tuberculosis and from
the pus of a patient of unknown age in Papeete, French Polynesia, who
was suffering from adenitis of the armpit, respectively. These three
isolates were found to constitute a homogeneous group of isolates
within the M. tuberculosis complex and were deposited in the
Culture Collection of the Pasteur Institute-Tuberculosis (CIPT) under
the numbers CIPT140010059, CIPT140010060, and CIPT140010061, respectively. Studies of the cell wall glycolipids showed that a
single phenolic glycolipid (PGL-Tb1) was produced at high levels by
these isolates and may explain the smooth phenotype observed in
"M. canettii" strains (8, 10).
Recently, two other "M. canettii" strains were isolated
(11, 16) and were shown to be similar to the original
M. canettii strain; they had in common a single copy of
IS1081, two copies of IS6110, identical
recA gene sequences, and identical spoligotypes (11,
15, 16). In the present investigation, we have investigated M. tuberculosis complex organisms by PCR-restriction
analysis (PRA) of a 441-bp fragment of the hsp65 gene and
show that the "M. canettii" taxon may easily be
differentiated from other members of the M. tuberculosis
complex on the basis of a specific PRA signature upon HhaI digestion.
Bacterial isolates.
A total of 102 isolates of the M. tuberculosis complex were studied, including 50 isolates of
M. tuberculosis (48 clinical isolates and the type strains
M. tuberculosis H37Rv and H37Ra), 20 isolates of M. bovis (19 clinical isolates and the type strain M. bovis ATCC 19210), 10 isolates of M. bovis BCG (strains
001-Pasteur, 003-USA, 004-Denmark, 005-Glaxo, 006-Athens, 007-Japan,
008-Montreal, 009-Brazil, 011-Russia, and 012-Sweden), 15 isolates of
M. africanum (14 clinical isolates and the type strain
M. africanum ATCC 25420), and the following 7 isolates of
"M. canettii": the original "M. tuberculosis var. canettii" strain CIPT140010059 from
the Institut Pasteur as well as the same strain under the designation
9600046 maintained at the National Institute of Public Health and
Environment, Bilthoven, The Netherlands; strain 910563, isolated from a
patient in 1991 at the Institut Pasteur, Paris; strain 217/94, isolated from a 56-year-old Swiss patient (smooth colony type)
(11), and the same strain under the designation
9701549 maintained at the National Institute of Public Health and
Environment, which produced both smooth and rough colony types upon
culture in our laboratory; strain So93 (smooth colony type), isolated
from a 2-year-old Somali patient (16); and strain So93R
(rough colony type), obtained upon culture of a single colony of So93.
All isolates were grown on fresh Löwenstein-Jensen slants at
37°C, and biochemical tests and drug susceptibility testing were
performed by classical procedures (4). "M.
canettii" isolate 217/94 was kindly provided by Gaby Pfyffer,
Swiss National Center for Mycobacteria, Zurich, Switzerland,
"M. canettii" isolates 9600046, 9701549, 17727 (S093R), and 17728 (So93) were kindly provided by Dick van Soolingen,
Mycobacteria Laboratory, National Institute of Public Health and
Environment, whereas all other isolates including "M.
canettii" isolates CIPT140010059 and 910563 were from our own
culture collection.
PRA and sequencing of hsp65 gene.
DNA was
prepared by a glass bead method (5), and a 5-µl aliquot
of the supernatant containing the crude DNA extract was used for PCR.
Amplification was performed with primers Tb11
(5'-ACCAACGATGGTGTGTCCAT) and Tb12
(5'-CTTGTCGAACCGCATACCCT), which amplified a 441-bp fragment of the hsp65 gene (positions 396 to 836 of the published
sequence of M. tuberculosis H37Rv), followed by digestion of
the PCR product with BstEII (Promega, Madison, Wis.) and
with HaeIII, AciI, and HhaI (BioLabs
Inc., Beverly, Mass). After digestion, 12 µl of the restriction
digest was loaded onto a 3% (wt/vol) Metaphor agarose gel (FMC
Bioproducts, Rockland, Maine). An external molecular weight
marker (100 bp-ladder; AP Biotech, Uppsala, Sweden) was added to every
six lanes of migration to reduce migration-related errors. The
fragments were visualized using ethidium bromide; and the images
were captured on video, digitized, and analyzed with Gel-Analyst
software (Bioprobe Systems, Montreuil, France). The fragment lengths
were calculated with Taxotron software (Taxolab, Institut Pasteur,
Paris, France), as reported previously (5).
Sequencing of the hsp65 gene was performed as described
previously (9). Briefly, the 21M13 forward primer TB11
(5'-T GTAAAACGACGGCCAGTACCAACGATGGTGTGTCC AT-3')
and the M13 reverse primer TB12
(5'-CAGGAAACAGCTATGACCCTTGTCGAACCGCATACCCT-3') (underscores indicate forward and reverse primers [21M13 and M13, respectively]) were used to amplify a 441-bp portion of the
hsp65 gene (9, 13). The amplification product
(10 µl) was first checked by agarose gel electrophoresis, and 40 µl
was purified with the QIAquick PCR purification kit (Qiagen,
Courtaboeuf, France). The PCR product was sequenced with the
Thermo-Sequenase fluorescence-labeled-primer cycle sequencing kit
(AP-Biotech, Piscataway, N.J.) with fluorescent primers Cy5.5-Tb11 and
Cy.5.0-Tb12 (Visible Genetics Inc., Toronto, Ontario, Canada) on an
Opengene Long Read Tower sequencing system (Visible Genetics Inc.),
according to the manufacturer's instruction. All the sequencing data
are from two independent experiments, and any discrepancy was
systematically checked by sequencing a third time. Sequencing data were
compared by using the sequences in the GenBank database and the BlastN
algorithm (9).
The biochemical and cultural characteristics and drug
susceptibility patterns of the seven "
M. canettii"
strains studied are
summarized in Table
1. The available "
M.
canettii" isolates were
easily differentiated from
M. tuberculosis on the basis of their
morphologies (eugonic, smooth
colonies), a negative response for
niacin production and
-glucosidase enzyme activity, and resistance
to pyrazinamide and
streptomycin. "
M. canettii" was also easily
discriminated from
M. bovis and
M. bovis BCG on
the basis of its
colony morphology, its ability to reduce nitrates and
to hydrolyze
Tween 80 (10 days), and resistance to
thiophene-2-carboxylic acid
hydrazide. A positive response of
"
M. canettii" for urease enzyme
activity further
differentiated it from
M. bovis, whereas the
susceptibility
of "
M. canettii" to
D-cycloserine
and the resistance
of "
M. canettii" to clarithromycin
were able to discriminate it
from
M. bovis BCG (Table
1).
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Biochemical and cultural characteristics and drug
susceptibility testing results for various subspecies of M. tuberculosis complexa
|
|
The smooth colony type of "
M. canettii" may switch to
give a stable rough colony type which is not reversible even after
passage
in guinea pigs (
16). Interestingly, the switch
from the smooth
to the rough colony types did not alter the
biochemical, cultural,
and the drug resistance patterns of the
"
M. canettii" isolates
(Table
1), a fact already
observed at the level of the genetic
markers studied previously
(
16). It is possible that the switch
from the smooth
colony type to the rough colony type is linked
to changes in the lipid
composition of the cell wall, as shown
previously for
M. avium (
12), in which it is associated with
large
genomic deletions implicating either the
ser2 gene cluster
that encodes a glycopeptidolipid (GPL) haptenic oligosaccharide
in
serovar 2 isolates (
6), or may further encompass the genes
encoding lipopeptide biosynthesis, resulting in rough morphotypes
that
are devoid of any vestige of the GPL antigens (
1).
Although
the molecular basis of the transition from the smooth colony
type
to the rough colony type is not yet known for "
M.
canettii," Daffé
et al. (
3) have shown that,
in addition to its ability to produce
large amounts of triglycosyl
phenol phthiocerol glycolipid (PGL-Tb1),
smooth "
M.
canettii" strains also differ from the classical rough
M. tuberculosis strains by the presence of large amounts of a
characteristic lipooligosaccharides (LOSs), which is distinguished
by
the presence, among other sugars, of 2-
O-Me-Fuc,
2-
O-Me-Rha,
and 4-
O-Me-Rha (
3).
Interestingly, rough isolate So93R was
devoid of this characteristic
LOSs, which was present in smooth
isolate So93 (
16).
The results of PRA after digestions with
BstEII,
HaeIII,
AciI, and
HhaI are summarized
in Fig.
1. Although the results were
similar for all 102 isolates studied after the digestions with
BstEII (three fragments of 235, 120, and 80 bp; Fig.
1A),
HaeIII
(four fragments of 155, 130, 70, and 40 bp; Fig.
1B),
and
AciI
(three fragments of 185, 130, 90 bp; Fig.
1C), the
digestion of
the 441-bp PCR product with
HhaI clearly
differentiated "
M. canettii"
from all other isolates at
the subspecies level (Fig.
1D); it
resulted in three fragments of 260, 105, and 60 bp for "
M. canettii,"
whereas it resulted in
four fragments of 185, 105, 75, and 60
bp for
M. tuberculosis,
M. bovis, and
M. bovis BCG.
Thus, the
185- and 75-bp fragments that characterize the
M. tuberculosis complex by PRA upon
HhaI digestion were
apparently replaced by
a 260-bp fragment in "
M.
canettii" strains, probably due to the
disappearance of an
HhaI restriction site in these strains. Sequencing
of the
441-bp
hsp65 fragment (Fig.
1E) showed a single mutation
at
position 235 (C-to-T transition), which corresponds to position
631 of
the homologous
hsp65 gene of
M. tuberculosis
H37Rv (
2).
The disappearance of an
HhaI site
yielded four fragments with
theoretical sizes of 257, 103, 64, and 17 bp for "
M. canettii,"
whereas it yielded five fragments
with theoretical sizes of 185,
103, 72, 64, and 17 bp for
M. tuberculosis. However, as the fragment
of 17 bp is not visible on
the gels, it did correspond to a three-band
profile (bands of 260, 105, and 60 bp) for "
M. canettii" and a
four-band profile
(bands of 185, 105, 75, and 60 bp) for other
members of the
M. tuberculosis complex.
View larger version (71K):
[in this window]
[in a new window]
|
FIG. 1.
PRA patterns of the M. tuberculosis
complex organisms upon digestion of the 441-bp PCR product with
BstEII (A), HaeIII (B),
AciI (C), or HhaI (D) and the sequence of
the hsp65 fragment from "M. canettii"
(E). Lanes 1, M. tuberculosis; lanes 2, M.
bovis; lanes 3, M. bovis BCG; lanes 4, M.
africanum; lanes 5, "M. canettii"; lanes C,
negative control; lanes M, 100-bp ladder. The underlined portion in
panel E shows the single mutation at position 235 (C-to-T transition)
that is linked to the disappearance of a HhaI site and
that corresponds to position 631 of the homologous hsp65
gene of M. tuberculosis H37Rv.
|
|
Although the results of PRA after
BstEII,
HaeIII,
and
AciI enzyme digestions did not discriminate among the
various members
of the
M. tuberculosis complex, we found an
excellent correlation
between the theoretical sizes of the fragments
based on
hsp65 sequencing data and PRA results. Knowing that
bands
40 bp are
not easily visible on Metaphor gels, the values
obtained were
four theoretical fragments of 231, 116, 79, and 15 bp
versus three
observed bands of 235, 120, and 80 bp for
BstEII; seven theoretical
fragments of 152, 127, 69, 42, 22, 17, and 12 bp versus four bands
of 155, 130, 70, and 40 bp for
HaeIII; and three theoretical fragments
of 190, 148, and 103 bp versus three bands of 185, 130, and 90
bp for
AciI. This
unambiguously corroborated the reproducibility
of the PRA methodology
under the experimental conditions used
and justifies its routine use
for the identification of mycobacteria,
as established previously
(
5,
13,
14).
The "
M. canettii" taxon may be further characterized by
a specific spoligotyping signature, as recently demonstrated by the
publication of 26 new "
M. canettii"-specific spacers
(
15). Various
members of the
M. tuberculosis
complex (
M. bovis,
M. microti,
and
M. africanum) have recently been reported to bear specific
spoligotyping signatures (
7,
15,
17,
18); however, PRA
is
easier to use and shows a greater sensitivity than spoligotyping
for
the rapid detection of
M. tuberculosis complex isolates from
smear-positive clinical samples (our unpublished results) and
might be
useful for determination of the true number of "
M.
canettii"
isolates implicated in tuberculosis (human and/or
animal) in the
routine microbiology laboratory. Indeed, the
prevalence of "
M. canettii" taxon isolates may be
underestimated due to their close
similarity to
M. tuberculosis, particularly as the smooth colony
type easily
reverts to a give a stable rough colony type in "
M. canettii," as shown previously (
16) and during the
present investigation;
e.g., the original Swiss isolate 217/94 gave
both smooth and rough
colony types upon successive culture of derived
isolate 9701549.
However, irrespective of the smooth or rough colony
types, all
"
M. canettii" isolates available so far are
uniform in regard
to their cultural and biochemical properties,
spoligotyping signatures,
and other genetic markers such as the loss of
a
HhaI restriction
site, the presence of two to three copies
of IS
6110 and a single
copy of IS
1081 as
determined by restriction fragment length polymorphism
analysis,
and the sequence of the
recA gene. Further studies are
now
needed to discover the natural reservoir, host range, and
mode of
transmission of "
M. canettii" as well as the basis for
the transition from the smooth to the rough colony type, which
has not
been found in other members of the
M. tuberculosis complex.
| |
ACKNOWLEDGMENTS |
The authors are very grateful to Gaby Pfyffer, Swiss National
Center for Mycobacteria, and Dick van Soolingen, Mycobacteria Laboratory, National Institute of Public Health and Environment, for
providing the "M. canettii" strains.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
Pasteur, Morne Jolivière, BP 484, F-97165 Pointe-à-Pitre,
Cedex, Guadeloupe. Phone: 590-89 76 61. Fax: 590-89 38 80. E-mail:
rastogi{at}pasteur.gp.
| |
REFERENCES |
| 1.
|
Belisle, J. T.,
K. Klaczkiewics,
P. J. Brennan,
W. R. Jacobs, Jr., and J. M. Inamine.
1993.
Rough morphological variants of Mycobacterium avium: characterization of genomic deletions resulting in the loss of glycopeptidolipid expression.
J. Biol. Chem.
268:10517-10523[Abstract/Free Full Text].
|
| 2.
|
Cole, S. T.,
R. Brosch,
J. Parkhill,
T. Garnier,
C. Churcher,
D. Harris,
S. V. Gordon,
K. Eiglmeier,
S. Gas,
C. E. Bary III,
F. Tekaia,
K. Badcock,
D. Basham,
D. Brown,
T. Chillingworth,
R. Connor,
R. Davies,
K. Devlin,
T. Feltwell,
S. Gentles,
N. Hamlin,
S. Holroyd,
T. Hornsby,
K. Jagels,
A. Krogh,
J. McLean,
S. Moule,
L. Murphy,
K. Oliver,
J. Osborne,
M. A. Quail,
M.-A. Rajandream,
J. Rogers,
S. Rutter,
K. Seeger,
J. Skelton,
R. Squares,
S. Squares,
J. E. Sulston,
K. Taylor,
S. Whitehead, and B. G. Barrell.
1998.
Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence.
Nature
393:537-544[CrossRef][Medline].
|
| 3.
|
Daffé, M.,
M. McNeil, and P. Brennan.
1991.
Novel type-specific lipooligosaccharides from Mycobacterium tuberculosis.
Biochemistry
30:378-388[CrossRef][Medline].
|
| 4.
|
David, H.,
V. Lévy-Frébault, and M. F. Thorel.
1989.
Méthodes de laboratoire pour mycobactériologie clinique, p. 1-87.
Commission des Laboratoire de Référence et d'Expertise de l'Institut Pasteur, Institut Pasteur, Paris, France.
|
| 5.
|
Devallois, A.,
K. S. Goh, and N. Rastogi.
1997.
Rapid identification of mycobacteria to species level by PCR-restriction fragment length polymorphism analysis of the hsp65 gene and proposition of an algorithm to differentiate 34 mycobacterial species.
J. Clin. Microbiol.
35:2969-2973[Abstract].
|
| 6.
|
Eckstein, T. M.,
J. M. Inamine,
M. L. Lambert, and J. T. Belisle.
2000.
A genetic mechanism for deletion of the ser2 gene cluster and formation of rough morphological variant of Mycobacterium avium.
J. Bacteriol.
182:6177-6182[Abstract/Free Full Text].
|
| 7.
|
Kamerbeek, J.,
L. Schouls,
M. van Agterveld,
D. van Soolingen,
S. Kuijper,
A. Bunschoten,
H. Molhuizen,
R. Shaw,
M. Goyal, and J. D. A. van Embden.
1997.
Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology.
J. Clin. Microbiol.
35:907-914[Abstract].
|
| 8.
|
Laszlo, A.,
F. Papa, and H. L. David.
1992.
Thin-layer chromatography systems for the identification of Mycobacterium tuberculosis, M. bovis BCG, M. kansasii, M. gastri and M. marinum.
Res. Microbiol.
143:519-524[Medline].
|
| 9.
|
Legrand, E.,
K. S. Goh,
C. Sola, and N. Rastogi.
2000.
Description of a novel Mycobacterium simiae allelic variant isolated from Caribbean AIDS patients by PCR-restriction enzyme analysis and sequencing of hsp65 gene.
Mol. Cell. Probes
14:355-363[CrossRef][Medline].
|
| 10.
|
Papa, F.,
A. Laszlo, and H. L. David.
1988.
Specificity of Mycobacterium tuberculosis phenolic glycolipid (PGL-Tb1) antiserum.
Ann. Inst. Pasteur
139:535-545.
|
| 11.
|
Pfyffer, G. E.,
R. Auckenthaler,
J. D. A. van Embden, and D. van Soolingen.
1998.
Mycobacterium canettii, the smooth variant of M. tuberculosis, isolated from a Swiss patient exposed in Africa.
Emerg. Infect. Dis.
4:631-634[Medline].
|
| 12.
|
Rastogi, N.,
V. Lévy-Frébault,
M.-C. Blom-Potar, and H. L. David.
1989.
Ability of smooth and rough variants of Mycobacterium avium and M. intracellulare to multiply and survive intracellularly: role of C-mycosides.
Zentbl. Bakteriol. Parasitenkd. Infektkrankh. Hyg. Abt. 1 Orig. Reihe A
270:345-360.
|
| 13.
|
Ringuet, H.,
C. Akoua-Koffi,
S. Honore,
A. Varnerot,
V. Vincent,
P. Berche,
J. L. Gaillard, and C. Pierre-Audigier.
1999.
hsp65 sequencing for identification of rapidly growing mycobacteria.
J. Clin. Microbiol.
37:852-857[Abstract/Free Full Text].
|
| 14.
|
Telenti, A.,
F. Marchesi,
M. Balz,
F. Bally,
E. C. Böttger, and T. Bodmer.
1993.
Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis.
J. Clin. Microbiol.
31:175-178[Abstract/Free Full Text].
|
| 15.
|
van Embden, J. A. D.,
T. van Gorkom,
K. Kremer,
R. Jansen,
B. A. M. van der Zeijst, and L. M. Schouls.
2000.
Genetic variation and evolutionary origin of the direct repeat locus of Mycobacterium tuberculosis complex bacteria.
J. Bacteriol.
182:2393-2401[Abstract/Free Full Text].
|
| 16.
|
van Soolingen, D.,
T. Hoogenboezem,
P. E. W. de Haas,
P. W. M. Hermans,
M. A. Koedam,
K. S. Teppema,
P. J. Brennan,
G. S. Besra,
F. Portaels,
J. Top,
L. M. Schouls, and J. D. A. van Embden.
1997.
A novel pathogenic taxon of the Mycobacterium tuberculosis complex canetti: characterization of an exceptional isolate from Africa.
Int. J. Syst. Bacteriol.
47:1236-1245[Abstract/Free Full Text].
|
| 17.
|
van Soolingen, D.,
A. G. M. van der Zanden,
P. E. W. de Haas,
G. T. Noordhoek,
A. Kiers,
N. A. Foudraine,
F. Portaels,
A. H. J. Kolk,
K. Kremer, and J. D. A. van Embden.
1998.
Diagnosis of Mycobacterium microti infections among humans by using novel genetic markers.
J. Clin. Microbiol.
36:1840-1845[Abstract/Free Full Text].
|
| 18.
|
Viana-Niero, C.,
C. Gutierrez,
C. Sola,
I. Filliol,
F. Boulahbal,
V. Vincent, and N. Rastogi.
2001.
Genetic diversity of Mycobacterium africanum clinical isolates based on IS6110-restriction fragment length polymorphism analysis, spoligotyping, and variable number of tandem DNA repeats.
J. Clin. Microbiol.
39:57-65[Abstract/Free Full Text].
|
Journal of Clinical Microbiology, October 2001, p. 3705-3708, Vol. 39, No. 10
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.10.3705-3708.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Somoskovi, A., Dormandy, J., Mayrer, A. R., Carter, M., Hooper, N., Salfinger, M.
(2009). "Mycobacterium canettii" Isolated from a Human Immunodeficiency Virus-Positive Patient: First Case Recognized in the United States. J. Clin. Microbiol.
47: 255-257
[Abstract]
[Full Text]
-
Bergval, I. L., Vijzelaar, R. N. C. P., Dalla Costa, E. R., Schuitema, A. R. J., Oskam, L., Kritski, A. L., Klatser, P. R., Anthony, R. M.
(2008). Development of Multiplex Assay for Rapid Characterization of Mycobacterium tuberculosis. J. Clin. Microbiol.
46: 689-699
[Abstract]
[Full Text]
-
Somoskovi, A., Dormandy, J., Parsons, L. M., Kaswa, M., Goh, K. S., Rastogi, N., Salfinger, M.
(2007). Sequencing of the pncA Gene in Members of the Mycobacterium tuberculosis Complex Has Important Diagnostic Applications: Identification of a Species-Specific pncA Mutation in "Mycobacterium canettii" and the Reliable and Rapid Predictor of Pyrazinamide Resistance. J. Clin. Microbiol.
45: 595-599
[Abstract]
[Full Text]
-
Huard, R. C., Fabre, M., de Haas, P., Claudio Oliveira Lazzarini, L., van Soolingen, D., Cousins, D., Ho, J. L.
(2006). Novel Genetic Polymorphisms That Further Delineate the Phylogeny of the Mycobacterium tuberculosis Complex.. J. Bacteriol.
188: 4271-4287
[Abstract]
[Full Text]
-
Goh, K. S., Rastogi, N., Berchel, M., Huard, R. C., Sola, C.
(2005). Molecular Evolutionary History of Tubercle Bacilli Assessed by Study of the Polymorphic Nucleotide within the Nitrate Reductase (narGHJI) Operon Promoter. J. Clin. Microbiol.
43: 4010-4014
[Abstract]
[Full Text]
-
Fabre, M., Koeck, J.-L., Le Fleche, P., Simon, F., Herve, V., Vergnaud, G., Pourcel, C.
(2004). High Genetic Diversity Revealed by Variable-Number Tandem Repeat Genotyping and Analysis of hsp65 Gene Polymorphism in a Large Collection of "Mycobacterium canettii" Strains Indicates that the M. tuberculosis Complex Is a Recently Emerged Clone of "M. canettii". J. Clin. Microbiol.
42: 3248-3255
[Abstract]
[Full Text]
-
Tortoli, E.
(2003). Impact of Genotypic Studies on Mycobacterial Taxonomy: the New Mycobacteria of the 1990s. Clin. Microbiol. Rev.
16: 319-354
[Abstract]
[Full Text]
-
Huard, R. C., de Oliveira Lazzarini, L. C., Butler, W. R., van Soolingen, D., Ho, J. L.
(2003). PCR-Based Method To Differentiate the Subspecies of the Mycobacterium tuberculosis Complex on the Basis of Genomic Deletions. J. Clin. Microbiol.
41: 1637-1650
[Abstract]
[Full Text]
Top
Abstract
Text
