Previous Article | Next Article ![]()
Journal of Clinical Microbiology, October 2001, p. 3796-3798, Vol. 39, No. 10
Clinical Microbiology and Public Health
Laboratory, Addenbrooke's Hospital, Cambridge CB2
2QW,1 and Camelia Botnar Laboratories,
Great Ormond St. Hospital for Children, London WC1N
3JH,2 United Kingdom
Received 15 March 2001/Returned for modification 21 June
2001/Accepted 11 July 2001
Rotavirus strains collected in the United Kingdom during the
1995-1996 season and genotyped as G2 by reverse
transcription-PCR failed to serotype in enzyme-linked immunosorbent
assays using three different G2-specific monoclonal antibodies. The
deduced amino acid sequences of the antigenic regions A (amino acids 87 to 101), B (amino acids 142 to 152), and C (amino acids 208 to 221) of
VP7 revealed that a substitution at position 96 (Asp Rotaviruses are triple-layered
particles of the Reoviridae family that contain 11 segments
of double-stranded RNA. The outer layer is composed of VP7 and VP4
proteins, encoded by gene segments 9, 7, or 8 (depending on the strain)
and 4, respectively (8). These two proteins elicit
neutralizing antibody responses and form the basis for the dual
classification system of rotaviruses into G and P types, the
designations being derived from glycoprotein (VP7) and
protease-sensitive protein (VP4), respectively (8). Comparative sequence analyses of the deduced VP7 amino acid
sequences of different animal and human rotavirus serotypes have
identified six serotype-specific variable regions (VR) between amino
acids (aa) 39 and 50, aa 87 and 101, aa 120 and 130, aa 143 and 152, aa
208 and 221, and aa 233 and 242, and these have been designated VR4 to
VR9 (9, 11). VR5, VR7, and VR8 correspond to the antigenic regions A, B, and C, respectively, which have been confirmed as major
rotavirus neutralization sites by mapping of neutralization escape mutants (6, 7, 16, 17).
Serotyping using G type-specific monoclonal antibodies (MAbs) has been
applied widely in rotavirus epidemiological studies. However, the
results of many studies have been incomplete due to the limited
availability of MAbs specific for types other than G1 to G4, the
relatively low sensitivity of the method due mainly to the requirement
of intact virus particles, or to the existence of monotypes or antibody
escape mutants within the different G types (2-4).
Monotypes within G1, G2, G3, and G4 rotaviruses react with different
degrees of affinity against different panels of G-specific MAbs
(21) .
Previously we reported that rotavirus strains collected in the United
Kingdom during the 1995-1996 season and genotyped by reverse
transcription-PCR as G2 failed to serotype in enzyme-linked immunosorbent assays (ELISAs) using G2-specific MAbs (13).
Complementary DNAs of the VP7 genes of a subset of these strains were
partially sequenced and compared to corresponding sequences of a subset of successfully serotyped G2 strains collected during 1990 and 1991 in
order to identify amino acid substitutions at the VP7 antigenic sites
that may be responsible for the failure to react with different
G2-specific MAbs.
G-serotyping ELISAs and genotyping reverse transcription-PCRs were
performed as previously described (1, 10, 13) using 10%
rotavirus-positive fecal suspensions in balanced salt solution. G-serotyping ELISAs (13) were performed using three
different G2-specific MAbs (S2-2G10 [23], RV5:3
[5] and IC10 [20]). The presence of
intact VP7 was confirmed in an ELISA using a cross-reactive MAb
(MAb/60 [22]).
Twenty-one G2 rotavirus strains isolated in the United
Kingdom Sequencing of the VP7 amplicons was performed using an automated
sequencing system (Beckman CQ2000). Primers specific for conserved
regions of the VP7 gene were used for amplification and sequencing of
an 884-bp region of the gene: VP7-F (nucleotides 49 to 71), 5'
ATGTATGGTATTGAATATACCAC 3', and VP7-R (nucleotides 914 to 933),
5' AACTTGCCACCATTTTTTCC 3'. Sequence data were analyzed using the SeqMan and Megalign (both of the DNAstar software package; Lasergene) software programs.
The presence of the VP7 protein in samples that failed to serotype was
confirmed by reactivity in an ELISA using the cross-reactive MAb/60.
None of the 10 G2 nonreactive specimens cross-reacted with G1-, G3-, or
G4-specific MAbs (data not shown).
The alignment of the deduced amino acid sequences of the VP7 genes
revealed amino acid substitutions at positions 87 (Ala
0095-1137/01/$04.00+0 DOI: 10.1128/JCM.39.10.3796-3798.2001
Copyright © 2001, American Society for Microbiology. All rights reserved.
Amino Acid Substitution within the VP7 Protein of G2 Rotavirus
Strains Associated with Failure To Serotype
![]()
ABSTRACT
Top
Abstract
Text
References
Asn) correlated
with the change in ability to serotype these G2 strains.
![]()
TEXT
Top
Abstract
Text
References
including (i) 10 rotavirus strains from the 1995-1996 rotavirus season which failed to serotype using all three G2-specific
MAbs, (ii) 9 strains from an archival collection of rotaviruses from the season 1990-1991 that had been successfully serotyped using MAb
RV5:3 (19), and (iii) 2 strains isolated during the
1998-1999 rotavirus season for which the serotype was not
determined
were selected for sequencing of the VP7 cDNA.
Thr) and 96 (Asp
Asn), both located within antigenic region A (aa 87 to 101).
These were the only consistent differences between the strains that
were successfully serotyped using MAb RV5:3 and those that failed to
serotype with all three G2-specific MAbs (Table 1). Random mutations were found in
antigenic sites B and C (Table 1) and in other areas of the sequenced
VP7 fragment (data not shown) but were not significantly associated
with the ability or inability to serotype. The loss of reactivity with
G2-specific MAbs (RV3:1 and RV5:4) of one G2 rotavirus strain isolated
in Australia (strain 1076) had previously been correlated with amino acid substitutions in antigenic regions B and C, at positions 147, 213, and 217 (4). However, in our study no consistent differences were found in antigenic regions B and C between strains that were serotyped and those that failed to serotype (Table 1). The sequences of antigenic region A of the strains which were successfully serotyped were identical to those of the prototype G2
strains RV5, S2, and DS-1 and two human strains which had been serotyped successfully in Australia (Human/Australia/5/77
[Hu/Aus/5/77] and 92a-Australia [92A-Aus]) (Table 1). The
prototype serotype G2 strain HN126 (11) typeable by
G2-specific MAbs possessed a single amino acid substitution, Ala
Thr
at position 87 (Table 1), strongly suggesting that this amino acid
substitution is therefore not responsible for the antigenic change
leading to a failure to react with G2-specific MAbs.
TABLE 1.
Deduced amino acid sequences of the VP7 antigenic site A
of rotavirus G2 strainsa
Thus, the amino acid substitution at position 96 (Asp
Asn) is likely
to be responsible for the failure to react with the G2-specific MAbs.
All strains sequenced with an amino acid substitution at position 96 also had an amino acid substitution at position 87. The substitution at
position 96 in the absence of a substitution at position 87 has been
found in experiments with rotavirus antibody escape mutants (MAb RV5:4)
(17). This substitution induces a change in electric
charge and may result in a conformational change of the epitopes
recognized by neutralizing antibodies. Although the epitopes recognized
by rotavirus neutralizing antibodies have not been completely defined,
it has been proposed that antigenic regions A and C which are distant
in the linear molecule interact closely together in the folded form of
the VP7 molecule (7).
The sequences of VP7 antigenic region A of the strains isolated during 1998 and 1999 were identical to those isolated in 1995 and 1996, and it appears that these two substitutions are being maintained over time. These mutants can therefore be regarded as antibody escape mutants that are widely dispersed geographically and are identical to G2 strains isolated post-1993 in Taiwan, where an epidemic caused by G2 rotavirus strains in 1993 was reported (24). It was suggested that the epidemic in Taiwan was associated with an alteration in pathogenicity, perhaps conferred by reassortment (24). However, the explosive reemergence of G2 strains in this region may have been due to immune evasion as a consequence of altered antigenicity conferred by the amino acid substitution at position 96 of antigenic region A. The lack of cross-protection conferred from previous infections with G2 strains may also explain the higher incidence of infection with rotavirus G2 strains found in the older population in the United Kingdom between 1995 and 1999 (12).
Genetic drift through the accumulation of point mutations (14) and genetic shift through reassortment (15) are thought to be the major mechanisms associated with rotavirus evolution. Although some point mutations appear to be localized both temporally and geographically (14), others become stable, giving origin to global genetic lineages (15, 18) and monotypes of the different G and P types circulating synchronously worldwide. In this context, the usefulness of the G-type-specific MAbs is likely to be time limited as a result of the accumulation of point mutations at their corresponding epitopes.
| |
ACKNOWLEDGMENTS |
|---|
We thank R. Bishop, K. Taniguchi, and H. Greenberg for kindly providing the VP7-specific MAbs.
This work was supported by a grant from the Public Health Laboratory Service.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Clinical Microbiology and Public Health Laboratory, Addenbrooke's Hospital, Hills Rd., Cambridge CB2 2QW, United Kingdom. Phone: 44-1223-586925. Fax: 44-1223-242775. E-mail: mirren.iturriza-gomara{at}addenbrookes.nhs.uk.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Boom, R.,
C. J. A. Sol,
M. M. M. Salismans,
C. L. P. M. E. Jansen,
P. M. Wertheim-van Dillen, and J. van den Noordaa.
1990.
Rapid and simple method for the purification of nucleic acids.
J. Clin. Microbiol.
28:495-503 |
| 2. | Coulson, B. S. 1996. VP4 and VP7 typing using monoclonal antibodies. Arch. Virol. Suppl. 12:113-118[Medline]. |
| 3. |
Coulson, B. S., and C. Kirkwood.
1991.
Relation of VP7 amino acid sequence to monoclonal antibody neutralization of rotavirus and rotavirus monotype.
J. Virol.
65:5968-5974 |
| 4. |
Coulson, B. S.,
C. D. Kirkwood,
P. J. Masendycz,
R. F. Bishop, and G. Gerna.
1996.
Amino acids involved in distinguishing between monotypes of rotavirus G serotypes 2 and 4.
J. Gen. Virol.
77:239-245 |
| 5. |
Coulson, B. S.,
L. Unicomb,
G. Pitson, and R. Bishop.
1987.
Simple and specific enzyme immunoassay using monoclonal antibodies for serotyping human rotaviruses.
J. Clin. Microbiol.
25:509-515 |
| 6. |
Dyall-Smith, M. L., and I. H. Holmes.
1984.
Sequence homology between human and animal rotavirus serotype-specific glycoproteins.
Nucleic Acids Res.
12:3973-3982 |
| 7. |
Dyall-Smith, M. L.,
I. Lazdins,
G. W. Tregear, and I. H. Holmes.
1986.
Location of the major antigenic sites involved in rotavirus serotype-specific neutralization.
Proc. Natl. Acad. Sci. USA
83:3465-3468 |
| 8. | Estes, M. 1996. Rotaviruses and their replication, p. 1625-1655. In B. N. Fields, et al. (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa. |
| 9. | Glass, R. I., J. Keith, O. Nakagomi, T. Nakagomi, J. Askaa, A. Z. Kapikian, R. M. Chanock, and J. Flores. 1985. Nucleotide sequence of the structural glycoprotein VP7 gene of Nebraska calf diarrhea virus rotavirus: comparison with homologous genes from four strains of human and animal rotaviruses. Virology 141:292-298[CrossRef][Medline]. |
| 10. |
Gouvea, V.,
R. I. Glass,
P. Woods,
K. Taniguchi,
H. F. Clark,
B. Forrester, and Z. Y. Fang.
1990.
Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens.
J. Clin. Microbiol.
28:276-282 |
| 11. | Green, K., K. Midhun, M. Gorziglia, Y. Hoshino, A. Kapikian, R. Chanock, and J. Flores. 1987. Comparison of the amino acid sequences of the major neutralisation protein of four human rotavirus serotypes. Virology 161:153-159[CrossRef][Medline]. |
| 12. | Iturriza-Gómara, M., J. Green, D. Brown, M. Ramsay, U. Desselberger, and J. Gray. 2000. Molecular epidemiology of human group A rotavirus infections in the United Kingdom between 1995 and 1998. J. Clin. Microbiol. 38:4094-4401. |
| 13. | Iturriza-Gómara, M., J. Green, D. W. Brown, U. Desselberger, and J. J. Gray. 1999. Comparison of specific and random priming in the reverse transcriptase polymerase chain reaction for genotyping group A rotaviruses. J. Virol. Methods 78:93-103[CrossRef][Medline]. |
| 14. |
Iturriza-Gómara, M.,
J. Green,
D. W. Brown,
U. Desselberger, and J. J. Gray.
2000.
Diversity within the VP4 gene of rotavirus P[8] strains: implications for reverse transcription-PCR genotyping.
J. Clin. Microbiol.
38:898-901 |
| 15. |
Iturriza-Gómara, M.,
B. Isherwood,
U. Desselberger, and J. Gray.
2001.
Reassortment in vivo: a driving force for diversity of human rotavirus strains isolated in the United Kingdom between 1995 and 1999.
J. Virol.
75:3696-3705 |
| 16. | Kirkwood, C., P. J. Masendycz, and B. S. Coulson. 1993. Characteristics and location of cross-reactive and serotype-specific neutralization sites on VP7 of human G type 9 rotaviruses. Virology 196:79-88[CrossRef][Medline]. |
| 17. | Lazdins, I., B. S. Coulson, C. Kirkwood, M. Dyall Smith, P. J. Masendycz, S. Sonza, and I. H. Holmes. 1995. Rotavirus antigenicity is affected by the genetic context and glycosylation of VP7. Virology 209:80-89[CrossRef][Medline]. |
| 18. | Maunula, L., and C. H. von Bonsdorff. 1998. Short sequences define genetic lineages: phylogenetic analysis of group A rotaviruses based on partial sequences of genome segments 4 and 9. J. Gen. Virol. 79:321-332[Abstract]. |
| 19. |
Noel, J. S.,
S. P. Parker,
K. Choules,
A. D. Phillips,
J. Walker Smith, and W. D. Cubitt.
1994.
Impact of rotavirus infection on a paediatric hospital in the east end of London.
J. Clin. Pathol.
47:67-70 |
| 20. |
Padilla-Noriega, L.,
C. F. Arias,
S. López,
F. Puerto,
D. R. Snodgrass,
K. Taniguchi, and H. B. Greenberg.
1990.
Diversity of rotavirus serotypes in Mexican infants with gastroenteritis.
J. Clin. Microbiol.
28:1114-1119 |
| 21. |
Raj, P.,
D. O. Matson,
B. S. Coulson,
R. F. Bishop,
K. Taniguchi,
S. Urasawa,
H. B. Greenberg, and M. K. Estes.
1992.
Comparisons of rotavirus VP7-typing monoclonal antibodies by competition binding assay.
J. Clin. Microbiol.
30:704-711 |
| 22. |
Shaw, R.,
D. Stoner-Ma,
M. Estes, and H. Greenberg.
1985.
Specific enzyme-linked immunoassay for rotavirus serotypes 1 and 3.
J. Clin. Microbiol.
22:286-291 |
| 23. | Taniguchi, K., T. Urasawa, Y. Morita, H. Greenberg, and S. Urasawa. 1987. Direct serotyping of human rotavirus in stools by an enzyme-linked immunosorbent assay using 1-, 2-, 3-, and 4-specific monoclonal antibodies to VP7. J. Infect. Dis. 155:1159-1166[Medline]. |
| 24. | Zao, C. L., W. N. Yu, C. L. Kao, K. Taniguchi, C. Y. Lee, and C. N. Lee. 1999. Sequence analysis of VP1 and VP7 genes suggests occurrence of a reassortant of G2 rotavirus responsible for an epidemic of gastroenteritis. J. Gen. Virol. 80:1407-1415[Abstract]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»